Next Article in Journal
Synergistic Inhibition of Methicillin-Resistant Staphylococcus aureus (MRSA) by Melaleuca alternifolia Chell (Tea Tree) and Eucalyptus globulus Labill. Essential Oils in Association with Oxacillin
Next Article in Special Issue
Broccoli: A Multi-Faceted Vegetable for Health: An In-Depth Review of Its Nutritional Attributes, Antimicrobial Abilities, and Anti-inflammatory Properties
Previous Article in Journal
Prevalence Estimation, Antimicrobial Susceptibility, and Serotyping of Salmonella enterica Recovered from New World Non-Human Primates (Platyrrhini), Feed, and Environmental Surfaces from Wildlife Centers in Costa Rica
Previous Article in Special Issue
Aegle marvels (L.) Correa Leaf Essential Oil and Its Phytoconstituents as an Anticancer and Anti-Streptococcus mutans Agent
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Essential Oil from Lippia origanoides on the Transcriptional Expression of Genes Related to Quorum Sensing, Biofilm Formation, and Virulence of Escherichia coli and Staphylococcus aureus

1
Grupo de Investigación en Bioquímica y Microbiología (GIBIM), Escuela de Microbiología, Facultad de Salud, Universidad Industrial de Santander, Bucaramanga 680002, Colombia
2
Escuela de Química, Centro de Cromatografía y Espectrometría de Masas (CROM-MASS), Universidad Industrial de Santander, Bucaramanga 680002, Colombia
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(5), 845; https://doi.org/10.3390/antibiotics12050845
Submission received: 31 March 2023 / Revised: 25 April 2023 / Accepted: 28 April 2023 / Published: 3 May 2023

Abstract

Microbial infections resistant to conventional antibiotics constitute one of the most important causes of mortality in the world. In some bacterial species, such as Escherichia coli and Staphylococcus aureus pathogens, biofilm formation can favor their antimicrobial resistance. These biofilm-forming bacteria produce a compact and protective matrix, allowing their adherence and colonization to different surfaces, and contributing to resistance, recurrence, and chronicity of the infections. Therefore, different therapeutic alternatives have been investigated to interrupt both cellular communication routes and biofilm formation. Among these, essential oils (EO) from Lippia origanoides thymol-carvacrol II chemotype (LOTC II) plants have demonstrated biological activity against different biofilm-forming pathogenic bacteria. In this work, we determined the effect of LOTC II EO on the expression of genes associated with quorum sensing (QS) communication, biofilm formation, and virulence of E. coli ATCC 25922 and S. aureus ATCC 29213. This EO was found to have high efficacy against biofilm formation, decreasing—by negative regulation—the expression of genes involved in motility (fimH), adherence and cellular aggregation (csgD), and exopolysaccharide production (pgaC) in E. coli. In addition, this effect was also determined in S. aureus where the L. origanoides EO diminished the expression of genes involved in QS communication (agrA), production of exopolysaccharides by PIA/PNG (icaA), synthesis of alpha hemolysin (hla), transcriptional regulators of the production of extracellular toxins (RNA III), QS and biofilm formation transcriptional regulators (sarA) and global regulators of biofilm formation (rbf and aur). Positive regulation was observed on the expression of genes encoding inhibitors of biofilm formation (e.g., sdiA and ariR). These findings suggest that LOTCII EO can affect biological pathways associated with QS communication, biofilm formation, and virulence of E. coli and S. aureus at subinhibitory concentrations and could be a promising candidate as a natural antibacterial alternative to conventional antibiotics.

1. Introduction

Antimicrobial resistance (AMR) to conventional antibiotics is a serious public health problem directly causing an estimated 1.3 million deaths per year around the world [1,2]. These infections can be considered emergent diseases because of their potential to affect human beings and the limitations of the therapeutic treatments for them around the world [3,4]. Among different antimicrobial-resistant microorganisms, E. coli and S. aureus are the most prevalent pathogens, mainly because they can form biofilms. Biofilm-forming bacteria can produce a compact and protective matrix allowing them to adhere to different surfaces such as medical devices and cellular tissues. Microbial growth of these pathogens generally contributes to the chronicity of the infection and its recurrence, especially in both implants and medical devices [5,6,7].
S. aureus is the main microorganism causing nosocomial and community-acquired bacterial infections [8]. Methicillin-resistant and multidrug-resistant Staphylococcus aureus (MRSA) strains are becoming a serious threat to global public health, which stimulates the search for new antimicrobial agents [9]. During biofilm formation, S. aureus can produce diverse virulence factors, including hemolytic toxins, enterotoxins, and proteolytic enzymes, among others. One important virulence factor is the pore-forming toxin alpha-hemolysin (hla) [10]. This hla has a strong hemolytic effect on red blood cells from different mammals and plays an important role in biofilm formation in staphylococcal infections [11]. In addition, QS-agr and global regulators such as sarA, aur and rbf coordinately control the colonization, adhesion, and exopolysaccharide formation in S. aureus infections. The formation of different types of polysaccharide intercellular adhesin (PIA) and Poly- β(1-6)-N-acetylglucosamine (PNAG)-dependent exopolysaccharides or extracellular proteases allows S. aureus to invade any type of biotic and abiotic surface. This biological property converts S. aureus into one of the most important microorganisms associated with nosocomial infections on medical devices [12,13].
On the other hand, Escherichia coli is a recognized pathogen causing different important intestinal and extraintestinal infections [14]. Some E. coli strains have been implicated in sporadic cases and outbreaks of enterohemorrhagic diarrhea throughout the world [15] and are one of the most common multidrug-resistant strains of urinary tract infection in Latin America [16,17]. E. coli possesses essential virulence factors for adhesion to epithelial cells and cellular aggregation, which drives biofilm formation in cell infections [18,19]. In pathogenic strains of E. coli, the LuxS gene is responsible for QS regulation, an important tool in the regulation of gene expression of some virulence factors and bacterial motility of these bacterial strains [20]. During E. coli biofilm formation, gene regulation of bacterial mechanisms such as motility, adhesion, and cellular aggregation is an essential issue [21]. For instance, motility is influenced by the regulation of flagella and pili that facilitate cell–surface interaction and cellular aggregation, curli and fimbriae syntheses that enable cellular communication and exopolysaccharide formation, and therefore promote an irreversible interaction between bacteria and cell surfaces [22]. Each of these bacterial features promotes biofilm formation, chronicity, and antibiotic resistance. Among the different treatments explored to combat AMR, essential oils (EOs) have emerged as promising mixtures against infections caused by antibiotic-resistant microorganisms. EOs are secondary metabolites with antimicrobial properties, generally acting on the cell membranes and therefore affecting the cellular structures of microorganisms, which facilitates their cytotoxic and therapeutic properties [23,24,25]. Recently, EO from Lippia origanoides (Verbenaceae family), mainly composed of phenolic monoterpenes, has been proven to have high antimicrobial activity against different pathogenic microorganisms [16,26,27]. These findings provide further evidence of the potential of the L. origanoides EO as an antimicrobial agent against infections caused by S. aureus and E. coli. Therefore, this work aimed to study, via RT-qPCR analyses, the effect of the L. origanoides EO from on the expression of genes related to QS communication, biofilm formation, and virulence of pathogenic strains of E. coli ATCC 25922 and S. aureus ATCC 29213.

2. Results

2.1. Chemical Composition of the L. origanoides EO

Five major components present in L. origanoides EO were identified via GC-MS analyses [28] (See Table 1). The percentage of major biomarkers are as follows: oxygenated compounds 51.5%, sesquiterpenes 6.3% and monoterpenes 6.4%, respectively. Among them, the major biomarkers were thymol (32.7%) and carvacrol (18.8%), which have been previously proven as promising antimicrobial compounds against antibiotic-resistant bacteria [29].

2.2. Antimicrobial Activity of the LOTC II EO on Biofilm Formation of E. coli and S. aureus

The anti-biofilm effect of the LOTC II EO on E. coli ATCC 25922 and S. aureus ATCC 29213 cultures is shown in Table 2 and Figure 1. A high inhibitory effect on biofilm formation was observed with bacterial cultures treated with the LOTC II EO. Inhibition of biofilm formation by 76% and 71% for E. coli and S. aureus, respectively, was determined for this EO at a CMIB of 0.40 mg/mL.

2.3. Obtaining Cell Biomass from Treated and Untreated Bacterial Biofilms with LOTC II EO in Bioreactors of 50 mL

Scale-up of biofilm cultures was performed to obtain a large amount of cell biomass. Initially, inhibition kinetics were performed on a subinhibitory concentration of the LOTC II EO on planktonic and sessile cells in the bioreactors. This was carried out to assess cell culture conditions in the bioreactor. Therefore, it was corroborated that antibacterial and antibiofilm activity determinations of the LOTC II EO were not altered at the culture conditions in the bioreactor at volumes of 50 mL. Figure 2 shows the cell inhibition kinetics obtained with E. coli cultures treated with EO.

2.4. Total RNA Extraction and cDNA Synthesis

Extraction of total RNA from biofilm samples treated and untreated with the subinhibitory concentration of EO from LOTC II was performed at 24 h of incubation time. Table 3 shows the RNA properties of each biofilm samples. All RNA exhibited A260/280 ratio of ~2.0, which indicated that the RNA samples had adequate purity and yield; therefore, these samples could be used for amplification experiments by RT-qPCR.

2.5. EO Effect on Swimming Motility of E. coli ATCC 25922

All the evaluated genes are directly involved in the QS regulation system, biofilm formation, and virulence of both E. coli and S. aureus. The specificity of the synthesized primers was evaluated via agarose gel electrophoresis and real-time PCR. Figure 3 shows agarose gel electrophoresis of evaluated genes from E. coli and S. aureus. All amplifications showed a single amplification product.

2.6. Differential Expression Analysis of Genes Related to Quorum Sensing, Biofilm Formation, and Virulence

Our results showed significant differences between treated and untreated cultures with the EO for all evaluated microorganisms (See Figure 4 and Figure 5), with higher changes observed for E. coli. Both positive and negative regulation of genes related to quorum sensing and biofilm formation were observed. In E. coli, the expression of genes related to motility and production of biofilm exopolysaccharide was mainly affected, while in S. aureus, the expression of genes related to the global regulation of exopolysaccharide production and cell survival was mainly modified.

3. Discussion

Biofilm formation in S. aureus is a multifactorial process influenced by different biological processes and factors, with PIA being one of the most important. Although different candidate polysaccharides have been postulated to be determinants of biofilm formation, PIA, a PNAG, is the main exopolysaccharide component of the staphylococcal biofilm matrix and is linked to irreversible adhesion of S. aureus [30]. Enzymes for PIA/PNAG synthesis are encoded by the icaADBC operon, and any mutation of this gene operon causes a decreased capacity for biofilm formation [31]. Within the icaADBC operon, the icaA and icaD genes are directly related to PNAG synthesis and cellular multilayer clustering, whereas the icaB and icaC genes encode for a protein involved in matrix exopolysaccharide stability and a protein receptor from polysaccharides, respectively. In addition, the activation of this operon is influenced by the negative regulation of the icaR gene and the activation of the agr system [32,33]. In this study, we found a negative regulation in the expression of the icaA gene in S. aureus with no significant changes in the expression of the icaD gene. The regulation of these genes is involved in the synthesis of adhesins and exopolysaccharide exportation [30]. Moreover, gene transcription of proteins from icaADBC is under positive global regulation of the sarA transcription regulator [34]. Negative regulation of sarA gene expression was observed in cultures of both E. coli and S. aureus treated with the EO from LOTC II. The sarA locus encodes a DNA-binding protein required in some conditions for microbial growth associated with biofilm formation. Previous studies [35,36] proved that a sarA mutation causes a decrease in biofilm formation and a diminished transcription of genes of the icaADBC operon and PIA/PNAG synthesis. Moreover, these studies showed that the negative regulation of the icaA and icaD genes, even only the icaA gene, caused a significant reduction in biofilm formation in S. aureus [37].
On the other hand, the expression of the agrA gene was decreased by the effect of the EO from LOTC II in both biofilm and planktonic cells of S. aureus. This accessory gene regulator (agr) is important in the regulation of the QS mechanism and pathways associated with the synthesis of the exopolysaccharide matrix. In the development of S. aureus biofilms, some cell surface proteins play an important role in the adhesion of bacterial cells to host cells and surfaces; among these, microbial surface components that recognize adhesive matrix molecules (MSCRAMMs), mediate the adhesion of microbes to components of the extracellular matrix of the host. On staphylococci, MSCRAMMs often have multiple ligands, and their production is an essential step in the formation, development, and maturation of biofilms [38,39]. The MSCRAMM synthesis is influenced by the agr and the staphylococcal accessory regulator (sarA). These regulatory elements play opposing roles in S. aureus biofilms formation because mutation of agr results in increased biofilm formation and decreased antibiotic susceptibility, while mutation of sarA has the opposite effect [35,40,41].
The agr locus encodes a two-component QS system that modulates the synthesis of a transcriptional regulator (RNA III) and the autoregulation of the agr system. The LOTC II EO also affected the gene expression of the RNA III gene, significantly decreasing its transcription in the biofilm formation of S. aureus. RNA III is an important transcriptional regulator of biofilm formation in S. aureus and is responsible for the posttranscriptional regulation of several virulence factors that mediate changes in the expression of cell surface-related proteins and extracellular toxins such as alpha-hemolysin (hla) and delta-hemolysin (hld) [42]. Caiazza et al., (2003) proved that hla synthesis was necessary for biofilm formation by an activation mechanism of adhesive proteins [43,44]. In addition, negative regulation of the hla gene by the effect of the LOTC II EO suggests that this EO affects not only alpha-hemolysin synthesis but also QS signal recognition proteins, causing inhibition on the expression of transcriptional regulators, toxin production, and biofilm formation. The agrA gene also encodes an essential protein in QS signal recognition and acts as a transcriptional regulator of different bacterial features from S. aureus. Previous studies showed that bacterial strains expressing agr genes at high levels had a decreased capacity for biofilm formation, that is, inactivation of the QS system in S. aureus would be necessary for biofilm reinforcement [45,46]. However, agrC and agrA comprise a classic two-component signal transduction system, where agrC bound to a ligand activates a DNA-binding response regulator agrA. In this case, active dimers of agrA are bound to an intergenic region of agr and positively regulate the expression of the two operons. Moreover, agrA independently regulates the expression of cytolytic phenol soluble modulins (PSMs) and several genes related to cell metabolism [47].
Biofilm formation in S. aureus is not only mediated by PIA/PNAG synthesis. It is possible that biofilm formation is dependent on the icaADBC operon biofilm formation. These biofilms are associated with the biofilm-associated protein (Bap), a surface protein implicated in the biofilm formation of S. aureus strains isolated from chronic infections. Regulation of Bap-dependent biofilms is influenced by global regulators such as rbf [48]. In this study, negative regulation of the expression of rbf and aur genes in response to the LOTC II EO was observed. These genes are related to protein exopolysaccharide production and extracellular proteases. Additionally, it has been proposed that rbf is involved in the positive regulation of important proteins of biofilm formation [49]. Lim et al., (2004) observed that the insertion of the rbf gene in S. aureus altered biofilm formation on polystyrene and glass surfaces. Nevertheless, this mutant was not affected in its primary adhesive step, which suggests that rbf inactivation affects cell aggregation but not cell adhesion and can regulate ica genes via an independent pathway [50]. These findings were previously observed by Cue et al., (2009), who found that Rbf represses icaR transcription with a concomitant increase in icaADBC gene expression and enhanced PNAG and biofilm formation [51]. Thus, inhibition of S. aureus biofilm formation by the LOTC II EO would affect both PIA and protein exopolysaccharide biosynthesis.
The first stages in biofilm formation in E. coli require the synthesis of different structures from bacterial surfaces that allow irreversible attachment to cell surfaces [52]. In this sense, adhesive organelles such as curli fimbriae, encoded by the csg operon, and type I fimbriae, encoded by fim genes, are especially important. On the other hand, cell motility is a mediator of cell–cell interactions and acts as a determining factor of biofilm architecture [53]. Additionally, motility and synthesis of fimbriae-flagellum would be a key factor in the development of QS communication and biofilm formation in E. coli, since once the bacteria cells are irreversibly bound to the surface, coproduction of polysaccharides and curli is necessary for biofilm development [52]. Genes for curli synthesis are organized into two divergent operons: csgBA, encoding structural components, and csgDEFG-encoding proteins for assembling and transporting of curli. Gene expression of these two curli operons is under the control of the csgD protein. In this study, we found a negative regulation of the expression of the csgD gene in S. aureus caused by the LOTC II EO, which is an important finding since the csgD protein modulates the expression of a set of genes responsible for the adaptation of cell physiology to the biofilm state [54,55].
Type I fimbriae, known as pili, are commonly used as adherence structures to resist shear stress. In E. coli, one of the most important proteins constituting the type I fimbriae is the fimH protein, a highly conserved adhesive subunit responsible for structure maintenance. The fimH domain is responsible for the adherence process, a main step in the colonization of biofilm formation of E. coli [56]. Zuberi et al., (2017), proved that deletion of the fimH gene blocks the synthesis of the fimH subunit of fimbriae from E. coli, significantly reducing its ability for biofilm formation [57]. We found that the LOTC II EO caused a negative regulation of the expression of the fimH gene in E. coli biofilms, suggesting a loss of motility and an effect on curli proteins, with the concomitant inhibition of biofilm formation because it is affected cell–surface and cell–cell interactions, and blocked cell aggregation.
We also found a negative regulation in the expression of the pgaC gene of E. coli in response to the LOTC II EO; this gene is involved in exopolysaccharide synthesis pathways and exportation. In biofilm maintenance of E. coli, the production of the linear homopolymer poly-Beta-1,6-N-acetyl glucosamine (PGA) is important because this polymer acts as an adhesin, giving shape and stability to bacterial biofilms. PGA synthesis requires the expression of the pgaABDC operon, which is necessary for the maturation of the biofilm [58]. In addition, the pgaC protein is an essential glucosyltransferase for PGA production. It has been proven that deletion of the pgaC gene blocks PGA synthesis, inhibiting the maintenance and formation of biofilms [59]. Consequently, the negative regulation of pgaC gene expression caused by the LOTC II EO affected exopolysaccharide production, significantly inhibiting biofilm formation and cell aggregation, which was clearly observed in SEM analyses [27].
In contrast, positive regulation of ariR, an important gene involved in resistance pathways to environmental changes, was observed in response to LOTC II EO. During the sessile growth of E. coli, ariR is an important protein because it is a global regulator that is upregulated by cytoplasmic pH stress and therefore allows E. coli to resist acidic conditions. Transcriptomic studies have identified that this protein plays an important role in the colonization of E. coli in the digestive system and is involved in cell communication and biofilm development [60,61]. Phenotype studies showed that ariR represses biofilm formation in under stress environments, decreasing cell motility and protecting the bacterial cells against acidic conditions. These data are potentially mediated through AI-2 signal interactions (luxS) and indole, which suggests that ariR is a nonspecific transcriptional regulator [61]. Thus, overexpression of the ariR gene facilitates the resistance of E. coli to environmental pH changes, which would be caused by the effect of the LOTC II EO on bacterial cells, with the consequent inhibition of motility and biofilm formation.
Moreover, the LOTC II EO positively regulated the expression of LuxS and gseC genes in E. coli. These genes are associated with cell communication and are important in biofilm formation. The AI-2 is the main QS communication system in E. coli since autoinducer-2 (furanosyl borate diester) synthesis is regulated by the LuxS protein [62]. AI-2 system promotes biofilm formation and changes its structure when it stimulates flagellar motility through the QS motility regulator MqsR. In addition, this MqsR regulator acts through the two-component QseBC motility regulator system. Thus, the two-component QseBC motility regulator system would transcriptionally affect cell motility gene expression [63,64]. Additionally, Yang et al., (2014) proved that the QseC histidine kinase sensor, a QseB response protein regulator, plays an important role in an additional cell communication system for biofilm formation mediated by the epinephrine–norepinephrine (EPI-NE) recognition process in E. coli [65]. Therefore, E. coli cells could regulate their motility mechanisms through the regulation of the gseC gene; however, this hypothesis should be confirmed by studies on changes in gseB gene expression.
On the other hand, in this study, a positive regulation in the expression of the SdiA gene, a transcriptional regulator related to QS communication, was observed in E. coli biofilm cultures treated with the LOTC II EO. E. coli encodes a transcription-activating protein associated with QS communication, a homolog receptor of LuxR known as suppressor of division inhibitor (SdiA). Although E. coli is not able to synthesize N-acyl homoserine lactone (AHL) molecules, SdiA can recognize autoinducer molecules produced by other bacteria. E. coli uses SdiA proteins to reduce biofilm formation by recognizing QS and indole signals. Previous studies have proven that SdiA reduces biofilm formation by repressing genes related to curli and indole pathway synthesis. These results suggest that E. coli can regulate sdiA expression to decrease biofilm formation by altering signal sensors [66]. Culler et al., (2018) showed that SidA is active and functional in the presence and absence of AHL molecules. Moreover, SdiA can sense different environmental conditions, such as osmolarity and temperature, allowing E. coli to regulate the stress response system and survive in the infected host or in the environment [67]. Kim et al., (2014) proved the interaction of SdiA and the cell division promotor ftsQP2 as a response to stress in the absence of inducing molecules [68]. Therefore, the positive regulation of SdiA expression caused by the LOTC II EO would significantly affect the motility mechanism and biofilm formation in E. coli.

4. Materials and Methods

4.1. Materials

Bacterial Strains and Plant Material

Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 29214 were purchased commercially from ATCC by Grupo de Investigación en Bioquímica y Mcirobiologia (GIBIM). Lippia origanoides chemotype thymol-carvacrol II plants were harvested from experimental plots located at the Agroindustrial Pilot Complex of CENIVAM (National Research Center for the Agro-Industrialization of Tropical Medicinal Aromatic Plants), at Universidad Industrial de Santander (Bucaramanga, Colombia). The taxonomic characterization of the plants was carried out at the Institute of Natural Sciences of the Universidad Nacional de Colombia (Bogotá, Colombia) and they were identified at the species level [28].

4.2. Essential Oil Distillation and Analysis

EO from Lippia origanoides thymol-carvacrol II plants was extracted via microwave-assisted hydrodistillation (MWHD) and characterized using gas chromatography coupled to mass spectrometry (GC/MS) [69].

4.3. Determination of the Minimum Inhibitory Concentration of the LOTC II EO on E. coli and S. aureus Biofilm Formation

Inhibition of biofilm formation of E. coli and S. aureus cultures by EO from LOTC II was determined as described by Martínez et al., (2021), with some modifications [27]. Briefly, sterile flat-bottom polystyrene (PS) 96 microtiter plate wells were used for biofilm formation. Cultures were grown overnight in 3 mL of tryptic soy broth (TSB) with 2% w/v glucose diluted (1/100) in growth medium to 5.8 × 105 (CFU/mL) for S. aureus, whereas we used Luria Bertani (LB) medium diluted (1/10) in growth medium to 6 × 106 (CFU/mL) for E. coli. One hundred microliters of the respective growth culture medium were transferred into the microplate in the presence of 100 µL subinhibitory concentrations of the LOTC II EO. We used 100 µL of bacterial inoculum and 100 µL of peptone water as biofilm formation controls. Microplates were incubated at 27 °C for 24 h. The formed biofilms were then washed three times with sterile phosphate-buffered saline (PBS pH 7.2) to remove free-floating planktonic bacteria. The biofilm formed by adherent sessile organisms in the microplates was stained with 0.45 w/v crystal violet. All the experiments were performed in triplicate. The inhibition percentage was determined according to the following equation:
Inhibition (%) = [(OD negative control − ODEO-treated)/OD negative control] × 100

4.4. Obtaining Biomass from Biofilm Treated and Untreated with the LOTC II EO II Bioreactors

Cell biomass from biofilms treated and untreated with the EO from LOTC II was obtained in aerated and stirred 50 mL glass bioreactors, using frosted glass coupons (~15 cm × 2 cm) as a support for biofilm formation. Bioreactors containing TSB culture medium with sub-(MIBC)50 of 0.375 mg/mL of the LOTC II EO cultures were inoculated with either 107 CFU/mL of E. coli in LB culture medium or 107 CFU/mL of S. aureus. Negative controls for EO untreated bioreactors were prepared by inoculating 107 CFU/mL for both E. coli and S. aureus in peptone water medium. All cultures were carried out at 37 °C for 24 h with constant oxygenation. Subsequently, each coupon was washed three times (3×) with PBS buffer (pH 7.2) to remove unattached bacterial cells. Adhered cells and biofilm were physically removed with a spatula and transferred to 50 mL Falcon tubes and dispersed with 50 mL of peptone water. Finally, total RNA was extracted from these bacterial biofilm cells and from planktonic cells treated and untreated with the LOTC II EO. All the extractions were performed in triplicate.

4.5. Extraction of Total RNA and Synthesis of cDNA

Total RNA extractions from biofilm treated and untreated with EO were carried out using the PureLink RNA mini kit (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions. The concentration and purification of total RNA was spectrophotometrically assessed using an IMPLEN NanoPhotometer NP80 (Thermo Fisher Scientific, Waltham, MA, USA). A 260/280 absorbance ratio was used as an indicator of purity and protein contamination of RNA samples. Subsequently, cDNA synthesis from total RNA was performed with a RevertAidTM H Minus First Strand cDNA kit according to the manufacturer’s instructions (Fermenta, Thermo Fisher Scientific, Madison, WI, USA). All RNA samples were used to obtain cDNA and adjusted at a final concentration of 10 ng/µL.

4.6. Primer Design

Primers for the specific genes listed in Table 4 and Table 5 were designed using Primer3 [70], OligoCalc [71] and SnapGene Tool and Viewer software (6.0.2 version). Primer design was performed according to recommended NCBI protocols. Genes were selected based on different biological processes related to biofilm formation, QS communication, and bacterial regulation features such as pathogenicity and virulence. Some genes have even been previously described in the literature.

4.7. Analysis of Differential Gene Expression

Quantification of expressed genes was carried out in the CFX96™ Real-time PCR system and software (Bio-Rad, Hercules, CA, USA). RT-qPCR reactions were performed according to the manufacturer’s instructions using a Luna® Universal SYBR green qPCR 2X Master mix (New England Biolabs, Ipswich, MA, USA) in a total volume of 20 μL, containing 10 μL of Luna Universal qPCR 2X Master Mix, 100 ng of cDNA template, 0.25 μM of forward primer, 0.25 μM of reverse primer and sterile nuclease-free water to complete 20 μL. cDNA amplification involved an incubation for initial denaturation at 95 °C for 1 min, followed by 40 cycles of 95 °C for 15 s, and 55–60 °C for 45 s. After 40 cycles, a melting curve was determined using SYBR green fluorescence. Negative controls for gene quantification were performed by omitting the cDNA template from an amplification reaction. Normalization of amplification curves of genes was determined using S. aureus (muc) and E. coli (rssA) housekeeping reference genes. Gene expression and quantification of amplification efficiency were carried out using the 2-ΔΔCt method [82].

4.8. Data Analysis

All experiments were performed in triplicate and a one-way analysis of variance (ANOVA) was performed to analyze the results among treatments. The significance level in each assay was <0.05%. The assumption of normality and data variances were previously tested using the Shapiro–Wilk and Levene tests, respectively.

5. Conclusions

The LOTC II EO caused significant changes in the expression of genes of E. coli ATCC 25922 and S. aureus ATCC 29213. These genes were related to adhesion mechanisms and cellular motility mechanisms, exopolysaccharide production (PIA/PNAG), environmental processing, two-component systems, ABC transporter membrane proteins, and global regulators of transcription, which could explain the antimicrobial, anti-QS, and anti-biofilm formation effects at subinhibitory concentrations of the LOTC II EO against both of the studied microorganisms. Through correlations of changes in differential gene expression with metabolic pathways, we suggest a probable mechanism of action; on E. coli ATCC 25922 and S. aureus ATCC 29213. This mechanism is associated with the inhibition of gene expression of important biological processes of bacterial cells such as motility, surface adhesion, cellular aggregation, exopolysaccharide production, and transcriptional regulators of QS communication and biofilm formation. These results could pave the way for new studies aimed at determining possible therapeutic targets and for the development of new antimicrobial compounds.

Author Contributions

A.M. conceived the experimental design, performed the experiments, data analysis and wrote the original draft manuscript; E.E.S. performed chemical analysis of essential oils and project supervision; G.Z. and R.T.S. contributed to the experimental design, data analysis and manuscript preparation; G.Z. and C.O. contributed to the project supervision and manuscript preparation. All authors have read and agreed to the published version of the manuscript.

Funding

Ministry of Science, Technology and Innovation, the Ministry of Education, the Ministry of Industry, Commerce and Tourism, and ICETEX, Ecosistema Científico-Colombia Científica program, from the Francisco José de Caldas Fund, Grand RC-FP44842-212-2018.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors gratefully acknowledge funding from the Ministry of Science, Technology and Innovation, the Ministry of Education, the Ministry of Industry, Commerce and Tourism, and ICETEX, Ecosistema Científico-Colombia Científica program from the Francisco José de Caldas Fund, Grand RC-FP44842-212-2018. The Ministry of Environment and Sustainable Development of Colombia supported the Universidad Industrial de Santander through the permit for access to genetic resources and derivative bioprospecting (Contract N° 270). Project RC-FP44842-212-2018 was approved by the Scientific Research Ethics Committee (Record N° 15-2017, File N° 4110) of the Universidad Industrial de Santander. The experiments and the chemical management were performed in accordance with the national law (Resolution N° 008430-1993) of the Colombian Ministry of Health and the Institutional Manual of Integrated Management and Processes (PGOR-PGGA.05).

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study, in the collection, analyses, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.

References

  1. Dadgostar, P. Antimicrobial Resistance: Implications and Costs. Infect. Drug Resist. 2019, 12, 3903–3910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Murray, C.J.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Aguilar, G.R.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [Scilit]
  3. Gales, A.C.; Castanheira, M.; Jones, R.N.; Sader, H. Antimicrobial resistance among Gram-negative bacilli isolated from Latin America: Results from SENTRY Antimicrobial Surveillance Program (Latin America, 2008–2010). Diagn. Microbiol. Infect. Dis. 2012, 73, 354–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Rocha, C.; Reynolds, N.D.; Simons, M.P. Resistencia emergente a los antibióticos: Una amenaza global y un problema crítico en el cuidado de la salud. Rev. Peru. Med. Exp. Salud Pública 2015, 32, 139–145. [Google Scholar] [CrossRef] [Scilit]
  5. Olsen, I. Biofilm-specific antibiotic tolerance and resistance. Eur. J. Clin. Microbiol. Infect. Dis. 2015, 34, 877–886. [Google Scholar] [CrossRef] [Scilit]
  6. Hall, C.W.; Mah, T.-F. Molecular mechanisms of biofilm-based antibiotic resistance and tolerance in pathogenic bacteria. FEMS Microbiol. Rev. 2017, 41, 276–301. [Google Scholar] [CrossRef] [Scilit]
  7. Singh, S.; Singh, S.K.; Chowdhury, I.; Singh, R. Understanding the mechanism of bacterial biofilms resistance to antimicrobial agents. Open Microbiol. J. 2017, 11, 53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. McGuinness, W.A.; Malachowa, N.; DeLeo, F.R. Focus: Infectious diseases: Vancomycin resistance in Staphylococcus aureus. Yale J. Biol. Med. 2017, 90, 269. [Google Scholar]
  9. Guo, Y.; Song, G.; Sun, M.; Wang, J.; Wang, Y. Prevalence and Therapies of Antibiotic-Resistance in Staphylococcus aureus. Front. Cell. Infect. Microbiol. 2020, 10, 107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. David, M.Z.; Daum, R.S. Treatment of Staphylococcus aureus Infections. In Staphylococcus aureus: Microbiology, Pathology, Immunology, Therapy and Prophylaxis; Springer: Cham, Switzerland, 2017; pp. 325–383. [Google Scholar]
  11. Duan, J.; Li, M.; Hao, Z.; Shen, X.; Liu, L.; Jin, Y.; Wang, S.; Guo, Y.; Yang, L.; Wang, L. Subinhibitory concentrations of resveratrol reduce alpha-hemolysin production in Staphylococcus aureus isolates by downregulating saeRS. Emerg. Microbes Infect. 2018, 7, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Mello, P.L.; Riboli, D.F.M.; Martins, L.D.A.; Brito, M.A.V.P.; Victória, C.; Romero, L.C.; de Souza da Cunha, M.D.L.R. Staphylococcus spp. isolated from bovine subclinical mastitis in different regions of Brazil: Molecular typing and biofilm gene expression analysis by RT-qPCR. Antibiotics 2020, 9, 888. [Google Scholar] [CrossRef] [Scilit]
  13. Kitichalermkiat, A.; Katsuki, M.; Sato, J.; Sonoda, T.; Masuda, Y.; Honjoh, K.-I.; Miyamoto, T. Effect of epigallocatechin gallate on gene expression of Staphylococcus aureus. J. Glob. Antimicrob. Resist. 2020, 22, 854–859. [Google Scholar] [CrossRef] [Scilit]
  14. Makvana, S.; Krilov, L.R. Escherichia coli infections. Pediatr. Rev. 2015, 36, 167–170. [Google Scholar] [CrossRef] [Scilit]
  15. Crim, S.M.; Griffin, P.M.; Tauxe, R.; Marder, E.P.; Gilliss, D.; Cronquist, A.B.; Cartter, M.; Tobin-D’Angelo, M.; Blythe, D.; Smith, K.; et al. Preliminary incidence and trends of infection with pathogens transmitted commonly through food—Foodborne Diseases Active Surveillance Network, 10 US sites, 2006–2014. Morb. Mortal. Wkly. Rep. 2015, 64, 495. [Google Scholar]
  16. Gómez-Sequeda, N.; Ruiz, J.; Ortiz, C.; Urquiza, M.; Torres, R. Potent and Specific Antibacterial Activity against Escherichia coli O157:H7 and Methicillin Resistant Staphylococcus aureus (MRSA) of G17 and G19 Peptides Encapsulated into Poly-Lactic-Co-Glycolic Acid (PLGA) Nanoparticles. Antibiotics 2020, 9, 384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Maldonado, N.A.; Múnera, M.I.; López, J.A.; Sierra, P.; Robledo, C.; Robledo, J. Tendencias de la resistencia a antibióticos en Medellín y en los municipios del área metropolitana entre 2007 y 2012: Resultados de seis años de vigilancia. Biomédica 2014, 34, 433–446. [Google Scholar] [CrossRef] [Scilit]
  18. Terlizzi, M.E.; Gribaudo, G.; Maffei, M.E. UroPathogenic Escherichia coli (UPEC) Infections: Virulence Factors, Bladder Responses, Antibiotic, and Non-antibiotic Antimicrobial Strategies. Front. Microbiol. 2017, 8, 1566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Zagaglia, C.; Ammendolia, M.G.; Maurizi, L.; Nicoletti, M.; Longhi, C. Urinary Tract Infections Caused by Uropathogenic Escherichia coli Strains—New Strategies for an Old Pathogen. Microorganisms 2022, 10, 1425. [Google Scholar] [CrossRef] [Scilit]
  20. Dinh, C.V.; Prather, K.L.J. Development of an autonomous and bifunctional quorum-sensing circuit for metabolic flux control in engineered Escherichia coli. Proc. Natl. Acad. Sci. USA 2019, 116, 25562–25568. [Google Scholar] [CrossRef] [Scilit]
  21. Shrestha, R.; Khanal, S.; Poudel, P.; Khadayat, K.; Ghaju, S.; Bhandari, A.; Lekhak, S.; Pant, N.D.; Sharma, M.; Marasini, B.P. Extended spectrum β-lactamase producing uropathogenic Escherichia coli and the correlation of biofilm with antibiotics resistance in Nepal. Ann. Clin. Microbiol. Antimicrob. 2019, 18, 1–6. [Google Scholar] [CrossRef] [Scilit]
  22. Stanton, M.M.; Park, B.W.; Vilela, D.; Bente, K.; Faivre, D.; Sitti, M.; Sánchez, S. Magnetotactic bacteria powered biohybrids target E. coli biofilms. ACS Nano 2017, 11, 9968–9978. [Google Scholar] [CrossRef] [Scilit]
  23. Nazzaro, F.; Fratianni, F.; Coppola, R.; De Feo, V. Essential Oils and Antifungal Activity. Pharmaceuticals 2017, 10, 86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Sharma, S.; Barkauskaite, S.; Jaiswal, A.K.; Jaiswal, S. Essential oils as additives in active food packaging. Food Chem. 2021, 343, 128403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Noorbakhsh, F.; Rahmati, P. Effects of Thymus vulgaris and Cinnamomum verum Essential Oils on bap and ica Gene Expression in Staphylococcus aureus. Arch. Clin. Infect. Dis. 2022, 17, e122410. [Google Scholar] [CrossRef] [Scilit]
  26. Cáceres, M.; Hidalgo, W.; Stashenko, E.; Torres, R.; Ortiz, C. Essential Oils of Aromatic Plants with Antibacterial, Anti-Biofilm and Anti-Quorum Sensing Activities against Pathogenic Bacteria. Antibiotics 2020, 9, 147. [Google Scholar] [CrossRef] [Scilit]
  27. Martínez, A.; Manrique-Moreno, M.; Klaiss-Luna, M.C.; Stashenko, E.; Zafra, G.; Ortiz, C. Effect of essential oils on growth inhibition, biofilm formation and membrane integrity of Escherichia coli and Staphylococcus aureus. Antibiotics 2021, 10, 1474. [Google Scholar] [CrossRef] [Scilit]
  28. E Stashenko, E.; E Jaramillo, B.; Martínez, J.R. Comparison of different extraction methods for the analysis of volatile secondary metabolites of Lippia alba (Mill.) N.E. Brown, grown in Colombia, and evaluation of its in vitro antioxidant activity. J. Chromatogr. A 2004, 1025, 93–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Memar, M.Y.; Raei, P.; Alizadeh, N.; Aghdam, M.A.; Kafil, H.S. Carvacrol and thymol: Strong antimicrobial agents against resistant isolates. Rev. Med. Microbiol. 2017, 28, 63–68. [Google Scholar] [CrossRef] [Scilit]
  30. Chen, Q.; Xie, S.; Lou, X.; Cheng, S.; Liu, X.; Zheng, W.; Zheng, Z.; Wang, H. Biofilm formation and prevalence of adhesion genes among Staphylococcus aureus isolates from different food sources. MicrobiologyOpen 2020, 9, e00946. [Google Scholar] [CrossRef] [Scilit]
  31. Avila-Novoa, M.-G.; Iñíguez-Moreno, M.; Solís-Velázquez, O.-A.; González-Gómez, J.-P.; Guerrero-Medina, P.-J.; Gutiérrez-Lomelí, M. Biofilm Formation by Staphylococcus aureus Isolated from Food Contact Surfaces in the Dairy Industry of Jalisco, Mexico. J. Food Qual. 2018, 2018, 1746139. [Google Scholar] [CrossRef] [Scilit]
  32. Fitzpatrick, F.; Humphreys, H.; O’Gara, J.P. Evidence for icaADBC-Independent Biofilm Development Mechanism in Methicillin-Resistant Staphylococcus aureus Clinical Isolates. J. Clin. Microbiol. 2005, 43, 1973–1976. [Google Scholar] [CrossRef] [Scilit]
  33. Hoang, T.-M.; Zhou, C.; Lindgren, J.K.; Galac, M.R.; Corey, B.; Endres, J.E.; Olson, M.E.; Fey, P.D. Transcriptional Regulation of icaADBC by both IcaR and TcaR in Staphylococcus epidermidis. J. Bacteriol. 2019, 201, e00524-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Jeng, W.-Y.; Ko, T.-P.; Liu, C.-I.; Guo, R.-T.; Liu, C.-L.; Shr, H.-L.; Wang, A.H.-J. Crystal structure of IcaR, a repressor of the TetR family implicated in biofilm formation in Staphylococcus epidermidis. Nucleic Acids Res. 2008, 36, 1567–1577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Beenken, K.E.; Blevins, J.S.; Smeltzer, M.S. Mutation of sarA in Staphylococcus aureus Limits Biofilm Formation. Infect. Immun. 2003, 71, 4206–4211. [Google Scholar] [CrossRef] [Scilit]
  36. Valle, J.; Toledo-Arana, A.; Berasain, C.; Ghigo, J.M.; Amorena, B.; Penadés, J.R.; Lasa, I. SarA and not σB is essential for biofilm development by Staphylococcus aureus. Mol. Microbiol. 2003, 48, 1075–1087. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Valle, J.; Echeverz, M.; Lasa, I. σB inhibits poly-N-acetylglucosamine exopolysaccharide synthesis and biofilm formation in Staphylococcus aureus. J. Bacteriol. 2019, 201, e00098-19. [Google Scholar] [CrossRef] [Scilit]
  38. Blevins, J.S.; Beenken, K.E.; Elasri, M.O.; Hurlburt, B.K.; Smeltzer, M.S. Strain-dependent differences in the regulatory roles of sarA and agr in Staphylococcus aureus. Infect. Immun. 2002, 70, 470–480. [Google Scholar] [CrossRef] [Scilit]
  39. Foster, T.J. The MSCRAMM Family of Cell-Wall-Anchored Surface Proteins of Gram-Positive Cocci. Trends Microbiol. 2019, 27, 927–941. [Google Scholar] [CrossRef] [Scilit]
  40. Beenken, K.E.; Mrak, L.N.; Griffin, L.M.; Zielinska, A.K.; Shaw, L.; Rice, K.C.; Horswill, A.R.; Bayles, K.W.; Smeltzer, M.S. Epistatic Relationships between sarA and agr in Staphylococcus aureus Biofilm Formation. PLoS ONE 2010, 5, e10790. [Google Scholar] [CrossRef] [Scilit]
  41. Arora, S.; Li, X.; Hillhouse, A.; Konganti, K.; Little, S.V.; Lawhon, S.D.; Threadgill, D.; Shelburne, S.; Hook, M. Staphylococcus epidermidis MSCRAMM SesJ Is Encoded in Composite Islands. mBio 2020, 11, e02911-19. [Google Scholar] [CrossRef] [Scilit]
  42. Caballero, C.J.; Menendez-Gil, P.; Catalan-Moreno, A.; Vergara-Irigaray, M.; Garcia, B.; Segura, V.; Irurzun, N.; Villanueva, M.; Mozos, I.R.D.L.; Solano, C.; et al. The regulon of the RNA chaperone CspA and its auto-regulation in Staphylococcus aureus. Nucleic Acids Res. 2018, 46, 1345–1361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Caiazza, N.C.; O’Toole, G.A. Alpha-Toxin Is Required for Biofilm Formation by Staphylococcus aureus. J. Bacteriol. 2003, 185, 3214–3217. [Google Scholar] [CrossRef] [Scilit]
  44. Anderson, M.J.; Schaaf, E.; Breshears, L.M.; Wallis, H.W.; Johnson, J.R.; Tkaczyk, C.; Sellman, B.R.; Sun, J.; Peterson, M.L. Alpha-Toxin Contributes to Biofilm Formation among Staphylococcus aureus Wound Isolates. Toxins 2018, 10, 157. [Google Scholar] [CrossRef] [Scilit]
  45. Vuong, C.; Saenz, H.L.; Götz, F.; Otto, M. Impact of the agr quorum-sensing system on adherence to polystyrene in Staphylococcus aureus. J. Infect. Dis. 2000, 182, 1688–1693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Tan, L.; Li, S.R.; Jiang, B.; Hu, X.M.; Li, S. Therapeutic Targeting of the Staphylococcus aureus Accessory Gene Regulator (agr) System. Front. Microbiol. 2018, 9, 55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Derakhshan, S.; Navidinia, M.; Haghi, F. Antibiotic susceptibility of human-associated Staphylococcus aureus and its relation to agr typing, virulence genes, and biofilm formation. BMC Infect. Dis. 2021, 21, 1–10. [Google Scholar] [CrossRef] [Scilit]
  48. Morales, L.; Echeverz, M.; Trobos, M.; Solano, C.; Lasa, I. Diversity in regulatory regions of icaADBCR and fnbAB genes among Staphylococcus aureus strains isolated from periprosthetic joint infections (No. biofilms9-71). In Proceedings of the Copernicus Meetings, 2020. Biofilms 9 Online Conference, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany, 29 September–1 October 2020. [Google Scholar]
  49. Fang, B.; Liu, B.; Sun, B. Transcriptional regulation of virulence factors Hla and phenol-soluble modulins α by AraC-type regulator Rbf in Staphylococcus aureus. Int. J. Med. Microbiol. 2020, 310, 151436. [Google Scholar] [CrossRef] [Scilit]
  50. Lim, Y.; Jana, M.; Luong, T.T.; Lee, C.Y. Control of glucose-and NaCl-induced biofilm formation by rbf in Staphylococcus aureus. J. Bacteriol. 2004, 186, 722–729. [Google Scholar] [CrossRef] [Scilit]
  51. Cue, D.; Lei, M.G.; Luong, T.T.; Kuechenmeister, L.; Dunman, P.M.; O’Donnell, S.; Rowe, S.; O’Gara, J.P.; Lee, C.Y. Rbf promotes biofilm formation by Staphylococcus aureus via repression of icaR, a negative regulator of icaADBC. J. Bacteriol. 2009, 191, 6363–6373. [Google Scholar] [CrossRef] [Scilit]
  52. Prüß, B.M.; Besemann, C.; Denton, A.; Wolfe, A.J. A Complex Transcription Network Controls the Early Stages of Biofilm Development by Escherichia coli. J. Bacteriol. 2006, 188, 3731–3739. [Google Scholar] [CrossRef] [Scilit]
  53. Wood, T.K.; Barrios, A.F.G.; Herzberg, M.; Lee, J. Motility influences biofilm architecture in Escherichia coli. Appl. Microbiol. Biotechnol. 2006, 72, 361–367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Brombacher, E.; Baratto, A.; Dorel, C.; Landini, P. Gene Expression Regulation by the Curli Activator CsgD Protein: Modulation of Cellulose Biosynthesis and Control of Negative Determinants for Microbial Adhesion. J. Bacteriol. 2006, 188, 2027–2037. [Google Scholar] [CrossRef] [Scilit]
  55. Ogasawara, H.; Ishizuka, T.; Hotta, S.; Aoki, M.; Shimada, T.; Ishihama, A. Novel regulators of the csgD gene encoding the master regulator of biofilm formation in Escherichia coli K-12. Microbiology 2020, 166, 880–890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Yoshida, M.; Thiriet-Rupert, S.; Mayer, L.; Beloin, C.; Ghigo, J.-M. Selection for nonspecific adhesion is a driver of FimH evolution increasing Escherichia coli biofilm capacity. Microlife 2022, 3, 1–14. [Google Scholar] [CrossRef] [Scilit]
  57. Zuberi, A.; Ahmad, N.; Khan, A.U. CRISPRi Induced Suppression of Fimbriae Gene (fimH) of a Uropathogenic Escherichia coli: An Approach to Inhibit Microbial Biofilms. Front. Immunol. 2017, 8, 1552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Scotti, R.; Stringaro, A.; Nicolini, L.; Zanellato, M.; Boccia, P.; Maggi, F.; Gabbianelli, R. Effects of Essential Oils from Cymbopogon spp. and Cinnamomum verum on Biofilm and Virulence Properties of Escherichia coli O157: H7. Antibiotics 2022, 10, 113. [Google Scholar] [CrossRef] [Scilit]
  59. Itoh, Y.; Rice, J.D.; Goller, C.; Pannuri, A.; Taylor, J.; Meisner, J.; Beveridge, T.J.; Preston, J.F., III; Romeo, T. Roles of pgaABCD genes in synthesis, modification, and export of the Escherichia coli biofilm adhesin poly-β-1, 6-N-acetyl-d-glucosamine. J. Bacteriol. 2008, 190, 3670–3680. [Google Scholar] [CrossRef] [Scilit]
  60. Attila, C.; Ueda, A.; Wood, T.K. 5-Fluorouracil reduces biofilm formation in Escherichia coli K-12 through global regulator AriR as an antivirulence compound. Appl. Microbiol. Biotechnol. 2009, 82, 525–533. [Google Scholar] [CrossRef] [Scilit]
  61. Wood, T.K. Insights on Escherichia coli biofilm formation and inhibition from whole-transcriptome profiling. Environ. Microbiol. 2009, 11, 1–15. [Google Scholar] [CrossRef] [Scilit]
  62. Yao, Y.; Martinez-Yamout, M.A.; Dickerson, T.J.; Brogan, A.P.; Wright, P.E.; Dyson, H.J. Structure of the Escherichia coli Quorum Sensing Protein SdiA: Activation of the Folding Switch by Acyl Homoserine Lactones. J. Mol. Biol. 2006, 355, 262–273. [Google Scholar] [CrossRef] [Scilit]
  63. Jani, S.; Seely, A.L.; Peabody V, G.L.; Jayaraman, A.; Manson, M.D. Chemotaxis to self-generated AI-2 promotes biofilm formation in Escherichia coli. Microbiology 2017, 163, 1778–1790. [Google Scholar] [CrossRef] [Scilit]
  64. Sperandio, V.; Torres, A.G.; Kaper, J.B. Quorum sensing Escherichia coli regulators B and C (QseBC): A novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli. Mol. Microbiol. 2002, 43, 809–821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Yang, K.; Meng, J.; Huang, Y.-C.; Ye, L.-H.; Li, G.-J.; Huang, J.; Chen, H.-M. The Role of the QseC Quorum-Sensing Sensor Kinase in Epinephrine-Enhanced Motility and Biofilm Formation by Escherichia coli. Cell Biochem. Biophys. 2014, 70, 391–398. [Google Scholar] [CrossRef] [Scilit]
  66. Lee, J.; Maeda, T.; Hong, S.H.; Wood, T.K. Reconfiguring the Quorum-Sensing Regulator SdiA of Escherichia coli to Control Biofilm Formation via Indole and N -Acylhomoserine Lactones. Appl. Environ. Microbiol. 2009, 75, 1703–1716. [Google Scholar] [CrossRef] [Scilit]
  67. Culler, H.F.; Couto, S.C.F.; Higa, J.S.; Ruiz, R.M.; Yang, M.J.; Bueris, V.; Franzolin, M.R.; Sircili, M.P. Role of SdiA on Biofilm Formation by Atypical Enteropathogenic Escherichia coli. Genes 2018, 9, 253. [Google Scholar] [CrossRef] [Scilit]
  68. Kim, T.; Duong, T.; Wu, C.A.; Choi, J.; Lan, N.; Kang, S.W.; Lokanath, N.K.; Shin, D.; Hwang, H.Y.; Kim, K.K. Structural insights into the molecular mechanism of Escherichia coli SdiA, a quorum-sensing receptor. Acta Crystallogr. Sect. D Biol. Crystallogr. 2014, 70, 694–707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Stashenko, E.E.; Martínez, J.R.; Ruíz, C.A.; Arias, G.; Durán, C.; Salgar, W.; Cala, M. Lippia origanoides chemotype differentiation based on essential oil GC-MS and principal component analysis. J. Sep. Sci. 2010, 33, 93–103. [Google Scholar] [CrossRef] [Scilit]
  70. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Scilit]
  71. Kibbe, W.A. OligoCalc: An online oligonucleotide properties calculator. Nucleic Acids Res. 2007, 35 (Suppl. 2), W43–W46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Jacquet, R.; LaBauve, A.E.; Akoolo, L.; Patel, S.; Alqarzaee, A.A.; Lung, T.W.F.; Poorey, K.; Stinear, T.P.; Thomas, V.C.; Meagher, R.J.; et al. Dual Gene Expression Analysis Identifies Factors Associated with Staphylococcus aureus Virulence in Diabetic Mice. Infect. Immun. 2019, 87, e00163-19. [Google Scholar] [CrossRef] [Scilit]
  73. Tuttobene, M.R.; Pérez, J.F.; Pavesi, E.S.; Mora, B.P.; Biancotti, D.; Cribb, P.; Altilio, M.; Müller, G.L.; Gramajo, H.; Tamagno, G.; et al. Light Modulates Important Pathogenic Determinants and Virulence in ESKAPE Pathogens Acinetobacter baumannii, Pseudomonas aeruginosa, and Staphylococcus aureus. J. Bacteriol. 2021, 203, e00566-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  74. Yeo, W.-S.; Anokwute, C.; Marcadis, P.; Levitan, M.; Ahmed, M.; Bae, Y.; Kim, K.; Kostrominova, T.; Liu, Q.; Bae, T. A Membrane-Bound Transcription Factor is Proteolytically Regulated by the AAA+ Protease FtsH in Staphylococcus aureus. J. Bacteriol. 2020, 202, e00019-20. [Google Scholar] [CrossRef] [Scilit]
  75. Wang, B.; Duan, J.; Jin, Y.; Zhan, Q.; Xu, Y.; Zhao, H.; Wang, X.; Rao, L.; Guo, Y.; Yu, F. Functional Insights of MraZ on the Pathogenicity of Staphylococcus aureus. Infect. Drug Resist. 2021, 14, 4539–4551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  76. Divyakolu, S.; Chikkala, R.; Kamaraju, S.; Sritharan, V. Quorum quenching as a strategy for treating Methicillin Resistant S. aureus (MRSA)—Effect of ε-Polylysine, ethanolic extracts of guava leaves and mango seed kernel. Indian J. Biochem. Biophys. 2021, 58, 171–177. [Google Scholar] [CrossRef] [Scilit]
  77. Atshan, S.S.; Shamsudin, M.N.; Karunanidhi, A.; van Belkum, A.; Lung, L.T.T.; Sekawi, Z.; Nathan, J.J.; Ling, K.H.; Seng, J.S.C.; Ali, A.M.; et al. Quantitative PCR analysis of genes expressed during biofilm development of methicillin resistant Staphylococcus aureus (MRSA). Infect. Genet. Evol. 2013, 18, 106–112. [Google Scholar] [CrossRef] [Scilit]
  78. Mahmoudi, H.; Pourhajibagher, M.; Alikhani, M.Y.; Bahador, A. The effect of antimicrobial photodynamic therapy on the expression of biofilm associated genes in Staphylococcus aureus strains isolated from wound infections in burn patients. Photodiagnosis Photodyn. Ther. 2019, 25, 406–413. [Google Scholar] [CrossRef] [Scilit]
  79. Kalinka, J.; Hachmeister, M.; Geraci, J.; Sordelli, D.; Hansen, U.; Niemann, S.; Oetermann, S.; Peters, G.; Löffler, B.; Tuchscherr, L. Staphylococcus aureus isolates from chronic osteomyelitis are characterized by high host cell invasion and intracellular adaptation, but still induce inflammation. Int. J. Med. Microbiol. 2014, 304, 1038–1049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  80. Demirci, M.; Yiğin, A.; Demir, C. Efficacy of antimicrobial peptide LL-37 against biofilm forming Staphylococcus aureus strains obtained from chronic wound infections. Microb. Pathog. 2022, 162, 105368. [Google Scholar] [CrossRef] [Scilit]
  81. Ma, R.; Qiu, S.; Jiang, Q.; Sun, H.; Xue, T.; Cai, G.; Sun, B. AI-2 quorum sensing negatively regulates rbf expression and biofilm formation in Staphylococcus aureus. Int. J. Med. Microbiol. 2017, 307, 257–267. [Google Scholar] [CrossRef] [Scilit]
  82. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effect of different subinhibitory concentrations of the LOTC II EO on bacterial planktonic cell cultures. (A) E. coli ATCC 25922; (B) S. aureus ATCC 29213.
Figure 1. Effect of different subinhibitory concentrations of the LOTC II EO on bacterial planktonic cell cultures. (A) E. coli ATCC 25922; (B) S. aureus ATCC 29213.
Antibiotics 12 00845 g001
Figure 2. Evaluation of the inhibitory effect of the LOTC II EO at a concentration of 0.37 mg/mL on planktonic and sessile cells in 50 mL bioreactors cultivated with E. coli and S. aureus.
Figure 2. Evaluation of the inhibitory effect of the LOTC II EO at a concentration of 0.37 mg/mL on planktonic and sessile cells in 50 mL bioreactors cultivated with E. coli and S. aureus.
Antibiotics 12 00845 g002
Figure 3. Agarose gel electrophoresis of amplicons of different genes obtained by RT-qPCR of samples from (A) E. coli ATCC 25922. Lanes: 1. MW markers (50–1000 pb), 2. rssA, 3. SdiA. 4. Pgac, 5. qseC, 6. csgD, 7. ariR, 8. LuxS, 9. fimH. (B) S. aureus ATCC 29213. Lanes: 1. MW markers (50–1000 pb), 2. hla, 3. agrA, 4. RNAIII, 5. rbf, 6. icaA, 7. icaD, 8. aur, 9. SarA, 10. nuc.
Figure 3. Agarose gel electrophoresis of amplicons of different genes obtained by RT-qPCR of samples from (A) E. coli ATCC 25922. Lanes: 1. MW markers (50–1000 pb), 2. rssA, 3. SdiA. 4. Pgac, 5. qseC, 6. csgD, 7. ariR, 8. LuxS, 9. fimH. (B) S. aureus ATCC 29213. Lanes: 1. MW markers (50–1000 pb), 2. hla, 3. agrA, 4. RNAIII, 5. rbf, 6. icaA, 7. icaD, 8. aur, 9. SarA, 10. nuc.
Antibiotics 12 00845 g003
Figure 4. Transcriptional profiles of genes expressed in different cell culture stages of E. coli ATCC 25922 treated and untreated with the LOTC II EO. (A) Planktonic cells, (B) Biofilm. The relative expression of target genes was normalized to the reference genes. All data represent transcriptional levels of genes after EO treatment versus untreated controls at 24 h incubation time. Statistical differences are indicated with asterisks (* p ≤ 0.05, ** p ≤ 0.02, **** p ≤ 0.0001, *** p ≤ 0.0002, ns: not significant).
Figure 4. Transcriptional profiles of genes expressed in different cell culture stages of E. coli ATCC 25922 treated and untreated with the LOTC II EO. (A) Planktonic cells, (B) Biofilm. The relative expression of target genes was normalized to the reference genes. All data represent transcriptional levels of genes after EO treatment versus untreated controls at 24 h incubation time. Statistical differences are indicated with asterisks (* p ≤ 0.05, ** p ≤ 0.02, **** p ≤ 0.0001, *** p ≤ 0.0002, ns: not significant).
Antibiotics 12 00845 g004
Figure 5. Transcriptional profiles of genes expressed in different cell culture stages of S. aureus ATCC 29213 treated and untreated with the LOTC II EO. (A) Planktonic cells, (B) Biofilm. The relative expression of target genes was normalized to the reference genes. All data represent transcriptional levels of genes after EO treatment versus untreated controls at 24 h incubation time. Statistical differences are indicated with asterisks (* p ≤ 0.05, ** p ≤ 0.02, **** p ≤ 0.0001, *** p ≤ 0.0002, ns: not significant).
Figure 5. Transcriptional profiles of genes expressed in different cell culture stages of S. aureus ATCC 29213 treated and untreated with the LOTC II EO. (A) Planktonic cells, (B) Biofilm. The relative expression of target genes was normalized to the reference genes. All data represent transcriptional levels of genes after EO treatment versus untreated controls at 24 h incubation time. Statistical differences are indicated with asterisks (* p ≤ 0.05, ** p ≤ 0.02, **** p ≤ 0.0001, *** p ≤ 0.0002, ns: not significant).
Antibiotics 12 00845 g005
Table 1. Five major chemical constituents of the L. origanoides EO. The relative amount of each compound is reported as a percentage (%).
Table 1. Five major chemical constituents of the L. origanoides EO. The relative amount of each compound is reported as a percentage (%).
CodePlant SpeciesChemotypeMajor Components
LOTC IILippia origanoides (Verbenaceae)Thymol-carvacrol IIγ-Terpinene (5.2%), p-cymene (1.1%), thymol (32.7%), carvacrol (18.8%), and trans-β-caryophyllene (6.4%)
Table 2. Effect of different subinhibitory concentrations of the LOTC II EO on biofilm formation of E. coli and S. aureus.
Table 2. Effect of different subinhibitory concentrations of the LOTC II EO on biofilm formation of E. coli and S. aureus.
LOTC II (mg/mL)E. coli ATCC 25922S. aureus ATCC 29213
Absorbance (OD 595 nm)Biofilm Formation Inhibition (%)Planktonic Cell Concentration (CFU/mL)Absorbance (OD 595 nm)Biofilm Formation Inhibition (%)Planktonic Cell Concentration (CFU/mL)
0.370.410245.0 × 1060.730194.10 × 108
0.400.134763.9 × 1060.253723.60 × 108
0.450.034941.9 × 1060.045951.85 × 108
Control0.540-4.3 × 1060.896-3.90 × 108
Table 3. Evaluation of the concentration and quality of total extracted RNA from treated and untreated samples with the LOTC II EO.
Table 3. Evaluation of the concentration and quality of total extracted RNA from treated and untreated samples with the LOTC II EO.
Sample ConditionConcentration (ng/μL)Absorbance Ratio (260/280)
Planktonic E. coli with no-treatment631.99
Planktonic E. coli with treatment582.02
Planktonic E. coli with no-treatment492.10
E. coli biofilm with treatment431.98
Planktonic E. coli with no-treatment1202.00
Planktonic S. aureus with treatment1001.98
Planktonic E. coli with no-treatment972.01
S. aureus biofilm with treatment802.00
Table 4. List of genes and their respective primers for evaluation of the effect of the EO from LOTC on E. coli gene expression during QS communication and biofilm formation.
Table 4. List of genes and their respective primers for evaluation of the effect of the EO from LOTC on E. coli gene expression during QS communication and biofilm formation.
GenePrimerSequence 5′ to 3′Product Size (pb)Tm (°C)% GCReferences
SdiASdiA 1
SdiA 2
CGGTGCTGAACCCTGAA
CGCTGCAACGGGAAAA
17759.3
60.5
58.8
56.2
(This work)
LuxSLuxS 1
LuxS 2
TGTTGCTGATGCCTGGAA
CTTTCGGCAGTGCCAGTT
19459.9
60.0
50.0
55.6
(This work)
FimHFimH 1
FimH 2
GGCTGCGATGTTTCTGCT
CCCCAGGTTTTGGCTTTT
10560.1
59.9
55.6
50
(This work)
csgDcsgD 1
csgD 2
CCGTACCGCGACATTGA
CGCCTTGCAACCCATT
9160.2
59.1
58.8
56.2
(This work)
ariRariR 1
ariR 2
TGTTAGGGCAGGCTGTCA
TCGCAACACGATTTCCAG
14958.9
59.3
55.6
50.0
(This work)
pgaCpgaC 1
pgaC 2
TTGATGGCGATGCGTTATTA
GGAATACTCGCCAACCTGAA
15360.1
60.1
40
50
(This work)
qseCqseC 1
qseC 2
ACCCACGACGGCAGAAT
GCCCGTCAGCAAAACCT
8860.1
59.8
58.8
58.8
(This work)
RNArrssA 1
rssA 2
AGGTGATCCGCCCGATA
CGGCAAAAGTTCGTCCA
13060.0
59.3
58.8
52.9
(This work)
Table 5. List of genes and their respective primers for evaluation of the effect of the EO from LOTC on S. aureus gene expression during QS communication and biofilm formation.
Table 5. List of genes and their respective primers for evaluation of the effect of the EO from LOTC on S. aureus gene expression during QS communication and biofilm formation.
GenePrimerSequence 5′ to 3′Product Size (pb)Tm (°C)% GCReferences
hlaHla 1
Hla 2
GGCCTTATTGGTGCAAATGT
CCATATACCGGGTTCCAAGA
17659.8
59.6
45
50
[72,73,74]
agrAagrA 1
agrA 2
CAACCACAAGTTGTTAAAGCAG
TCGTTGTTTGCTTCAGTGATTC
17357.6
60.3
40.9
40.9
(This work)
RNAIIIRNAIII 1
RNAIII 2
CATGGTTATTAAGTTGGGATGGC
GAAGGAGTGATTTCAATGGCACA
18858.31
60.02
43.48
43.48
[75,76]
icaAicaA 1
icaA 2
GAGGTAAAGCCAACGCACTC
CCTGTAACCGCACCAAGTTT
15159.70
59.18
55
50
[77,78]
icaDicaD 1
icaD 2
ACCCAACGCTAAAATCATCG
GCGAAAATGCCCATAGTTTC
21156.99
56.16
45
45
[77,78]
aurAur 1
Aur 2
ACCGTGTGTTAATTCGTGTGCTA
ATGGTCGCACATTCACAAGTTT
6561.33
59.90
43.49
40.91
[79]
SarASarA 1
SarA 2
GTAATGAGCATGATGAAAGAACTGT
CGTTGTTTGCTTCAGTGATTCG
11158.44
59.53
36
45.45
[80]
rbfRbf 1
Rbf 2
AACCACCTAACTGATGTTATAC
GACAACTTGACTGTTCTTATTC
15653.77
53.59
36.36
36.36
[81]
RNArNuc 1
Nuc 2
AATATGGACGTGGCTTAGCGT
TTGACCTGAATCAGCGTTGTCTT
19760.38
61.28
47.62
43.48
(This work)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Martínez, A.; Stashenko, E.E.; Sáez, R.T.; Zafra, G.; Ortiz, C. Effect of Essential Oil from Lippia origanoides on the Transcriptional Expression of Genes Related to Quorum Sensing, Biofilm Formation, and Virulence of Escherichia coli and Staphylococcus aureus. Antibiotics 2023, 12, 845. https://doi.org/10.3390/antibiotics12050845

AMA Style

Martínez A, Stashenko EE, Sáez RT, Zafra G, Ortiz C. Effect of Essential Oil from Lippia origanoides on the Transcriptional Expression of Genes Related to Quorum Sensing, Biofilm Formation, and Virulence of Escherichia coli and Staphylococcus aureus. Antibiotics. 2023; 12(5):845. https://doi.org/10.3390/antibiotics12050845

Chicago/Turabian Style

Martínez, Andrés, Elena E. Stashenko, Rodrigo Torres Sáez, German Zafra, and Claudia Ortiz. 2023. "Effect of Essential Oil from Lippia origanoides on the Transcriptional Expression of Genes Related to Quorum Sensing, Biofilm Formation, and Virulence of Escherichia coli and Staphylococcus aureus" Antibiotics 12, no. 5: 845. https://doi.org/10.3390/antibiotics12050845

APA Style

Martínez, A., Stashenko, E. E., Sáez, R. T., Zafra, G., & Ortiz, C. (2023). Effect of Essential Oil from Lippia origanoides on the Transcriptional Expression of Genes Related to Quorum Sensing, Biofilm Formation, and Virulence of Escherichia coli and Staphylococcus aureus. Antibiotics, 12(5), 845. https://doi.org/10.3390/antibiotics12050845

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop