Exercise Promotes Hippocampal Neurogenesis in T2DM Mice via Irisin/TLR4/MyD88/NF-κB-Mediated Neuroinflammation Pathway
Abstract
:Simple Summary
Abstract
1. Introduction
2. Methods
2.1. Animal Experimentation
2.2. T2DM Models
2.3. Drug Administration Protocol
2.4. Exercise Training Protocol
2.5. Morris Water Maze (MWM) Test
2.6. Immunofluorescence Staining
2.7. Western Blot Analysis
2.8. Quantitative RT-PCR
2.9. Statistical Analysis
3. Results
3.1. Hippocampal Neurogenesis Is Impaired in Diabetes but Restored after Exercise Intervention
3.2. Exercise Alleviates Neuroinflammation in the Hippocampus
3.3. Exercise Affects Microglial Activation Patterns in the Hippocampus
3.4. Exercise Decreases TLR4/MyD88/NF-kB Pathways but Is Inhibited by Cyclo RGDyk Treatment
3.5. Cyclo RGDyk Treatment Reverses Microglial Activation and Hippocampal Neurogenesis Impairment
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
T2DM | Type 2 diabetic mellitus |
STZ | Streptozocin |
AHN | Adult hippocampal neurogenesis |
TLR4 | Toll-like receptor 4 |
MyD88 | Myeloid differential protein-88 |
NF-κB | Nuclear factor kappa-B |
TNF-α | Tumor necrosis factor-α |
IL-1β | Interleukin-1β |
IFNγ | Interferon-γ |
Arg-1 | Arginase 1 |
TGF-β1 | Transforming growth factor-β |
FBG | Fasting blood glucose |
SDS-PAGE | Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis |
DAPI | 4′,6-diamidino-2-phenylindole |
Iba-1 | Ionized calcium-binding adapter molecule 1 |
iNOS | Inducible nitric oxide synthase |
CD206 | Mannose Receptor |
DCX | -doublecortin |
FNDC5 | Fibronectin type III domain-containing protein 5 |
ANOVA | Analysis of variance |
References
- Sun, H.; Saeedi, P.; Karuranga, S.; Pinkepank, M.; Ogurtsova, K.; Duncan, B.B.; Stein, C.; Basit, A.; Chan, J.C.N.; Mbanya, J.C.; et al. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res. Clin. Pract. 2022, 183, 109119. [Google Scholar] [CrossRef] [PubMed]
- Mauricio, D.; Alonso, N.; Gratacòs, M. Chronic diabetes complications: The need to move beyond classical concepts. Trends Endocrinol. Metab. 2020, 31, 287–295. [Google Scholar] [CrossRef] [PubMed]
- McCrimmon, R.J.; Ryan, C.M.; Frier, B.M. Diabetes and cognitive dysfunction. Lancet 2012, 379, 2291–2299. [Google Scholar] [CrossRef] [PubMed]
- Ho, N.; Sommers, M.S.; Lucki, I. Effects of diabetes on hippocampal neurogenesis: Links to cognition and depression. Neurosci. Biobehav. Rev. 2013, 37, 1346–1362. [Google Scholar] [CrossRef] [PubMed]
- Toda, T.; Parylak, S.L.; Linker, S.B.; Gage, F.H. The role of adult hippocampal neurogenesis in brain health and disease. Mol. Psychiatry 2019, 24, 67–87. [Google Scholar] [CrossRef]
- Mu, Y.; Gage, F.H. Adult hippocampal neurogenesis and its role in Alzheimer’s disease. Mol. Neurodegener. 2011, 6, 85. [Google Scholar] [CrossRef]
- Lang, H.-L.; Zhao, Y.-Z.; Xiao, R.-J.; Sun, J.; Chen, Y.; Hu, G.-W.; Xu, G.-H. Small extracellular vesicles secreted by induced pluripotent stem cell-derived mesenchymal stem cells improve postoperative cognitive dysfunction in mice with diabetes. Neural Regen. Res. 2023, 18, 609–617. [Google Scholar]
- Asslih, S.; Damri, O.; Agam, G. Neuroinflammation as a common denominator of complex diseases (cancer, diabetes type 2, and neuropsychiatric disorders). Int. J. Mol. Sci. 2021, 22, 6138. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Yang, M.; Wang, Y.; Ren, J.; Lin, P.; Cui, C.; Song, J.; He, Q.; Hu, H.; Wang, K.; et al. Melatonin prevents diabetes-associated cognitive dysfunction from microglia-mediated neuroinflammation by activating autophagy via TLR4/Akt/mTOR pathway. FASEB J. 2021, 35, e21485. [Google Scholar] [CrossRef]
- Boche, D.; Perry, V.H.; Nicoll, J.A. Review: Activation patterns of microglia and their identification in the human brain. Neuropathol. Appl. Neurobiol. 2013, 39, 3–18. [Google Scholar] [CrossRef]
- Mills, C.D.; Kincaid, K.; Alt, J.M.; Heilman, M.J.; Hill, A.M. M-1/M-2 macrophages and the Th1/Th2 paradigm. J. Immunol. 2000, 164, 6166–6173. [Google Scholar] [CrossRef] [PubMed]
- Perry, V.H.; Teeling, J. Microglia and macrophages of the central nervous system: The contribution of microglia priming and systemic inflammation to chronic neurodegeneration. Semin. Immunopathol. 2013, 35, 601–612. [Google Scholar] [CrossRef] [PubMed]
- Xiong, X.-Y.; Liu, L.; Yang, Q.-W. Functions and mechanisms of microglia/macrophages in neuroinflammation and neurogenesis after stroke. Prog. Neurobiol. 2016, 142, 23–44. [Google Scholar] [CrossRef] [PubMed]
- Cherry, J.D.; Olschowka, J.A.; O’Banion, M.K. Neuroinflammation and M2 microglia: The good, the bad, and the inflamed. J. Neuroinflamm. 2014, 11, 98. [Google Scholar] [CrossRef]
- Marques-Aleixo, I.; Beleza, J.; Sampaio, A.; Stevanović, J.; Coxito, P.; Gonçalves, I.; Ascensão, A.; Magalhães, J. Preventive and therapeutic potential of physical exercise in neurodegenerative diseases. Antioxid. Redox Signal. 2021, 34, 674–693. [Google Scholar] [CrossRef]
- Colberg, S.R.; Sigal, R.J.; Yardley, J.E.; Riddell, M.C.; Dunstan, D.W.; Dempsey, P.C.; Horton, E.S.; Castorino, K.; Tate, D.F. Physical activity/exercise and diabetes: A position statement of the American Diabetes Association. Diabetes Care 2016, 39, 2065. [Google Scholar] [CrossRef]
- Fiuza-Luces, C.; Santos-Lozano, A.; Joyner, M.; Carrera-Bastos, P.; Picazo, O.; Zugaza, J.L.; Izquierdo, M.; Ruilope, L.M.; Lucia, A. Exercise benefits in cardiovascular disease: Beyond attenuation of traditional risk factors. Nat. Rev. Cardiol. 2018, 15, 731–743. [Google Scholar] [CrossRef] [PubMed]
- Pereira, A.C.; Huddleston, D.E.; Brickman, A.M.; Sosunov, A.A.; Hen, R.; McKhann, G.M.; Sloan, R.; Gage, F.H.; Brown, T.R.; Small, S.A. An in vivo correlate of exercise-induced neurogenesis in the adult dentate gyrus. Proc. Natl. Acad. Sci. USA 2007, 104, 5638–5643. [Google Scholar] [CrossRef]
- Horowitz, A.M.; Fan, X.; Bieri, G.; Smith, L.K.; Sanchez-Diaz, C.I.; Schroer, A.B.; Gontier, G.; Casaletto, K.B.; Kramer, J.H.; Williams, K.E.; et al. Blood factors transfer beneficial effects of exercise on neurogenesis and cognition to the aged brain. Science 2020, 369, 167–173. [Google Scholar] [CrossRef]
- Van Praag, H.; Kempermann, G.; Gage, F.H. Running increases cell proliferation and neurogenesis in the adult mouse dentate gyrus. Nat. Neurosci. 1999, 2, 266–270. [Google Scholar] [CrossRef]
- Choi, S.H.; Bylykbashi, E.; Chatila, Z.K.; Lee, S.W.; Pulli, B.; Clemenson, G.D.; Kim, E.; Rompala, A.; Oram, M.K.; Asselin, C. Combined adult neurogenesis and BDNF mimic exercise effects on cognition in an Alzheimer’s mouse model. Science 2018, 361, eaan8821. [Google Scholar] [CrossRef] [PubMed]
- Ridler, C. Exercise wards off Alzheimer disease by boosting neurogenesis and neuroprotective factors. Nat. Rev. Neurol. 2018, 14, 632. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Dong, Y.; Tucker, D.; Wang, R.; Ahmed, M.E.; Brann, D.; Zhang, Q. Treadmill exercise exerts neuroprotection and regulates microglial polarization and oxidative stress in a streptozotocin-induced rat model of sporadic Alzheimer’s disease. J. Alzheimer’s Dis. 2017, 56, 1469–1484. [Google Scholar] [CrossRef] [PubMed]
- Ryan, S.M.; Nolan, Y.M. Neuroinflammation negatively affects adult hippocampal neurogenesis and cognition: Can exercise compensate? Neurosci. Biobehav. Rev. 2016, 61, 121–131. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Valverde, P.; Zhu, X.; Murray, D.; Wu, Y.; Yu, L.; Jiang, H.; Dard, M.M.; Huang, J.; Xu, Z. Exercise-induced irisin in bone and systemic irisin administration reveal new regulatory mechanisms of bone metabolism. Bone Res. 2017, 5, 16056. [Google Scholar] [CrossRef]
- Wang, Y.; Tian, M.; Tan, J.; Pei, X.; Lu, C.; Xin, Y.; Deng, S.; Zhao, F.; Gao, Y.; Gong, Y. Irisin ameliorates neuroinflammation and neuronal apoptosis through integrin αVβ5/AMPK signaling pathway after intracerebral hemorrhage in mice. J. Neuroinflamm. 2022, 19, 82. [Google Scholar] [CrossRef]
- Islam, M.R.; Valaris, S.; Young, M.F.; Haley, E.B.; Luo, R.; Bond, S.F.; Mazuera, S.; Kitchen, R.R.; Caldarone, B.J.; Bettio, L.E. Exercise hormone irisin is a critical regulator of cognitive function. Nat. Metab. 2021, 3, 1058–1070. [Google Scholar] [CrossRef]
- Kim, H.; Wrann, C.D.; Jedrychowski, M.; Vidoni, S.; Kitase, Y.; Nagano, K.; Zhou, C.; Chou, J.; Parkman, V.-J.A.; Novick, S.J.; et al. Irisin Mediates Effects on Bone and Fat via αV Integrin Receptors. Cell 2018, 175, 1756–1768. [Google Scholar] [CrossRef]
- Wei, X.; Gao, J.; Zhan, C.; Xie, C.; Chai, Z.; Ran, D.; Ying, M.; Zheng, P.; Lu, W. Liposome-based glioma targeted drug delivery enabled by stable peptide ligands. J. Control Release 2015, 218, 13–21. [Google Scholar] [CrossRef]
- Huber, J.D.; VanGilder, R.L.; Houser, K.A. Streptozotocin-induced diabetes progressively increases blood-brain barrier permeability in specific brain regions in rats. Am. J. Physiol. Heart Circ. Physiol. 2006, 291, H2660–H2668. [Google Scholar] [CrossRef]
- Mooradian, A.D.; Haas, M.J.; Batejko, O.; Hovsepyan, M.; Feman, S.S. Statins ameliorate endothelial barrier permeability changes in the cerebral tissue of streptozotocin-induced diabetic rats. Diabetes 2005, 54, 2977–2982. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; He, X.; Wang, K.; Xue, Y.; Hu, S.; Jin, Y.; Zhu, G.; Shi, Q.; Rui, Y. Irisin alleviates obesity-induced bone loss by inhibiting interleukin 6 expression via TLR4/MyD88/NF-κB axis in adipocytes. J. Adv. Res. 2024; in press. [Google Scholar] [CrossRef]
- Mazur-Bialy, A.I.; Pocheć, E.; Zarawski, M. Anti-Inflammatory Properties of Irisin, Mediator of Physical Activity, Are Connected with TLR4/MyD88 Signaling Pathway Activation. Int. J. Mol. Sci. 2017, 18, 701. [Google Scholar] [CrossRef]
- Shao, Q.H.; Chen, Y.; Li, F.F.; Wang, S.; Zhang, X.L.; Yuan, Y.H.; Chen, N.H. TLR4 deficiency has a protective effect in the MPTP/probenecid mouse model of Parkinson’s disease. Acta Pharmacol. Sin. 2019, 40, 1503–1512. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.-t.; Bian, C.; Yuan, J.-c.; Chu, W.-h.; Xiang, X.; Chen, F.; Wang, C.-s.; Feng, H.; Lin, J.-k. Curcumin attenuates acute inflammatory injury by inhibiting the TLR4/MyD88/NF-κB signaling pathway in experimental traumatic brain injury. J. Neuroinflamm. 2014, 11, 59. [Google Scholar] [CrossRef] [PubMed]
- Rolls, A.; Shechter, R.; London, A.; Ziv, Y.; Ronen, A.; Levy, R.; Schwartz, M. Toll-like receptors modulate adult hippocampal neurogenesis. Nat. Cell Biol. 2007, 9, 1081–1088. [Google Scholar] [CrossRef]
- Takahashi, M.; Chen-Yoshikawa, T.F.; Menju, T.; Ohata, K.; Kondo, T.; Motoyama, H.; Hijiya, K.; Aoyama, A.; Date, H. Inhibition of Toll-like receptor 4 signaling ameliorates lung ischemia-reperfusion injury in acute hyperglycemic conditions. J. Heart Lung Transpl. 2016, 35, 815–822. [Google Scholar] [CrossRef]
- Jiang, Q.; Yi, M.; Guo, Q.; Wang, C.; Wang, H.; Meng, S.; Liu, C.; Fu, Y.; Ji, H.; Chen, T. Protective effects of polydatin on lipopolysaccharide-induced acute lung injury through TLR4-MyD88-NF-κB pathway. Int. Immunopharmacol. 2015, 29, 370–376. [Google Scholar] [CrossRef]
- Lu, M.; Zhang, Q.; Chen, K.; Xu, W.; Xiang, X.; Xia, S. The regulatory effect of oxymatrine on the TLR4/MyD88/NF-κB signaling pathway in lipopolysaccharide-induced MS1 cells. Phytomedicine 2017, 36, 153–159. [Google Scholar] [CrossRef]
- Latz, E.; Xiao, T.S.; Stutz, A. Activation and regulation of the inflammasomes. Nat. Rev. Immunol. 2013, 13, 397–411. [Google Scholar] [CrossRef]
- Locksley, R.M.; Killeen, N.; Lenardo, M.J. The TNF and TNF receptor superfamilies: Integrating mammalian biology. Cell 2001, 104, 487–501. [Google Scholar] [CrossRef]
- Cao, Y.; Han, X.; Wang, Z.; Liu, Y.; Wang, Y.; Zhang, R.; Ye, J.; Zou, L.; Dai, W. TLR4 knockout ameliorates streptozotocin-induced osteoporosis in a mouse model of diabetes. Biochem. Biophys. Res. Commun. 2021, 546, 185–191. [Google Scholar] [CrossRef] [PubMed]
- Lourenco, M.V.; Frozza, R.L.; de Freitas, G.B.; Zhang, H.; Kincheski, G.C.; Ribeiro, F.C.; Gonçalves, R.A.; Clarke, J.R.; Beckman, D.; Staniszewski, A.; et al. Exercise-linked FNDC5/irisin rescues synaptic plasticity and memory defects in Alzheimer’s models. Nat. Med. 2019, 25, 165–175. [Google Scholar] [CrossRef]
- Svensson, M.; Lexell, J.; Deierborg, T. Effects of Physical Exercise on Neuroinflammation, Neuroplasticity, Neurodegeneration, and Behavior: What We Can Learn From Animal Models in Clinical Settings. Neurorehabil. Neural Repair. 2015, 29, 577–589. [Google Scholar] [CrossRef]
- Sood, A.; Fernandes, V.; Preeti, K.; Rajan, S.; Khatri, D.K.; Singh, S.B. S1PR2 inhibition mitigates cognitive deficit in diabetic mice by modulating microglial activation via Akt-p53-TIGAR pathway. Int. Immunopharmacol. 2024, 126, 111278. [Google Scholar] [CrossRef]
- Preeti, K.; Sood, A.; Fernandes, V.; Khan, I.; Khatri, D.K.; Singh, S.B. Experimental Type 2 diabetes and lipotoxicity-associated neuroinflammation involve mitochondrial DNA-mediated cGAS/STING axis: Implication of Type-1 interferon response in cognitive impairment. Mol. Neurobiol. 2024, 61, 6217–6244. [Google Scholar] [CrossRef] [PubMed]
- DeFronzo, R.A.; Ferrannini, E.; Groop, L.; Henry, R.R.; Herman, W.H.; Holst, J.J.; Hu, F.B.; Kahn, C.R.; Raz, I.; Shulman, G.I. Type 2 diabetes mellitus. Nat. Rev. Dis. Primers 2015, 1, 15019. [Google Scholar] [CrossRef]
- Roberts, R.O.; Knopman, D.S.; Przybelski, S.A.; Mielke, M.M.; Kantarci, K.; Preboske, G.M.; Senjem, M.L.; Pankratz, V.S.; Geda, Y.E.; Boeve, B.F. Association of type 2 diabetes with brain atrophy and cognitive impairment. Neurology 2014, 82, 1132–1141. [Google Scholar] [CrossRef]
- Tumminia, A.; Vinciguerra, F.; Parisi, M.; Frittitta, L. Type 2 diabetes mellitus and Alzheimer’s disease: Role of insulin signalling and therapeutic implications. Int. J. Mol. Sci. 2018, 19, 3306. [Google Scholar] [CrossRef]
- Hawley, J.A. Exercise as a therapeutic intervention for the prevention and treatment of insulin resistance. Diabetes/Metab. Res. Rev. 2004, 20, 383–393. [Google Scholar] [CrossRef]
- De Miguel, Z.; Khoury, N.; Betley, M.J.; Lehallier, B.; Willoughby, D.; Olsson, N.; Yang, A.C.; Hahn, O.; Lu, N.; Vest, R.T. Exercise plasma boosts memory and dampens brain inflammation via clusterin. Nature 2021, 600, 494–499. [Google Scholar] [CrossRef]
- Wanrooy, B.J.; Kumar, K.P.; Wen, S.W.; Qin, C.X.; Ritchie, R.H.; Wong, C.H. Distinct contributions of hyperglycemia and high-fat feeding in metabolic syndrome-induced neuroinflammation. J. Neuroinflamm. 2018, 15, 293. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Jin, K. Current perspectives on the link between neuroinflammation and neurogenesis. Metab. Brain Dis. 2015, 30, 355–365. [Google Scholar] [CrossRef] [PubMed]
- Rivest, S. Regulation of innate immune responses in the brain. Nat. Rev. Immunol. 2009, 9, 429–439. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Wu, S.; Hong, Z.; Chen, X.; Shan, X.; Fischbach, S.; Xiao, X. Chronic hyperglycemia regulates microglia polarization through ERK5. Aging 2019, 11, 697. [Google Scholar] [CrossRef] [PubMed]
- Papageorgiou, I.E.; Lewen, A.; Galow, L.V.; Cesetti, T.; Scheffel, J.; Regen, T.; Hanisch, U.-K.; Kann, O. TLR4-activated microglia require IFN-γ to induce severe neuronal dysfunction and death in situ. Proc. Natl. Acad. Sci. USA 2016, 113, 212–217. [Google Scholar] [CrossRef]
- Li, D.-J.; Li, Y.-H.; Yuan, H.-B.; Qu, L.-F.; Wang, P. The novel exercise-induced hormone irisin protects against neuronal injury via activation of the Akt and ERK1/2 signaling pathways and contributes to the neuroprotection of physical exercise in cerebral ischemia. Metabolism 2017, 68, 31–42. [Google Scholar] [CrossRef]
- Dresler, M.; Sandberg, A.; Ohla, K.; Bublitz, C.; Trenado, C.; Mroczko-Wąsowicz, A.; Kühn, S.; Repantis, D. Non-pharmacological cognitive enhancement. Neuropharmacology 2013, 64, 529–543. [Google Scholar] [CrossRef]
- Rahmati, M.; Keshvari, M.; Mirnasouri, R.; Chehelcheraghi, F. Exercise and Urtica dioica extract ameliorate hippocampal insulin signaling, oxidative stress, neuroinflammation, and cognitive function in STZ-induced diabetic rats. Biomed. Pharmacother. 2021, 139, 111577. [Google Scholar] [CrossRef]
- Rom, S.; Zuluaga-Ramirez, V.; Gajghate, S.; Seliga, A.; Winfield, M.; Heldt, N.A.; Kolpakov, M.A.; Bashkirova, Y.V.; Sabri, A.K.; Persidsky, Y. Hyperglycemia-driven neuroinflammation compromises BBB leading to memory loss in both diabetes mellitus (DM) type 1 and type 2 mouse models. Mol. Neurobiol. 2019, 56, 1883–1896. [Google Scholar] [CrossRef]
- Bassani, T.B.; Bonato, J.M.; Machado, M.M.; Cóppola-Segovia, V.; Moura, E.L.; Zanata, S.M.; Oliveira, R.M.; Vital, M.A. Decrease in adult neurogenesis and neuroinflammation are involved in spatial memory impairment in the streptozotocin-induced model of sporadic Alzheimer’s disease in rats. Mol. Neurobiol. 2018, 55, 4280–4296. [Google Scholar] [CrossRef]
- Zhao, R. Exercise mimetics: A novel strategy to combat neuroinflammation and Alzheimer’s disease. J. Neuroinflamm. 2024, 21, 40. [Google Scholar] [CrossRef] [PubMed]
- Zhao, R. Irisin at the crossroads of inter-organ communications: Challenge and implications. Front. Endocrinol. 2022, 13, 989135. [Google Scholar] [CrossRef] [PubMed]
- Maak, S.; Norheim, F.; Drevon, C.A.; Erickson, H.P. Progress and Challenges in the Biology of FNDC5 and Irisin. Endocr. Rev. 2021, 42, 436–456. [Google Scholar] [CrossRef] [PubMed]
- Perakakis, N.; Triantafyllou, G.A.; Fernandez-Real, J.M.; Huh, J.Y.; Park, K.H.; Seufert, J.; Mantzoros, C.S. Physiology and role of irisin in glucose homeostasis. Nat. Rev. Endocrinol. 2017, 13, 324–337. [Google Scholar] [CrossRef]
Name | Primer Sequence (5′ to 3′) |
---|---|
IL-1β | F:TCAGCACCTCACAAGCAGAG R:TTCTTGTGACCCTGAGCGAC |
TNF-α | F:TGTCCCTTTCACTCACTGGC R:TCTTCTGCCAGTTCCACGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, H.; Tian, X.; Wang, Y.; Lin, J.; Zhu, B.; Zhao, C.; Wang, B.; Zhang, X.; Sun, Y.; Li, N.; et al. Exercise Promotes Hippocampal Neurogenesis in T2DM Mice via Irisin/TLR4/MyD88/NF-κB-Mediated Neuroinflammation Pathway. Biology 2024, 13, 809. https://doi.org/10.3390/biology13100809
Xu H, Tian X, Wang Y, Lin J, Zhu B, Zhao C, Wang B, Zhang X, Sun Y, Li N, et al. Exercise Promotes Hippocampal Neurogenesis in T2DM Mice via Irisin/TLR4/MyD88/NF-κB-Mediated Neuroinflammation Pathway. Biology. 2024; 13(10):809. https://doi.org/10.3390/biology13100809
Chicago/Turabian StyleXu, Haocheng, Xin Tian, Yuanxin Wang, Junjie Lin, Baishu Zhu, Chen Zhao, Bin Wang, Xin Zhang, Yu Sun, Nan Li, and et al. 2024. "Exercise Promotes Hippocampal Neurogenesis in T2DM Mice via Irisin/TLR4/MyD88/NF-κB-Mediated Neuroinflammation Pathway" Biology 13, no. 10: 809. https://doi.org/10.3390/biology13100809
APA StyleXu, H., Tian, X., Wang, Y., Lin, J., Zhu, B., Zhao, C., Wang, B., Zhang, X., Sun, Y., Li, N., Sun, X., Zeng, F., Li, M., Ya, X., & Zhao, R. (2024). Exercise Promotes Hippocampal Neurogenesis in T2DM Mice via Irisin/TLR4/MyD88/NF-κB-Mediated Neuroinflammation Pathway. Biology, 13(10), 809. https://doi.org/10.3390/biology13100809