Next Article in Journal
Correlation Between Antimicrobial Consumption and Resistance in Klebsiella pneumoniae During the COVID-19 Pandemic Using Dynamic Regression Models: A Quasi-Experimental Epidemiological Time-Series Study
Next Article in Special Issue
Multicentric Surveillance of Antimicrobial Resistance to Generate Data-Driven Regional Antibiograms: A Laboratory-Based Cross-Sectional Study in Pakistan
Previous Article in Journal
Antimicrobial: Antibiofilm, Anti-Quorum Sensing and Cytotoxic Activities of Dorystoechas hastata Boiss & Heldr. ex Bentham Essential Oil
Previous Article in Special Issue
Beyond Culture: Real-Time PCR Performance in Detecting Causative Pathogens and Key Antibiotic Resistance Genes in Hospital-Acquired Pneumonia
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

ISApl4, a New IS1595 Family Insertion Sequence Forming a Novel Pseudo-Compound Transposon That Confers Antimicrobial Multidrug Resistance in Actinobacillus pleuropneumoniae

by
Janine T. Bossé
1,†,
Yanwen Li
1,†,
Marc Stegger
2,3,
Liza Miriam Cohen
4,
Øystein Angen
5,
Søren Overballe-Petersen
5,
Dennis Hanke
6,7,
Stefan Schwarz
6,7,*,
Paul R. Langford
1,‡ and
Henrike Krüger-Haker
6,7,*,‡
1
Section of Paediatric Infectious Disease, Department of Infectious Disease, Imperial College London, South Kensington Campus, London SW7 2AZ, UK
2
Department of Sequencing and Bioinformatics, Statens Serum Institut, 2300 Copenhagen, Denmark
3
Antimicrobial Resistance and Infectious Diseases Laboratory, Harry Butler Institute, Murdoch University, Murdoch, Perth, WA 6150, Australia
4
Department of Production Animal Clinical Sciences, Faculty of Veterinary Medicine, Norwegian University of Life Sciences (NMBU), NO-1432 Ås, Norway
5
Department of Bacteria, Parasites and Fungi, Statens Serum Institut, 2300 Copenhagen, Denmark
6
Institute of Microbiology and Epizootics, School of Veterinary Medicine, Freie Universität Berlin, 14163 Berlin, Germany
7
Veterinary Centre for Resistance Research (TZR), School of Veterinary Medicine, Freie Universität Berlin, 14163 Berlin, Germany
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
These authors contributed equally to this work.
Antibiotics 2025, 14(10), 1021; https://doi.org/10.3390/antibiotics14101021
Submission received: 2 September 2025 / Revised: 29 September 2025 / Accepted: 8 October 2025 / Published: 14 October 2025
(This article belongs to the Special Issue Antibiotic Therapy in Respiratory Tract Infections (RTIs))

Abstract

Background/Objectives: Actinobacillus pleuropneumoniae is an important respiratory tract pathogen of swine worldwide. Insertion sequences (ISs) play a major role in the transfer of antimicrobial resistance (AMR) among various porcine respiratory tract pathogens. In this study, three A. pleuropneumoniae genomes were investigated for the presence of a novel IS. Methods: Analysis of the draft genomes of three A. pleuropneumoniae serovar 8 isolates (AP_1, AP_120, AP_123) suggested the presence of a novel IS. A closed whole-genome sequence was generated for strain AP_123 by hybrid assembly of Oxford Nanopore MinION long-reads and Illumina MiSeq short-reads, followed by sequence analysis using standard online tools. Transfer was tested by natural transformation. Antimicrobial susceptibility testing was conducted by broth microdilution following Clinical and Laboratory Standards Institute standards. Results: A novel IS, designated ISApl4, was detected in all three genomes. ISApl4 is 712 bp in size and has a transposase gene (tnp) of 654 bp. Moreover, it has perfect terminal 14-bp inverted repeats and produces 8-bp direct repeats at its integration site. This IS was found in 39 copies in the AP_123 genome, two of which formed the 5,765-bp pseudo-compound transposon Tn7560. This transposon carries four AMR genes: sul2 (sulfonamide resistance), strA-strB (streptomycin resistance), and tet(Y) (tetracycline resistance). RT-PCR confirmed tnp gene expression and horizontal transfer of Tn7560 into A. pleuropneumoniae MIDG2331. Conclusions: This study identified the novel ISApl4 in porcine A. pleuropneumoniae and its association with the novel pseudo-compound transposon Tn7560, which proved to be an active element capable of disseminating multidrug resistance amongst A. pleuropneumoniae.

1. Introduction

Horizontal transfer of antimicrobial resistance (AMR) genes amongst bacteria that infect livestock not only has an impact on the costs of food animal production but also increases the risk of transmission of resistant bacteria among and between animals, as well as to humans [1,2,3]. Actinobacillus pleuropneumoniae, a member of the Pasteurellaceae family, is one of the most important respiratory pathogens of swine and is responsible for major economic losses worldwide [4]. Despite increased regulatory restrictions in many countries, control of porcine pleuropneumonia still depends on the judicious use of antimicrobial agents during outbreaks, as commercially available vaccines are not fully efficacious against all A. pleuropneumoniae serovars and do not prevent colonization [5]. Levels of resistance to various antimicrobial agents differ between countries, reflecting preferred treatment regimens (e.g., choice of antimicrobial agents, dosage, and treatment duration). For example, several countries have reported high levels of tetracycline resistance in A. pleuropneumoniae [6,7], whereas in Denmark and Norway, most isolates remain susceptible to this agent [8,9].
There are more than 50 known genes that confer resistance to tetracyclines (http://faculty.washington.edu/marilynr/ (accessed on 29 September 2025)). However, until recently, only eight were found in A. pleuropneumoniae and other Pasteurellaceae species of veterinary origin, including tet(A), tet(B), tet(C), tet(G), tet(H), and tet(L), which encode efflux proteins, as well as tet(M) and tet(O), which encode ribosome protective proteins [1]. Of these, most have been found on plasmids and/or integrative and conjugative elements (ICEs), and some have been further associated with other mobile genetic elements (MGEs), such as transposons and insertion sequences (ISs) [1]. Most recently, a ninth tetracycline resistance gene, tet(Y), which so far has mainly been seen in various Gammaproteobacteria, including Escherichia coli, Salmonella enterica, Acinetobacter spp., and Moraxella spp., has been identified on several novel multidrug-resistance (MDR)-mediating ICEs in porcine and bovine Pasteurella multocida [10,11] as well as bovine Mannheimia haemolytica [12] from Germany, but not yet in A. pleuropneumoniae.
ISs are small MGEs, typically ≤3 kb, that generally only carry a gene for a transposase required for their movement between genetic locations. They are a ubiquitous and diverse type of MGEs, which are found in most bacterial genomes and can be grouped into different families based on common features, such as (i) the type of transposase (with catalytic site conservation), (ii) the similarity of the terminal inverted repeats, (iii) the target-site preference, and (iv) the length of the flanking repeats (i.e., the target site duplications) generated upon insertion [13,14]. Currently, there are at least 26 families of ISs, some of which can be further differentiated into subgroups with an ever-expanding database, ISfinder (https://www-is.biotoul.fr (accessed on 29 September 2025)), as new elements are discovered in the growing number of publicly available bacterial genomes. The transposition of ISs can either have a neutral effect on the genome or result in insertions that either increase or decrease bacterial fitness [15,16]. Regulation of transposition by IS- and/or host-mediated mechanisms is common, and IS copies may be eliminated from the genome via deletions and rearrangements [13]. Loss of ISs may leave “scars”, i.e., partial sequences lacking intact tnp genes and/or flanking inverted repeat (IR) sequences, and many bacterial genomes show evidence of ancestral transposition events [13].
Selective pressure for the dissemination of IS elements can occur through the formation of compound (also known as composite) transposons or pseudo-compound transposons, both carrying beneficial genes, such as those conferring AMR, flanked by two copies of the IS element [17,18]. Based on the orientation of the terminal ISs, compound (or composite) transposons and pseudo-compound transposons are differentiated [18]. While the ISs in the first type of transposons are in opposite orientation, structures bounded by directly oriented ISs are referred to as pseudo-compound transposons [18]. Despite the initial definition only including members of the IS26 family [18], it may also apply to members of other IS families. After compound transposons are acquired by horizontal transfer into a host bacterium, they can transpose into different locations in the chromosomal DNA or plasmids (if present) as an intact transposon. Alternatively, each copy of the IS element can further transpose separately [15]. This can lead to a rapid expansion of IS copies in a genome, with possible subsequent elimination as discussed above. In the case of pseudo-compound transposons, the two terminal ISs can recombine and form a translocatable unit (TU) that consists of the part between the two ISs and one copy of the IS [19]. This short-lived circular intermediate can again recombine with other copies of the respective IS either in the chromosomal DNA or on plasmids and, thereby, promote its change of location within the same cell. If, however, a TU integrates into an ICE, it can be exchanged across strain, species or genus boundaries as part of this conjugative MGE [20].
Three IS elements have been reported previously in A. pleuropneumoniae. ISApl1, a functional IS30 element, was identified in serovar 7 isolates [21]; whereas ISApl2 and ISApl3 (which are 98% identical) are members of the IS3 family but are predicted to be non-functional due to an internal frameshift mutation in the tnp gene. The former was from an unidentified isolate, the sequence of which was deposited directly in the ISfinder database, and the latter was identified in the genome of the serovar 5 reference strain L20 (https://www-is.biotoul.fr/list_names_attributed.php (accessed on 29 September 2025)). In a comparative analysis of draft genome sequences of A. pleuropneumoniae serovar 8 isolates from the United Kingdom (UK), Denmark, and Norway [8], three Norwegian isolates (AP_1, AP_120, and AP_123) were identified as the first A. pleuropneumoniae isolates carrying the tet(Y) gene along with other resistance genes. Further analysis of their draft genomes suggested the presence of a novel IS, designated ISApl4. In this study, the structure and function of ISApl4, as well as a novel pseudo-compound MDR transposon, carrying ISApl4 copies in the same orientation at its termini, were investigated in detail.

2. Results

2.1. Identification of ISApl4

In the draft genomes of the three Norwegian A. pleuropneumoniae isolates of serovar 8 (AP_1, AP_120, and AP_123), we identified an IS of 712 bp that carried a single reading frame of 654 bp encoding a predicted transposase of 217 aa. This IS, designated ISApl4, was bounded by perfect IRs of 14 bp (5′-GGGGCTGTACTAGA-3′). A sequence with the greatest identity of 99.58% (=709/712 bp) to ISApl4 was detected by blastn in the genomes of two Moraxella spp. isolates, FZLJ2107 and FZLJ2109, from pigs in China (GenBank accession nos. CP101111 and CP101112), each of which carried three identical copies of this ISApl4-related element. There were three differences at the nucleotide sequence level seen in comparison to ISApl4, all of which were located within the tnp reading frame. Two of them, G233A and G262A, changed the aa sequence to R78H and G88S, respectively, while the third, C276T, did not affect the V at position 92 in the deduced transposase protein sequence. Slightly lower nucleotide sequence identities, all ranging between 95.51% and 91.29% were seen with various Moraxella isolates, including Moraxella veridica ATCC 23246 (GenBank accession no. CP170124), Moraxella canis of not further specified origin from Finland (GenBank accession no. CP139961), several bovine Moraxella bovoculi isolates from China (GenBank accession nos. CP195518 and CP195440) or the United States of America (USA) (GenBank accession nos. CP011381, CP011380, CP011379, CP011378, CP011377, CP011376, and CP011374), and a Moraxella ovis isolate that was recovered from a cow in Norway already in 1959 (GenBank accession no. CP011158).
In contrast, the blastp analysis indicated that the ISApl4-encoded transposase protein shares 100% identity with IS1016 subgroup transposases of Mannheimia haemolytica from a cow in the Netherlands (GenBank accession no. HDL1205338), or isolates of P. multocida from cattle in Australia (GenBank accession nos. MDY0626729, MDY0678315, MDY0682612, and MDY0710592), from turkeys in the USA (GenBank accession nos. HDR1109752 and HEA3246051), and from a pig in the USA (GenBank accession no. HEH9724036). The next-related ISApl4-encoded transposase proteins are those from Moraxella spp. isolates FZLJ2107 and FZLJ2109 with 99.08% (215/217 aa). The discrepancy between the blastn and blastp results might be because for some protein sequences, the associated nucleotide sequences are not available in the databases to which blastn has access.
Further inspection of the ISApl4 sequence revealed that it is a DDE transposase, having a predicted catalytic site sequence, E-DESYFG(53)VYTD----Y(24)HINGIENFWSQAK(14)LFIKECEFRFN, characteristic of transposases of IS1016 elements, which are a subfamily of IS1595 elements [22,23].
Sequences matching either the 5′ or 3′ ends of the 712-bp sequence were mapped to multiple contigs in each of the AP_1, AP_120, and AP_123 draft genomes. By comparison to the complete closed genomes of other serovar 8 strains 405 and MIDG2331, mapping of the partial 5′ and 3′ ends of the ISApl4 element (with regard to flanking genes) indicated 18 ISApl4 insertions in AP_1, with 16 of these also seen in AP_120, along with a further nine insertions not found in AP_1. The AP_123 genome contains 39 ISApl4 insertions, with only four (including the two that represent part of a pseudo-compound transposon) being the same as in the other two isolates, as well as three in the same location, but opposite orientation.
To confirm the insertion sites predicted for the draft genomes, and to determine if any recombination events might have been mediated by the multiple copies of ISApl4, a closed genome sequence was generated for AP_123 (GenBank accession no. CP110664), the isolate containing the highest number of insertion sites (Figure 1). The predicted insertion sites detected in the draft genome were confirmed in the closed genome (Table 1). There was only one rearrangement detected, i.e., an inversion of a sequence containing the cpxR gene and most of the cpxA gene found between two closely spaced copies of ISApl4. The CpxRA system controls the expression of genes involved in biofilm formation [24,25,26,27].
Only the closed AP_123 genome allowed confident mapping of both flanks of each insertion. Detailed analysis of the integration sites in AP_123 revealed that ISApl4 produced preferably A/T-rich 8-bp direct repeats (DRs) immediately up- and downstream of its integration sites (Table 1). This observation is in agreement with the 7–9-bp DRs seen with other IS1016 elements [22]. These 8-bp DRs were identified for all but four ISApl4 insertions, i.e., those associated with the pseudo-compound transposon and those associated with the inverted sequence in the cpxRA region.
Most mapped insertions, including those of ISApl4 copies 1–2, 4–7, 9–10, 14–15, 17, 21, 26–30, and 34–35 (Table 1), were located in non-coding intergenic regions, although some were within genes, including several known or predicted to contribute to virulence. Thus, ISApl4 copy 3 was located within a gene encoding a drug/metabolite transporter (DMT) family EamA domain-containing protein. ISApl4 copy 8 was found within the gene tadA encoding a CpaF family protein/tight adherence protein A. ISApl4 copy 11 was inserted into a gene encoding a sulfatase N-terminal domain-containing protein, and ISApl4 copy 12 was located in a gene encoding a tetratricopeptide repeat (TPR) protein. The gene udk encoding a uridine kinase was interrupted by the insertion of ISApl4 copy 16. ISApl4 copy 19 was inserted into the phosphate regulon transcriptional regulator gene phoB, while copy 20 was within a gene encoding a Tex family protein. ISApl4 copy 22 was inserted into the manX gene encoding the phosphotransferase system (PTS) mannose transporter subunit IIAB. ISApl4 copy 23 was detected within a gene encoding a lipopolysaccharide (LPS) O-antigen chain length determinant protein of the WzzB/FepE family. ISApl4 copy 24 inactivated the gene encoding an N-6 DNA methylase/class I S-adenosyl methionine (SAM)-dependent DNA methyltransferase, while ISApl4 copy 25 was found within the wzxE gene encoding the lipid III flippase WzxE, a LPS biosynthesis protein. ISApl4 copy 31 disrupted the mutY gene encoding an A/G-specific adenine glycosylase, and ISApl4 copy 32 was within a gene encoding a DUF1523 domain-containing protein. Finally, ISApl4 copies 13, 18 and 33 were inserted into genes for hypothetical proteins.

2.2. Analysis of the Tn7560 Sequence

Tn7560 (https://transposon.lstmed.ac.uk/ (accessed on 29 September 2025)) is a pseudo-compound transposon of 5765 bp in size. The 4341-bp sequence between the two identical ISApl4 elements located in the same orientation harboured four different AMR genes: the sulfonamide resistance gene sul2, the streptomycin resistance genes strA-strB, and the tetracycline resistance gene tet(Y). The blastn analysis of this 4341-bp segment revealed the highest nucleotide sequence identities of ≥99.70% each to two segments, one comprising tet(Y), strA and strB and the other sul2, that are part of chromosomally located Tn7406 and Tn7406-related ICEs of German bovine P. multocida (GenBank accession no. CP172107.1) [11] and M. haemolytica isolates (GenBank accession nos. CP128531.1 (Tn7724), CP128523.1 (Tn7727), and CP087379.1) [12,28]. Similarly high nucleotide sequence identities were detected in the 97,979-bp plasmid pB2126 and the chromosomal DNA of several Pseudomonas spp. isolates, all of fish product origin from France (GenBank accession nos. CP162591.1, CP162591.1, CP162581.1, CP162583.1) as well as in the 158,867-bp plasmid pAT205 of an Acinetobacter towneri isolate of swine faeces origin from China (GenBank accession no. CP048015) (Figure 2). The 3,265-bp sequence containing the tet(Y) and strA-strB genes is also 100% identical to sequences from other Acinetobacter species recovered in China (GenBank accession nos. CP029397 and CP010351), as well as part of the 48,493-bp low GC conjugative plasmid pFK2-7 (GenBank accession no. KT325596) from an uncultured bacterium isolated from cattle feces in the Czech Republic [29]. However, plasmid pFK2-7 does not encode either sul2 or any IS1595-type tnp gene. Sequences identical to the sul2-strA-strB gene arrangement seen in Tn7560 have been identified in other Pasteurellaceae ICEs, such as those seen in P. multocida isolates FCf83 and FCf71 (GenBank accession nos. CP038875 and CP038872) and Glaesserella parasuis isolates GHP1807 and YHP170504 (GenBank accession nos. CP071491 and CP054198).
In the Tn7560 sequence, the sul2 gene is 852 bp in size rather than the 816 bp present in most sul2 GenBank entries. The reason for this is that the final “A” in the translational termination codon “TAA” is replaced by a “T”, thereby extending the sul2 reading frame by 36 bp and generating an alternative stop codon. This expanded sul2 reading frame overlaps the 5′ end of strA by 14 bp. The identical sequence has been found previously on plasmid pYFC1 from M. haemolytica [30]. Another interesting observation is the lack of the tet(Y)-associated tetR gene in Tn7560. Many tet genes specifying efflux-mediated tetracycline resistance in Gram-negative bacteria are regulated by the interplay between Tet repressor and Tet efflux proteins. This is also true for most known tetR-tet(Y) operons found in the aforementioned closely related sequences. Nevertheless, the tet(Y) gene in Tn7560 seems to be functional as the respective A. pleuropneumoniae isolates AP_1, AP_120, and AP_123 exhibited tetracycline minimal inhibitory concentrations (MICs) of 8 or 16 µg/mL (Table 2), classifying them as tetracycline-resistant according to the Clinical and Laboratory Standards Institute (CLSI)-approved A. pleuropneumoniae-specific clinical breakpoints [31]. A previous report on the tetracycline resistance gene tet(L) also identified that this gene was functional in M. haemolytica and Mannheimia glucosida without its regulatory region [32].
The closed AP_123 genome also enabled mapping of the insertion site of Tn7560 in a region upstream of the dld gene, which encodes a D-lactate dehydrogenase. As no insertion site could be mapped upstream of dld in AP_1 or AP_120, the transposon insertion site must be different in these isolates.

2.3. Single Nucleotide Polymorphism (SNP) Analysis

Comparing the genomes of AP_1, AP_120, AP_123, and 405, using the MIDG2331 chromosome as a reference, detected a total of 15,603 SNPs across all isolates in a 2.10 Mb core genome. MIDG2331 and 405 were separated by ~400 SNPs but differed by >15,000 SNPs compared to the three Norwegian isolates. Among the latter three isolates, AP_1 and AP_120 were almost identical, with only six SNP differences, whereas AP_123 contained between 111 and 113 SNP differences compared to AP_1 and AP_120, respectively. An in-depth analysis confirmed that the differences between the isolates of Norwegian origin were not due to recombination [8].

2.4. Confirmation of ISApl4 Activity

Expression of the tnp gene was confirmed by reverse transcription (RT)-PCR in AP_1, AP_120 and AP_123 (Figure 3a), indicating that the gene is actively transcribed in these isolates. The amplicons generated using RNA extracted from cultures grown in the presence of 5 µg/mL tetracycline appeared slightly more intense than those from cultures grown in non-selective medium; this difference was minor and not quantified. Inverse PCR confirmed the presence of a 718-bp circular intermediate of the ISApl4 element present in DNA extracted from each of AP_1, AP_120 and AP_123 (Figure 3b), indicating that the 8-bp DR sequences flanking the element facilitate excision during transposition.
Transfer of the pseudo-compound transposon to another strain of A. pleuropneumoniae was achieved via natural transformation under the conditions tested. Donor gDNA from each of AP_1, AP_120 and AP_123 resulted in MIDG2331 transformants, as confirmed by resistance to streptomycin. The MICs of tetracycline, sulfisoxasole, and streptomycin were the same for the transformants as for the original Norwegian isolates (Table 2). Expression of the tnp gene in selected transformants resulting from each donor strain’s gDNA was confirmed by RT-PCR, as for the original donor isolates above (Figure 3a).
Linker-PCR, using outward-facing transposon-specific primers, was used to map the location of the composite transposon in the AP_1 and AP_120 strains, as well as in the MIDG2331 transformants obtained using gDNA from AP_1, AP_120, and AP_123 (Figure 4). The multiple bands seen for AP_1 and AP_120, generated with both the tetY_5′_out and the sul2_up_out primers, suggest the presence of more than one copy of Tn7560 in the genomes. Furthermore, the band patterns for these isolates appear to be the same, likely indicating the same insertion sites. It was not possible to obtain clean sequences showing the insertion sites for AP_1 or AP_120 due to the multiple amplicons generated by linker PCR. In contrast, AP_123 has only one copy of Tn7560, as indicated by the single amplicon for each flank in the linker PCR. Sequencing of these amplicons confirmed the insertion site, upstream of the dld gene, as seen in the closed genome for AP_123. The selected clone for the MIDG2331/AP_1 transformant showed that only a single copy of Tn7560 was taken up and recombined into the chromosome during transformation, corresponding to the dominant amplicons for both flanks for AP_120. Sequencing of this amplicon indicated an insertion site located upstream of fdhD, encoding a sulfurtransferase, which matches one of the insertion sites mapped in the genome sequence of AP_1 and AP_120.

3. Discussion

In this study, we have identified, for the first time in A. pleuropneumoniae, multiple copies of a novel IS1016-subfamily element, designated ISApl4, in the genomes of three Norwegian serovar 8 isolates obtained between 2004 and 2008 [8]. No IS1016-type elements (complete or partial) have previously been reported in any A. pleuropneumoniae genome, suggesting acquisition by horizontal transfer. There is no evidence of plasmid content—neither in the draft genomes of these isolates, nor in the complete genome of AP_123—but all three isolates carry a copy of the novel pseudo-compound transposon, Tn7560, comprising two copies of ISApl4 flanking four AMR genes, i.e., tet(Y), strA, strB, and sul2. These four AMR genes have been found on pAT205, a 159-kb plasmid isolated from the A. towneri strain 205, recovered from a pig in China in 2019 [34], and as part of ICE Tn7406 carried by the M. haemolytica strain IMT47952, recovered from a calf in Germany in 2019 [28]. More recently, this resistance gene combination has also been identified in other Tn7406-related ICEs of bovine P. multocida and M. haemolytica from Germany [11,12]. Furthermore, neither sequence contains a copy of ISApl4, although a different IS1595-type element—ISMha6—was found next to a complete sul2 gene in Tn7406 [28].
ISApl4-related (>90% at nucleotide sequence level) elements have been detected in the genomes of various Moraxella isolates, many having truncated tnp genes, likely rendering them inactive. For example, a frameshift mutation was detected in the tnp gene of the single IS1016 element of M. ovis (GenBank accession no. CP011158) after position 37, which generates an early stop codon at positions 148–150, thereby resulting in a Tnp protein of only 49 aa. Similarly, most of the genomes of the seven M. bovoculi isolates from the USA collected in 2013 (GenBank accession nos. CP011376–CP011381), had single copies of the IS1016 element with truncated tnp genes due to early stop codons. Only one isolate, 58069 (GenBank accession no. CP011374), contains a complete IS1016 element with an intact tnp gene. These observations suggest that an IS1016 element may have been acquired by some Moraxella species in the more distant past, with copies lost and/or inactivated over time. It is possible that some isolates (yet to be sequenced) still retain active copies, as in the M. bovoculi isolate 58069, and this may have been the source of the pseudo-compound transposon Tn7560, following capture of the four AMR genes from other MGEs, such as those identified in other bovine and porcine pathogens discussed above. However, where and when the formation of Tn7560 occurred is unknown.
Acquisition of the pseudo-compound transposon Tn7560 by the three Norwegian isolates of A. pleuropneumoniae is supported by the high activity of the flanking ISApl4 elements, with 18 or more insertions in each of the three genomes, many of which are distinct for individual isolates. Transposition bursts are common following the acquisition of a new IS, with subsequent loss, as insertions into essential genes may eliminate the affected bacterial clones. In contrast, remnants of inactive elements are commonly seen within the genomes of surviving clones [16]. The observation that there are differences in the insertion site(s) of Tn7560 in the three Norwegian A. pleuropneumoniae isolates may suggest independent acquisition of Tn7560 by different isolates, or subsequent transposition of the entire pseudo-compound transposon to different genomic locations. In this regard, it is important to know that a Tn7560-derived TU can be generated by recombination of the two terminal ISApl4 copies. This TU consists of one copy of ISApl4 and the four resistance genes. The ISApl4 in the TU can then again recombine with any complete ISApl4 copy in the genome of the respective isolate and, thereby, change its location within the genome. As there are numerous ISApl4 copies per isolate available, numerous options for new locations of Tn7560 within the same isolate exist.
The majority of ISApl4 insertion sites were mapped to non-coding intergenic locations in each of the three genomes. This may explain the survival of these isolates, which were all recovered from clinical cases of pleuropneumonia in swine. Some ISApl4 insertions were found in genes known or predicted to contribute to virulence regulation, LPS biosynthesis, and DNA repair. This suggests that there may be functional consequences beyond resistance gene mobilisation. However, further research is required to investigate the actual impact of specific truncated or inactivated gene products on bacterial fitness and virulence. The affected genes here included those involved in the production of LPS O-Ag (wzxE, wzz) [35,36,37,38], in the regulation of biofilm formation (cpxRA) [25,26,27], or encoding the Flp-Tad adhesion (tadA) [39,40]. These ISApl4 insertions may affect adherence and virulence of the affected isolates but are not sufficiently deleterious to result in elimination of the respective bacteria. An insertion in the mutY gene (encoding the DNA repair A/G-specific adenine glycosylase) [41,42] in AP_123 likely accounts for the higher abundance of SNPs seen in this isolate relative to AP_1, AP_120 and the genomes of the serovar 8 reference strain 405 [43] and clinical isolate MIDG2331 [33]. Although only one genome rearrangement relative to the syntenic genomes of strains 405 and MIDG2331 (i.e., an inversion of sequences between two closely spaced copies of ISApl4) was detected in the complete closed genome of AP_123, the abundance of insertions in the three Norwegian isolates may lead to subsequent rearrangements/deletions that may affect viability and spread of ISApl4 by vertical transmission.
Although attempts to transfer Tn7560 via conjugation were unsuccessful, horizontal transfer of Tn7560 to a new strain of A. pleuropneumoniae was achieved by natural transformation, indicating that this element may further spread the associated AMR genes to other isolates of this bacterial species. However, Tn7560 has—to the best of our knowledge—not yet been detected in other clinical isolates of A. pleuropneumoniae. The Tn7560-associated AMR genes conferred resistance to tetracycline (MIC ≥ 8 µg/mL), streptomycin (MIC ≥ 256 µg/mL) and sulfisoxazole (MIC ≥ 512 µg/mL) to all isolates in which it was present (Table 2). Based on the CLSI-approved clinical breakpoints, A. pleuropneumoniae isolates with tetracycline MICs of ≥2 µg/mL are considered tetracycline-resistant. Although no A. pleuropneumoniae-specific CLSI-approved clinical breakpoints exist, at least 16-fold and at least 4-fold increases in the MICs of sulfisoxazole and streptomycin of the transformants in comparison to the “empty” recipient strongly suggest the activity of the respective resistance genes. Moreover, sulfisoxazole and streptomycin concentrations of 512 and 256 µg/mL cannot be reached in the lung of swine by regular dosing, suggesting isolates with such high MICs should be considered as resistant. As the tet(Y) gene has rarely been found in Pasteurellaceae, any tetracycline-resistant A. pleuropneumoniae isolates should be tested by PCR using the tet(Y)-specific primers designed in this study to facilitate further epidemiological studies on the spread of this tet gene. Furthermore, molecular surveillance for ISApl4 is also warranted, as this novel element may facilitate acquisition and spread of other AMR genes, as has been documented for the previously characterised ISApl1 element, which, since its first detection in isolates of A. pleuropneumoniae [21], has been associated with the spread of the colistin resistance gene mcr-1 [44].

4. Materials and Methods

4.1. Bacterial Isolates and Antimicrobial Susceptibility Testing

A. pleuropneumoniae isolates were cultured at 37 °C with 5% CO2 on Columbia agar (BD, Franklin Lakes, NJ, USA) supplemented with 0.01% nicotinamide adenine dinucleotide (NAD). The serovar 8 A. pleuropneumoniae isolates were cultured from pneumonic lungs of pigs in Norway, with AP_1 isolated in 2004, and AP_120 and AP_123 isolated in 2008, but each from a different part of Norway [8]. These isolates were sent to Imperial College London for further analysis. Isolate AP_123 was also sent to the Statens Serum Institut, Denmark, to generate a complete closed genome sequence. The UK serovar 8 strain MIDG2331 [33] was used to test the transfer of the pseudo-compound transposon Tn7560 by natural transformation, and the NAD-independent MIDG2331∆ureC::nadV mutant [45] was used to test the transfer of Tn7560 from AP_1 by conjugation. The susceptibility of isolates and transformants to tetracycline, streptomycin, and sulfisoxazole was analysed by the broth microdilution method according to CLSI recommendations [31]. The reference strain A. pleuropneumoniae ATCC 27090 served as the quality control strain. A. pleuropneumoniae-specific CLSI-approved clinical breakpoints were used, as far as available, to classify the isolates as resistant, intermediate or susceptible based on the MICs obtained.

4.2. Genome Analysis and Identification of ISApl4 Insertions

Draft whole-genome sequences for AP_1, AP_120, and AP_123 (ENA accession nos. ERR6510189, ERR6510049, and ERR6510052, respectively) were generated as part of a previous study [8]. ResFinder v4.7.2 [46] was used to identify contigs containing the AMR genes in each genome. As all AMR genes, i.e., tet(Y), sul2, strA and strB, were on a single contig of the same size in each genome, these three contigs were aligned using the ClustalW feature of MacVector v15.5.4 (MacVector Inc, Cambridge, UK) and analysed by a blastn search against the NCBI nr/nt database to identify sequences with the highest identity (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 29 September 2025)). As the majority of the contig sequence matched various possible plasmids, but no plasmid replication genes were present, the ends of the contigs were examined to determine if overlaps to other contigs could be found. The presence of a 14-bp IR at either end of the contig was identified, along with sequences matching either the 5′ or 3′ end of an IS1016-type IS, respectively. The 14-bp IR sequence was used to search each of the three genomes for other contigs where it was present.
For each contig in which the IR sequence was located, near either the 5′ or 3′ (or in some cases both) termini, the proximal sequences were analysed to map the genomic location in comparison with the closed genomes of serovar 8 strains 405 (GenBank accession no. CP078508) and MIDG2331 (GenBank accession no. LN908249), and to identify paired contigs containing the 5′ and 3′ ends of the IS element. For each paired contig, the sequences immediately proximal to the IRs were analysed to identify possible DR sequences generated by the insertion. Using the genomic sequence data, we also applied ISMapper [47] with the ISApI4 as query to identify sites and orientations of IS insertions in A. pleuropneumoniae, using default settings.

4.3. Generation of a Closed Genome of AP_123

To obtain a closed high-quality genome of AP_123, DNA from a full 1 µL loop of colonies was extracted with the GenFind v3 kit (Beckman Coulter, Amersham, UK) using a DynaMag-2 magnet (Thermo Fisher Scientific, Loughborough, UK). A library was prepared using the Rapid Barcoding Sequencing Kit (SQK-RBK004) and sequenced in a R10.3 flow cell (FLO-MIN111) with a MinION Mk1B (Oxford Nanopore Technologies, Oxford, UK). Using Guppy v4.2.2 (Oxford Nanopore Technologies, Oxford, UK), raw fast5 reads were base-called to fastq format in ‘high-accuracy’ configuration, demultiplexed and quality filtered to a minimum q8 using NanoFilt [48]. Illumina data were trimmed with Trimmomatic v0.36 [49] to remove low-quality (Q ≤ 20) read ends, and then a hybrid de novo genome assembly was obtained with Unicycler v0.4.8-beta [50] using default parameters.

4.4. SNP Analysis of the ISApl4-Containing Isolates

To investigate the relatedness of the four ISApl4-containing isolates (AP_1, AP_120, AP_123, 405), SNPs were identified in the core genome using the raw sequencing data aligned to the A. pleuropneumoniae MIDG2331 reference chromosome (GenBank accession no. LN908249) [33]. Only high-quality SNPs were retained by exclusion of any site if a minimum coverage of 10 was not met or if the variant was present in less than 90% of the base calls of individual isolates.

4.5. Analysis of ISApl4 Activity

RT-PCR was used to determine the activity of the tnp gene in the A. pleuropneumoniae isolates. Briefly, cultures were grown in Columbia-NAD broth with/without 5 µg/mL tetracycline to OD600 = 0.4, and RNA was extracted using the RNeasy Mini Kit (Qiagen Ltd., Manchester, UK), as per the manufacturer’s instructions. Samples were treated with the TURBO DNA-free Kit (Thermo Fisher Scientific) to remove residual genomic DNA. Approximately 600 ng RNA per sample were used as template for amplification using the OneStep RT-PCR kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions, with primers ISApl4_tnp_for and ISApl4_tnp_rev (Table 3). As negative controls, the RNA samples were also subjected to PCR without RT to verify the removal of all gDNA. The resulting 429-bp PCR products were visualized with ethidium bromide after separation by agarose gel electrophoresis.
Inverse PCR was used to test for the generation of circular intermediates during transposition, using gDNA extracted from an aliquot of the cultures prepared above (i.e., culture for RT-PCR). Outward-facing primers ISApl4_inv1 and ISApl4_inv2 would generate a product of 718 bp if the ISApl4 sequence formed a circular intermediate joined by the overlap of the 8-bp DR sequences generated at each insertion site.
To test for possible transfer of Tn7560 to another A. pleuropneumoniae isolate via conjugation, we used the MIDG2331∆ureC::nadV mutant as a recipient strain in a mating experiment, as the presence of ICEApl1 in MIDG2331 [51] supplies the conjugal transfer machinery that can mediate two-way exchange (retro-transposition) of DNA between isolates, and the presence of the nadV gene allows counterselection for transconjugants containing the pseudo-compound transposon on media without supplemental NAD. Conditions for the mating experiment were as previously described [51,52], with selection for NAD-independence and streptomycin-resistance using Columbia agar containing 200 µg/mL streptomycin.
To test for horizontal transfer of Tn7560 to another A. pleuropneumoniae isolate by natural transformation, we used MIDG2331 as a recipient, which is competent for natural transformation [53], as the recipient for uptake of gDNA extracted from each of the three Norwegian isolates (AP_1, AP_120, and AP_123), using the plate transformation assay previously described [53], with selection for transformants on Columbia-NAD agar containing 200 µg/mL streptomycin. The resulting transformants were tested by PCR for the presence of the ISApl4 tnp, tet(Y), sul2 and strA-strB genes (see Table 3 for primer sequences) to confirm the presence of the pseudo-compound transposon. Selected clones were tested for MICs of tetracycline, streptomycin and sulfisoxazole by broth microdilution (Table 2). Linker PCR was performed, as previously described [54]. Oligos 254 and 256 were used to generate the linker to be ligated to blunt-end restriction fragments generated by DpnI digestion of the genomic DNA. Transposon-flanking DNA fragments were then amplified using an outward-facing transposon-specific primer (tetY_5′_out or sul2_up_out) and a linker-specific primer, oligo 258. The transposon insertion sites were then determined by sequencing of the purified linker-PCR amplicons using the outward-facing ISApl4_inv1 (for tetY_5′_out amplicons) or ISApl4_inv2 (for sul2_up_out amplicons).

5. Conclusions

In conclusion, we have identified a novel IS1016 element, ISApl4, and the associated MDR-encoding pseudo-compound transposon, Tn7560, which was shown to be active in isolates of A. pleuropneumoniae. Results indicate acquisition and transposition bursts leading to large numbers of ISApl4 copies. Vertical transmission of this element may be mitigated by the introduction of deleterious mutations following further intrachromosomal spread of this IS, and/or genomic rearrangements/deletions, leading to elimination of affected clones. However, horizontal spread of ISApl4 to other isolates of A. pleuropneumoniae is possible by natural transformation. Furthermore, acquisition into other MGEs may result in the spread to other species found within the same host environment.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antibiotics14101021/s1, Table S1. Detailed characteristics of 35 of the 39 ISApl4 integration sites in the genome of AP-123.

Author Contributions

Conceptualization, J.T.B., S.S. and P.R.L.; methodology, J.T.B., Y.L., L.M.C., Ø.A., S.O.-P., D.H. and H.K.-H.; software, M.S. and D.H.; validation, J.T.B., P.R.L. and H.K.-H.; formal analysis, J.T.B., S.S., P.R.L. and H.K.-H.; investigation, J.T.B., Y.L., L.M.C., M.S. and S.O.-P.; resources, J.T.B., L.M.C. and Ø.A.; data curation, J.T.B., M.S., D.H. and H.K.-H.; writing—original draft preparation, J.T.B. and H.K.-H.; writing—review and editing, all; visualization, J.T.B. and H.K.-H.; supervision, J.T.B., S.S., P.R.L. and H.K.-H.; project administration, J.T.B., S.S., P.R.L. and H.K.-H.; funding acquisition, J.T.B., S.S. and P.R.L. All authors have read and agreed to the published version of the manuscript.

Funding

We are grateful to the Biotechnology and Biological Sciences Research Council (BB/S005897/1, BB/S002103/1), Norwegian Agricultural Agreement Research Fund and the Foundation for Research Levy on Agricultural Products for funding, grant number NFR-267422. Work conducted at FU Berlin was funded by the German Research Foundation, grant number SCHW382/17-1.

Institutional Review Board Statement

Ethical review and approval were waived for this study because only genome sequences of the three A. pleuropneumoniae isolates have been investigated in this study. No animals were used.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data presented in this study are available in the text, figures and tables of the main article. Whole-genome sequences of the investigated A. pleuropneumoniae isolates are available at GenBank within BioProject PRJEB47034 (https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 29 September 2025)).

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
AMRAntimicrobial resistance
CLSIClinical and Laboratory Standards Institute
DRDirect repeat
gDNAGenomic DNA
ICEIntegrative and conjugative element
IRInverted repeat
ISInsertion sequence
LPSLipopolysaccharide
MGEMobile genetic element
MDRMultidrug resistance
MICMinimal inhibitory concentration
NADNicotinamide adenine dinucleotide
PCRPolymerase chain reaction
RT-PCRReverse transcription polymerase chain reaction
SNPSingle nucleotide polymorphism
TUTranslocatable unit
UKUnited Kingdom
USAUnited States of America

References

  1. Michael, G.B.; Bossé, J.T.; Schwarz, S. Antimicrobial Resistance in Pasteurellaceae of Veterinary Origin. Microbiol. Spectr. 2018, 6, ARBA-0022-2017. [Google Scholar] [CrossRef]
  2. White, A.; Hughes, J.M. Critical Importance of a One Health Approach to Antimicrobial Resistance. EcoHealth 2019, 16, 404–409. [Google Scholar] [CrossRef]
  3. da Silva, G.C.; Gonçalves, O.S.; Rosa, J.N.; França, K.C.; Bossé, J.T.; Santana, M.F.; Langford, P.R.; Bazzolli, D.M.S. Mobile Genetic Elements Drive Antimicrobial Resistance Gene Spread in Pasteurellaceae Species. Front. Microbiol. 2021, 12, 773284. [Google Scholar] [CrossRef]
  4. Sassu, E.L.; Bossé, J.T.; Tobias, T.J.; Gottschalk, M.; Langford, P.R.; Hennig-Pauka, I. Update on Actinobacillus pleuropneumoniae-knowledge, gaps and challenges. Transbound. Emerg. Dis. 2018, 65 (Suppl. 1), 72–90. [Google Scholar] [CrossRef]
  5. Loera-Muro, A.; Angulo, C. New trends in innovative vaccine development against Actinobacillus pleuropneumoniae. Vet. Microbiol. 2018, 217, 66–75. [Google Scholar] [CrossRef]
  6. Bossé, J.T.; Li, Y.; Rogers, J.; Fernandez Crespo, R.; Li, Y.; Chaudhuri, R.R.; Holden, M.T.; Maskell, D.J.; Tucker, A.W.; Wren, B.W.; et al. Whole Genome Sequencing for Surveillance of Antimicrobial Resistance in Actinobacillus pleuropneumoniae. Front. Microbiol. 2017, 8, 311. [Google Scholar] [CrossRef] [PubMed]
  7. Vilaró, A.; Novell, E.; Enrique-Tarancón, V.; Balielles, J.; Vilalta, C.; Martinez, S.; Fraile Sauce, L.J. Antimicrobial Susceptibility Pattern of Porcine Respiratory Bacteria in Spain. Antibiotics 2020, 9, 402. [Google Scholar] [CrossRef] [PubMed]
  8. Cohen, L.M.; Bossé, J.T.; Stegger, M.; Li, Y.; Langford, P.R.; Kielland, C.; Klem, T.B.; Gulliksen, S.M.; Ranheim, B.; Grøntvedt, C.A.; et al. Comparative Genome Sequence Analysis of Actinobacillus pleuropneumoniae Serovar 8 Isolates From Norway, Denmark, and the United Kingdom Indicates Distinct Phylogenetic Lineages and Differences in Distribution of Antimicrobial Resistance Genes. Front. Microbiol. 2021, 12, 729637. [Google Scholar] [CrossRef] [PubMed]
  9. Holmer, I.; Salomonsen, C.M.; Jorsal, S.E.; Astrup, L.B.; Jensen, V.F.; Høg, B.B.; Pedersen, K. Antibiotic resistance in porcine pathogenic bacteria and relation to antibiotic usage. BMC Vet. Res. 2019, 15, 449. [Google Scholar] [CrossRef]
  10. Krüger-Haker, H.; Kostova, V.; Hanke, D.; Kaspar, H.; Fiedler, S.; Schwarz, S. Genetic basis of macrolide resistance in porcine Pasteurella multocida isolates from the German national resistance monitoring program GERM-Vet 2008–2021. J. Antimicrob. Chemother. 2024, 79, 2975–2979. [Google Scholar] [CrossRef]
  11. Jahnen, J.; Hanke, D.; Kadlec, K.; Schwarz, S.; Krüger-Haker, H. Antimicrobial Resistance in Pasteurella multocida Isolates from Bovine Mastitis Can Be Associated with Multidrug-Resistance-Mediating Integrative and Conjugative Elements (ICEs). Antibiotics 2025, 14, 153. [Google Scholar] [CrossRef]
  12. Kostova, V.; Hanke, D.; Kaspar, H.; Fiedler, S.; Schwarz, S.; Krüger-Haker, H. Macrolide resistance in Mannheimia haemolytica isolates associated with bovine respiratory disease from the German national resistance monitoring program GERM-Vet 2009 to 2020. Front. Microbiol. 2024, 15, 1356208. [Google Scholar] [CrossRef]
  13. Siguier, P.; Gourbeyre, E.; Chandler, M. Bacterial insertion sequences: Their genomic impact and diversity. FEMS Microbiol. Rev. 2014, 38, 865–891. [Google Scholar] [CrossRef]
  14. Vandecraen, J.; Chandler, M.; Aertsen, A.; Van Houdt, R. The impact of insertion sequences on bacterial genome plasticity and adaptability. Crit. Rev. Microbiol. 2017, 43, 709–730. [Google Scholar] [CrossRef]
  15. Consuegra, J.; Gaffé, J.; Lenski, R.E.; Hindré, T.; Barrick, J.E.; Tenaillon, O.; Schneider, D. Insertion-sequence-mediated mutations both promote and constrain evolvability during a long-term experiment with bacteria. Nat. Commun. 2021, 12, 980. [Google Scholar] [CrossRef]
  16. Wu, Y.; Aandahl, R.Z.; Tanaka, M.M. Dynamics of bacterial insertion sequences: Can transposition bursts help the elements persist? BMC Evol. Biol. 2015, 15, 288. [Google Scholar] [CrossRef]
  17. Wagner, A. Cooperation is fleeting in the world of transposable elements. PLoS Comput. Biol. 2006, 2, e162. [Google Scholar] [CrossRef]
  18. Harmer, C.J.; Pong, C.H.; Hall, R.M. Structures bounded by directly-oriented members of the IS26 family are pseudo-compound transposons. Plasmid 2020, 111, 102530. [Google Scholar] [CrossRef] [PubMed]
  19. Zhu, Y.; Yang, W.; Schwarz, S.; Xu, Q.; Yang, Q.; Wang, L.; Liu, S.; Zhang, W. Characterization of the novel optrA-carrying pseudo-compound transposon Tn7363 and an Inc18 plasmid carrying cfr(D) in Vagococcus lutrae. J. Antimicrob. Chemother. 2022, 77, 921–925. [Google Scholar] [CrossRef] [PubMed]
  20. Yang, Q.; Zhu, Y.; Schwarz, S.; Wang, L.; Liu, W.; Yang, W.; Liu, S.; Zhang, W. Integrative and conjugative elements in streptococci can act as vectors for plasmids and translocatable units integrated via IS1216E. Int. J. Antimicrob. Agents 2023, 61, 106793. [Google Scholar] [CrossRef] [PubMed]
  21. Tegetmeyer, H.E.; Jones, S.C.; Langford, P.R.; Baltes, N. ISApl1, a novel insertion element of Actinobacillus pleuropneumoniae, prevents ApxIV-based serological detection of serotype 7 strain AP76. Vet. Microbiol. 2008, 128, 342–353. [Google Scholar] [CrossRef]
  22. Siguier, P.; Gagnevin, L.; Chandler, M. The new IS1595 family, its relation to IS1 and the frontier between insertion sequences and transposons. Res. Microbiol. 2009, 160, 232–241. [Google Scholar] [CrossRef] [PubMed]
  23. Siguier, P.; Varani, A.; Perochon, J.; Chandler, M. Exploring bacterial insertion sequences with ISfinder: Objectives, uses, and future developments. Methods Mol. Biol. 2012, 859, 91–103. [Google Scholar] [CrossRef] [PubMed]
  24. Price, N.L.; Raivio, T.L. Characterization of the Cpx regulon in Escherichia coli strain MC4100. J. Bacteriol. 2009, 191, 1798–1815. [Google Scholar] [CrossRef] [PubMed]
  25. Ma, K.; Wang, H.; Lv, Z.; Hu, Y.; Wang, H.; Shu, F.; Zhu, C.; Xue, T. The Two-Component System CpxRA Affects Antibiotic Susceptibility and Biofilm Formation in Avian Pathogenic Escherichia coli. Animals 2023, 13, 383. [Google Scholar] [CrossRef]
  26. Matter, L.B.; Ares, M.A.; Abundes-Gallegos, J.; Cedillo, M.L.; Yáñez, J.A.; Martínez-Laguna, Y.; De la Cruz, M.A.; Girón, J.A. The CpxRA stress response system regulates virulence features of avian pathogenic Escherichia coli. Environ. Microbiol. 2018, 20, 3363–3377. [Google Scholar] [CrossRef]
  27. Shetty, D.; Abrahante, J.E.; Chekabab, S.M.; Wu, X.; Korber, D.R.; Vidovic, S. Role of CpxR in Biofilm Development: Expression of Key Fimbrial, O-Antigen and Virulence Operons of Salmonella Enteritidis. Int. J. Mol. Sci. 2019, 20, 5146. [Google Scholar] [CrossRef]
  28. Schink, A.-K.; Hanke, D.; Semmler, T.; Brombach, J.; Bethe, A.; Lübke-Becker, A.; Teske, K.; Müller, K.E.; Schwarz, S. Novel multiresistance-mediating integrative and conjugative elements carrying unusual antimicrobial resistance genes in Mannheimia haemolytica and Pasteurella multocida. J. Antimicrob. Chemother. 2022, 77, 2033–2035. [Google Scholar] [CrossRef]
  29. Kyselková, M.; Chrudimský, T.; Husník, F.; Chroňáková, A.; Heuer, H.; Smalla, K.; Elhottová, D. Characterization of tet(Y)-carrying LowGC plasmids exogenously captured from cow manure at a conventional dairy farm. FEMS Microbiol. Ecol. 2016, 92, fiw075. [Google Scholar] [CrossRef]
  30. Kehrenberg, C.; Schwarz, S. Occurrence and linkage of genes coding for resistance to sulfonamides, streptomycin and chloramphenicol in bacteria of the genera Pasteurella and Mannheimia. FEMS Microbiol. Lett. 2001, 205, 283–290. [Google Scholar] [CrossRef]
  31. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated From Animals; CLSI Supplement VET01S 7th ed; CLSI: Wayne, PA, USA, 2024. [Google Scholar]
  32. Kehrenberg, C.; Catry, B.; Haesebrouck, F.; de Kruif, A.; Schwarz, S. tet(L)-mediated tetracycline resistance in bovine Mannheimia and Pasteurella isolates. J. Antimicrob. Chemother. 2005, 56, 403–406. [Google Scholar] [CrossRef] [PubMed]
  33. Bossé, J.T.; Chaudhuri, R.R.; Li, Y.; Leanse, L.G.; Fernandez Crespo, R.; Coupland, P.; Holden, M.T.; Bazzolli, D.M.; Maskell, D.J.; Tucker, A.W.; et al. Complete Genome Sequence of MIDG2331, a Genetically Tractable Serovar 8 Clinical Isolate of Actinobacillus pleuropneumoniae. Genome Announc. 2016, 4, e01667-15. [Google Scholar] [CrossRef]
  34. Cheng, Y.; Chen, Y.; Liu, Y.; Song, J.; Chen, Y.; Shan, T.; Xiao, Y.; Zhou, K. Detection of a new tet(X6)-encoding plasmid in Acinetobacter towneri. J. Glob. Antimicrob. Resist. 2021, 25, 132–136. [Google Scholar] [CrossRef]
  35. Alaimo, C.; Catrein, I.; Morf, L.; Marolda, C.L.; Callewaert, N.; Valvano, M.A.; Feldman, M.F.; Aebi, M. Two distinct but interchangeable mechanisms for flipping of lipid-linked oligosaccharides. EMBO J. 2006, 25, 967–976. [Google Scholar] [CrossRef]
  36. Marolda, C.L.; Tatar, L.D.; Alaimo, C.; Aebi, M.; Valvano, M.A. Interplay of the Wzx translocase and the corresponding polymerase and chain length regulator proteins in the translocation and periplasmic assembly of lipopolysaccharide o antigen. J. Bacteriol. 2006, 188, 5124–5135. [Google Scholar] [CrossRef]
  37. Franco, A.V.; Liu, D.; Reeves, P.R. A Wzz (Cld) protein determines the chain length of K lipopolysaccharide in Escherichia coli O8 and O9 strains. J. Bacteriol. 1996, 178, 1903–1907. [Google Scholar] [CrossRef]
  38. Murray, G.L.; Attridge, S.R.; Morona, R. Regulation of Salmonella typhimurium lipopolysaccharide O antigen chain length is required for virulence; identification of FepE as a second Wzz. Mol. Microbiol. 2003, 47, 1395–1406. [Google Scholar] [CrossRef]
  39. Kachlany, S.C.; Planet, P.J.; Bhattacharjee, M.K.; Kollia, E.; DeSalle, R.; Fine, D.H.; Figurski, D.H. Nonspecific adherence by Actinobacillus actinomycetemcomitans requires genes widespread in bacteria and archaea. J. Bacteriol. 2000, 182, 6169–6176. [Google Scholar] [CrossRef]
  40. Bhattacharjee, M.K.; Kachlany, S.C.; Fine, D.H.; Figurski, D.H. Nonspecific adherence and fibril biogenesis by Actinobacillus actinomycetemcomitans: TadA protein is an ATPase. J. Bacteriol. 2001, 183, 5927–5936. [Google Scholar] [CrossRef] [PubMed]
  41. Au, K.G.; Cabrera, M.; Miller, J.H.; Modrich, P. Escherichia coli mutY gene product is required for specific A-G----C.G mismatch correction. Proc. Natl. Acad. Sci. USA 1988, 85, 9163–9166. [Google Scholar] [CrossRef] [PubMed]
  42. Russelburg, L.P.; O’Shea Murray, V.L.; Demir, M.; Knutsen, K.R.; Sehgal, S.L.; Cao, S.; David, S.S.; Horvath, M.P. Structural Basis for Finding OG Lesions and Avoiding Undamaged G by the DNA Glycosylase MutY. ACS Chem. Biol. 2020, 15, 93–102. [Google Scholar] [CrossRef]
  43. Bossé, J.T.; Li, Y.; Cohen, L.M.; Stegger, M.; Angen, Ø.; Lacouture, S.; Gottschalk, M.; Lei, L.; Koene, M.; Kuhnert, P.; et al. Complete genome for Actinobacillus pleuropneumoniae serovar 8 reference strain 405: Comparative analysis with draft genomes for different laboratory stock cultures indicates little genetic variation. Microb. Genom. 2021, 7, 000687. [Google Scholar] [CrossRef] [PubMed]
  44. Snesrud, E.; Ong, A.C.; Corey, B.; Kwak, Y.I.; Clifford, R.; Gleeson, T.; Wood, S.; Whitman, T.J.; Lesho, E.P.; Hinkle, M.; et al. Analysis of Serial Isolates of mcr-1-Positive Escherichia coli Reveals a Highly Active ISApl1 Transposon. Antimicrob. Agents Chemother. 2017, 61, e00056-17. [Google Scholar] [CrossRef] [PubMed]
  45. Bossé, J.T.; Li, Y.; Walker, S.; Atherton, T.; Fernandez Crespo, R.; Williamson, S.M.; Rogers, J.; Chaudhuri, R.R.; Weinert, L.A.; Oshota, O.; et al. Identification of dfrA14 in two distinct plasmids conferring trimethoprim resistance in Actinobacillus pleuropneumoniae. J. Antimicrob. Chemother. 2015, 70, 2217–2222. [Google Scholar] [CrossRef] [PubMed]
  46. Bortolaia, V.; Kaas, R.S.; Ruppe, E.; Roberts, M.C.; Schwarz, S.; Cattoir, V.; Philippon, A.; Allesoe, R.L.; Rebelo, A.R.; Florensa, A.F.; et al. ResFinder 4.0 for predictions of phenotypes from genotypes. J. Antimicrob. Chemother. 2020, 75, 3491–3500. [Google Scholar] [CrossRef]
  47. Hawkey, J.; Hamidian, M.; Wick, R.R.; Edwards, D.J.; Billman-Jacobe, H.; Hall, R.M.; Holt, K.E. ISMapper: Identifying transposase insertion sites in bacterial genomes from short read sequence data. BMC Genom. 2015, 16, 667. [Google Scholar] [CrossRef]
  48. De Coster, W.; D’Hert, S.; Schultz, D.T.; Cruts, M.; Van Broeckhoven, C. NanoPack: Visualizing and processing long-read sequencing data. Bioinformatics 2018, 34, 2666–2669. [Google Scholar] [CrossRef]
  49. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
  50. Wick, R.R.; Judd, L.M.; Gorrie, C.L.; Holt, K.E. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLOS Comput. Biol. 2017, 13, e1005595. [Google Scholar] [CrossRef]
  51. Bossé, J.T.; Li, Y.; Fernandez Crespo, R.; Chaudhuri, R.R.; Rogers, J.; Holden, M.T.; Maskell, D.J.; Tucker, A.W.; Wren, B.W.; Rycroft, A.N.; et al. ICEApl1, an Integrative Conjugative Element Related to ICEHin1056, Identified in the Pig Pathogen Actinobacillus pleuropneumoniae. Front. Microbiol. 2016, 7, 810. [Google Scholar] [CrossRef]
  52. Li, Y.; Li, Y.; Fernandez Crespo, R.; Leanse, L.G.; Langford, P.R.; Bossé, J.T. Characterization of the Actinobacillus pleuropneumoniae SXT-related integrative and conjugative element ICEApl2 and analysis of the encoded FloR protein: Hydrophobic residues in transmembrane domains contribute dynamically to florfenicol and chloramphenicol efflux. J. Antimicrob. Chemother. 2018, 73, 57–65. [Google Scholar] [CrossRef] [PubMed]
  53. Bossé, J.T.; Soares-Bazzolli, D.M.; Li, Y.; Wren, B.W.; Tucker, A.W.; Maskell, D.J.; Rycroft, A.N.; Langford, P.R. The generation of successive unmarked mutations and chromosomal insertion of heterologous genes in Actinobacillus pleuropneumoniae using natural transformation. PLoS ONE 2014, 9, e111252. [Google Scholar] [CrossRef] [PubMed]
  54. Maglennon, G.A.; Cook, B.S.; Deeney, A.S.; Bossé, J.T.; Peters, S.E.; Langford, P.R.; Maskell, D.J.; Tucker, A.W.; Wren, B.W.; Rycroft, A.N. Transposon mutagenesis in Mycoplasma hyopneumoniae using a novel mariner-based system for generating random mutations. Vet. Res. 2013, 44, 124. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Mapping of 35 of the 39 ISApl4 copies across the closed genome of isolate AP_123 (GenBank accession no. CP110664). A size scale is given outside the circular map. The positions of the novel transposon Tn7560 and the cpxRA region, respectively, are indicated by blue arrows.
Figure 1. Mapping of 35 of the 39 ISApl4 copies across the closed genome of isolate AP_123 (GenBank accession no. CP110664). A size scale is given outside the circular map. The positions of the novel transposon Tn7560 and the cpxRA region, respectively, are indicated by blue arrows.
Antibiotics 14 01021 g001
Figure 2. Structure and organization of transposon Tn7560 in comparison with related elements. The open reading frames are shown as arrows with the arrowhead indicating the direction of transcription. Resistance genes are marked in red, transposase genes in orange, other genes in blue and hypothetical (hp) genes with unknown function in grey. The truncated sul2 gene is indicated by a ∆ symbol. ISApl4 elements are displayed as green boxes. Identities of at least 99% between sequences are indicated by grey shading. A size scale is given on the right-hand side. IRL, inverted repeat left; IRR, inverted repeat right; DR, direct repeat.
Figure 2. Structure and organization of transposon Tn7560 in comparison with related elements. The open reading frames are shown as arrows with the arrowhead indicating the direction of transcription. Resistance genes are marked in red, transposase genes in orange, other genes in blue and hypothetical (hp) genes with unknown function in grey. The truncated sul2 gene is indicated by a ∆ symbol. ISApl4 elements are displayed as green boxes. Identities of at least 99% between sequences are indicated by grey shading. A size scale is given on the right-hand side. IRL, inverted repeat left; IRR, inverted repeat right; DR, direct repeat.
Antibiotics 14 01021 g002
Figure 3. (a) Confirmation of expression of the ISApl4 tnp gene in different A. pleuropnemoniae isolates, as determined by amplification of a 429-bp sequence. Lanes 1–3 show the results for AP_1, AP_120, and AP_123, respectively, grown in non-selective medium. Lane 4 shows no amplification from MIDG2331. Lanes 5–7 show the results for AP_1, AP_120, and AP_123, respectively, grown in medium containing 5 µg/mL tetracycline. Lanes 8–10 show the results for the MIDG2331 transformants obtained using genomic DNA (gDNA) from AP_1, AP_120, and AP_123, respectively, grown in medium containing 5 µg/mL tetracycline. (b) Confirmation of circular intermediate formation by ISApl4 during transposition. Inverse PCR was used to amplify a 718.bp product from each of AP_1, AP_120 and AP_123. Marker = GeneRuler 100 bp Plus DNA Ladder (Thermo Fisher Scientific, Loughborough, UK).
Figure 3. (a) Confirmation of expression of the ISApl4 tnp gene in different A. pleuropnemoniae isolates, as determined by amplification of a 429-bp sequence. Lanes 1–3 show the results for AP_1, AP_120, and AP_123, respectively, grown in non-selective medium. Lane 4 shows no amplification from MIDG2331. Lanes 5–7 show the results for AP_1, AP_120, and AP_123, respectively, grown in medium containing 5 µg/mL tetracycline. Lanes 8–10 show the results for the MIDG2331 transformants obtained using genomic DNA (gDNA) from AP_1, AP_120, and AP_123, respectively, grown in medium containing 5 µg/mL tetracycline. (b) Confirmation of circular intermediate formation by ISApl4 during transposition. Inverse PCR was used to amplify a 718.bp product from each of AP_1, AP_120 and AP_123. Marker = GeneRuler 100 bp Plus DNA Ladder (Thermo Fisher Scientific, Loughborough, UK).
Antibiotics 14 01021 g003
Figure 4. Results of linker PCR mapping of the insertion sites for Tn7560 in different A. pleuropneumoniae isolates. Lanes 1–3 show the sul2_up_out amplicons, and lanes 4–6 show the tetY_5′_out for the original AP_1, AP_120, and AP_123 isolates, respectively. Lanes 7–9 show the sul2_up_out amplicons, and lanes 10–12 show the tetY_5′_out for the MIDG2331 transformants obtained using gDNA from AP_1, AP_120, and AP_123, respectively. Marker = GeneRuler 100 bp Plus DNA Ladder (Thermo Fisher Scientific).
Figure 4. Results of linker PCR mapping of the insertion sites for Tn7560 in different A. pleuropneumoniae isolates. Lanes 1–3 show the sul2_up_out amplicons, and lanes 4–6 show the tetY_5′_out for the original AP_1, AP_120, and AP_123 isolates, respectively. Lanes 7–9 show the sul2_up_out amplicons, and lanes 10–12 show the tetY_5′_out for the MIDG2331 transformants obtained using gDNA from AP_1, AP_120, and AP_123, respectively. Marker = GeneRuler 100 bp Plus DNA Ladder (Thermo Fisher Scientific).
Antibiotics 14 01021 g004
Table 1. Characteristics of 35 of the 39 ISApl4 integration sites in the genome of AP-123.
Table 1. Characteristics of 35 of the 39 ISApl4 integration sites in the genome of AP-123.
ISApl4 Copy No.8-bp DRGenomic Context
1AAAAAAAAnon-coding region
2AAAAAGAAnon-coding region
3AAACAAAAintragenic (DMT family transporter/EamA domain-containing protein)
4AAACATAAnon-coding region
5AAATTTAAnon-coding region
6AAATTTTTnon-coding region
7AAATTTTTnon-coding region
8AACAATTAintragenic (tadA; CpaF family protein/tight adherence protein A)
9AACTAAAAnon-coding region
10AAGTTTTAnon-coding region
11AATAAATAintragenic (sulfatase N-terminal domain-containing protein)
12AATTAATTintragenic (tetratricopeptide repeat protein)
13ATAAAAAAintragenic (hypothetical protein)
14ATAATTTAnon-coding region
15ATGATAAAnon-coding region
16ATGATTTTintragenic (udk; uridine kinase)
17ATTAAATAnon-coding region
18CAATTTAAintragenic (hypothetical protein)
19GATATTTTintragenic (phoB; phosphate regulon transcriptional regulator)
20TAAATAAAintragenic (Tex family protein/predicted transcriptional accessory protein)
21TAAATGAAnon-coding region
22TAAATTAAintragenic (manX; PTS mannose transporter subunit IIAB)
23TAATAAAAintragenic (LPS O-antigen chain length determinant protein, WzzB/FepE family)
24TAATTTAAintragenic (N-6 DNA methylase/class I SAM-dependent DNA methyltransferase)
25TAATTTTTintragenic (wzxE; lipid III flippase WzxE/lipopolysaccharide biosynthesis protein)
26TATCTTAAnon-coding region
27TTAAAAATnon-coding region
28TTAATAAAnon-coding region
29TTAATAAAnon-coding region
30TTAATTTAnon-coding region
31TTAGTTTTintragenic (mutY; A/G-specific adenine glycosylase)
32TTATTAAAintragenic (DUF1523 domain-containing protein)
33TTTAATTAintragenic (hypothetical protein)
34TTTTAAGGnon-coding region
35TTTTATAAnon-coding region
DR, direct repeat; inverted repeat left (IRL): GGGGCTGTACTAGA; single mismatch for copy no. 23 GGGGATGTACTAGA; inverted repeat right (IRR): GGGGCTGTACTAGA; All sequences, except IRR, are shown in the 5′ → 3′ orientation. The IRR sequences are presented in the reverse complementary orientation to better illustrate the identity with the IRL sequences. Sequences of left and right flanking regions can be found in Table S1.
Table 2. MICs of relevant antimicrobial agents for A. pleuropneumoniae isolates containing Tn7560.
Table 2. MICs of relevant antimicrobial agents for A. pleuropneumoniae isolates containing Tn7560.
IsolateTetracycline MICSulfisoxazole MICStreptomycin MIC
AP_116>512>256
MIDG2331/AP_116>512>256
AP_12016>512>256
MIDG2331/AP_12016>512>256
AP_1238>512>256
MIDG2331/AP_1238>512>256
MIDG233123264
MIC; minimal inhibitory concentration in µg/mL. Strain MIDG2331 carries tet(B) as part of the ICEApl1 insertion [33], but no other AMR genes.
Table 3. Sequences of primers used in this study.
Table 3. Sequences of primers used in this study.
Primer Name Sequence 5′ to 3′ Target/Purpose
ISApl4_tnp_for TTGAAGTTACTGCTCGTTCGGC ISApl4 tnp; 429-bp amplicon
ISApl4_tnp_rev CGTTGATGTGATTATGGTCTTTTGC
ISApl4_inv1 TGAGAATTTCTGGTCGCAAGCC ISApl4 circular form (718-bp amplicon) and transposon insertion site mapping
ISApl4_inv2 GCCGTTGATGTGATTATGGTCTTTTG
tetY_for TATGGACGGCGGATTATTTTGCTG tet(Y) gene; 530-bp amplicon
tetY_rev GTGCCAATATCCCAATTCAAGCG
sul2_for TCAACATAACCTCGGACAGTTTCTCsul2 gene; 212-bp amplicon
sul2_revGGGAATGCCATCTGCCTTGAGC
strA_for GATTTTGTTTTTCGACGTGGTGACstrA-strB; 796-bp amplicon
strB_rev GTGTCCGCAATGAGAACAGG
oligo 254 CGACTGGACCTGGAGeneration of linkers
oligo 256 GATAAGCAGGGATCGGAACCTCCAGGTCCAGTCG
oligo 258 GATAAGCAGGGATCGGAACCLinker-specific primer for linker PCR
tetY_5′_out CATCAAGCGCGACAACAATGAG Transposon-specific primer for linker PCR
sul2_up_out TCTGGAAGCAAAGCAAGGAAAGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bossé, J.T.; Li, Y.; Stegger, M.; Cohen, L.M.; Angen, Ø.; Overballe-Petersen, S.; Hanke, D.; Schwarz, S.; Langford, P.R.; Krüger-Haker, H. ISApl4, a New IS1595 Family Insertion Sequence Forming a Novel Pseudo-Compound Transposon That Confers Antimicrobial Multidrug Resistance in Actinobacillus pleuropneumoniae. Antibiotics 2025, 14, 1021. https://doi.org/10.3390/antibiotics14101021

AMA Style

Bossé JT, Li Y, Stegger M, Cohen LM, Angen Ø, Overballe-Petersen S, Hanke D, Schwarz S, Langford PR, Krüger-Haker H. ISApl4, a New IS1595 Family Insertion Sequence Forming a Novel Pseudo-Compound Transposon That Confers Antimicrobial Multidrug Resistance in Actinobacillus pleuropneumoniae. Antibiotics. 2025; 14(10):1021. https://doi.org/10.3390/antibiotics14101021

Chicago/Turabian Style

Bossé, Janine T., Yanwen Li, Marc Stegger, Liza Miriam Cohen, Øystein Angen, Søren Overballe-Petersen, Dennis Hanke, Stefan Schwarz, Paul R. Langford, and Henrike Krüger-Haker. 2025. "ISApl4, a New IS1595 Family Insertion Sequence Forming a Novel Pseudo-Compound Transposon That Confers Antimicrobial Multidrug Resistance in Actinobacillus pleuropneumoniae" Antibiotics 14, no. 10: 1021. https://doi.org/10.3390/antibiotics14101021

APA Style

Bossé, J. T., Li, Y., Stegger, M., Cohen, L. M., Angen, Ø., Overballe-Petersen, S., Hanke, D., Schwarz, S., Langford, P. R., & Krüger-Haker, H. (2025). ISApl4, a New IS1595 Family Insertion Sequence Forming a Novel Pseudo-Compound Transposon That Confers Antimicrobial Multidrug Resistance in Actinobacillus pleuropneumoniae. Antibiotics, 14(10), 1021. https://doi.org/10.3390/antibiotics14101021

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop