Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers
Abstract
1. Introduction
2. Results
2.1. Prevalence of S. aureus in Examined Sample
2.2. Molecular Characterization of Isolated S. aureus
2.3. Antibiotic Susceptibility Test of S. aureus
3. Discussion
4. Materials and Methods
4.1. Samples Collection and Preparation
4.1.1. Animal Samples
4.1.2. Human Samples
4.2. Isolation and Identification of S. aureus
4.3. Molecular Characterization of Isolated S. aureus:
4.3.1. DNA Extraction
4.3.2. DNA Amplification
4.4. Reference Strain
4.5. Antimicrobial Susceptibility Testing
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kadariya, J.; Smith, T.C.; Thapaliya, D. Staphylococcus aureus and Staphylococcal Food-Borne Disease: An Ongoing Challenge in Public Health. Biomed Res. Int. 2014, 2014, 827965. [Google Scholar] [CrossRef] [Scilit]
- Peton, V.; Le Loir, Y. Staphylococcus aureus in Veterinary Medicine. Infect. Genet. Evol. 2014, 21, 602–615. [Google Scholar] [CrossRef] [Scilit]
- Algammal, A.M.; Hetta, H.F.; Elkelish, A.; Alkhalifah, D.H.H.; Hozzein, W.N.; Batiha, G.E.S.; El Nahhas, N.; Mabrok, M.A. Methicillin-Resistant Staphylococcus aureus (MRSA): One Health Perspective Approach to the Bacterium Epidemiology, Virulence Factors, Antibiotic-Resistance, and Zoonotic Impact. Infect. Drug Resist. 2020, 13, 3255–3265. [Google Scholar] [CrossRef] [Scilit]
- Nandhini, P.; Kumar, P.; Mickymaray, S.; Alothaim, A.S.; Somasundaram, J.; Rajan, M. Recent Developments in Methicillin-Resistant Staphylococcus aureus (MRSA) Treatment: A Review. Antibiotics 2022, 11, 606. [Google Scholar] [CrossRef] [Scilit]
- Mechesso, A.F.; Moon, D.C.; Ryoo, G.S.; Song, H.J.; Chung, H.Y.; Kim, S.U.; Choi, J.H.; Kim, S.J.; Kang, H.Y.; Na, S.H.; et al. Resistance Profiling and Molecular Characterization of Staphylococcus aureus Isolated from Goats in Korea. Int. J. Food Microbiol. 2021, 336, 108901. [Google Scholar] [CrossRef] [Scilit]
- Dweba, C.C.; Zishiri, O.T.; El Zowalaty, M.E. Methicillin-Resistant Staphylococcus aureus: Livestock-Associated, Antimicrobial, and Heavy Metal Resistance. Infect. Drug Resist. 2018, 11, 2497–2509. [Google Scholar] [CrossRef] [Scilit]
- Vanderhaeghen, W.; Hermans, K.; Haesebrouck, F.; Butaye, P. Methicillin-Resistant Staphylococcus aureus (MRSA) in Food Production Animals. Epidemiol. Infect. 2010, 138, 606–625. [Google Scholar] [CrossRef] [Scilit]
- Dai, X.H.; Li, H.E.; Lu, C.J.; Wang, J.F.; Dong, J.; Wei, J.Y.; Zhang, Y.; Wang, X.; Tan, W.; Deng, X.M.; et al. Liquiritigenin Prevents Staphylococcus aureus-Mediated Lung Cell Injury via Inhibiting the Production of α-Hemolysin. J. Asian Nat. Prod. Res. 2013, 15, 390–399. [Google Scholar] [CrossRef] [Scilit]
- Song, M.; Bai, Y.; Xu, J.; Carter, M.Q.; Shi, C.; Shi, X. Genetic Diversity and Virulence Potential of Staphylococcus aureus Isolates from Raw and Processed Food Commodities in Shanghai. Int. J. Food Microbiol. 2015, 195, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.B.; Seo, K.W.; Jeon, H.Y.; Lim, S.K.; Lee, Y.J. Erratum: Corrigendum to “Characteristics of the Antimicrobial Resistance of Staphylococcus aureus Isolated from Chicken Mean Produced by Different Integrated Broiler Operations in Korea” (Poultry Science (2018) 97 3 (962–969)). Poult. Sci. 2018, 97, 3762. [Google Scholar] [CrossRef] [Scilit]
- Gebreyes, W.A.; Jackwood, D.; de Oliveira, C.J.B.; Lee, C.-W.; Hoet, A.E.; Thakur, S. Molecular Epidemiology of Infectious Zoonotic and Livestock Diseases. Microbiol. Spectr. 2020, 8, 2–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chambers, H.F.; DeLeo, F.R. Waves of Resistance: Staphylococcus aureus in the Antibiotic Era. Nat. Rev. Microbiol. 2009, 7, 629–641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rammelkamp, C.H. Observations on Resistance of Staphylococcus aureus to Action of Tyrothricin. Proc. Soc. Exp. Biol. Med. 1942, 49, 346–350. [Google Scholar] [CrossRef] [Scilit]
- Lade, H.; Joo, H.S.; Kim, J.S. Molecular Basis of Non-β-Lactam Antibiotics Resistance in Staphylococcus aureus. Antibiotics 2022, 11, 1378. [Google Scholar] [CrossRef] [Scilit]
- Faccone, D.; Togneri, A.M.; Podesta, L.; Perez, M.; Gagetti, P.; Sanchez, S.; Romero, G.; Corso, A. MRSA Pediatric Clone Expressing ermC plus lnuA Genes Causing Nosocomial Transmission and Healthcare Workers Colonization in a Neonatal Intensive Care Unit. Infect. Genet. Evol. 2014, 25, 78–80. [Google Scholar] [CrossRef] [Scilit]
- Sattler, C.A.; Mason, E.O.; Kaplan, S.L. Prospective Comparison of Risk Factors and Demographic and Clinical Characteristics of Community-Acquired, Methicillin-Resistant versus Methicillin-Susceptible Staphylococcus aureus Infection in Children. Pediatr. Infect. Dis. J. 2002, 21, 910–916. [Google Scholar] [CrossRef] [Scilit]
- Osman, K.M.; Badr, J.; Orabi, A.; Elbehiry, A.; Saad, A.; Ibrahim, M.D.S.; Hanafy, M.H. Poultry as a Vector for Emerging Multidrug Resistant Enterococcus Spp.: First Report of Vancomycin (van) and the Chloramphenicol–Florfenicol (Cat-Fex-Cfr) Resistance Genes from Pigeon and Duck Faeces. Microb. Pathog. 2019, 128, 195–205. [Google Scholar] [CrossRef] [Scilit]
- Feßler, A.T.; Kadlec, K.; Schwarz, S. Novel Apramycin Resistance Gene apmA in Bovine and Porcine Methicillin-Resistant Staphylococcus aureus ST398 Isolates. Antimicrob. Agents Chemother. 2011, 55, 373–375. [Google Scholar] [CrossRef] [Scilit]
- Argudín, M.A.; Mendoza, M.C.; González-Hevia, M.A.; Bances, M.; Guerra, B.; Rodicio, M.R. Genotypes, Exotoxin Gene Content, and Antimicrobial Resistance of Staphylococcus aureus Strains Recovered from Foods and Food Handlers. Appl. Environ. Microbiol. 2012, 78, 2930–2935. [Google Scholar] [CrossRef] [Scilit]
- Azimian, A.; Havaei, S.A.; Fazeli, H.; Naderi, M.; Ghazvini, K.; Samiee, S.M.; Soleimani, M.; Peerayeh, S.N. Genetic Characterization of a Vancomycin-Resistant Staphylococcus aureus Isolate from the Respiratory Tract of a Patient in a University Hospital in Northeastern Iran. J. Clin. Microbiol. 2012, 50, 3581–3585. [Google Scholar] [CrossRef] [Scilit]
- Wendlandt, S.; Feßler, A.T.; Monecke, S.; Ehricht, R.; Schwarz, S.; Kadlec, K. The Diversity of Antimicrobial Resistance Genes among Staphylococci of Animal Origin. Int. J. Med. Microbiol. 2013, 303, 338–349. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Huang, T.; Xu, K.; Li, C.; Li, Y. Molecular Characteristics and Virulence Gene Profiles of Staphylococcus aureus Isolates in Hainan, China. BMC Infect. Dis. 2019, 19, 487–494. [Google Scholar] [CrossRef] [Scilit]
- Mehrotra, M.; Wang, G.; Johnson, W.M. Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. J. Clin. Microbiol. 2000, 38, 1032–1035. [Google Scholar] [CrossRef] [Scilit]
- Tristan, A.; Ying, L.; Bes, M.; Etienne, J.; Vandenesch, F.; Lina, G. Use of Multiplex PCR to Identify Staphylococcus aureus Adhesins Involved in Human Hematogenous Infections. J. Clin. Microbiol. 2003, 41, 4465–4467. [Google Scholar] [CrossRef] [Scilit]
- Matsuhashi, M.; Song, M.D.; Ishino, F.; Wachi, M.; Doi, M.; Inoue, M.; Ubukata, K.; Yamashita, N.; Konno, M. Molecular Cloning of the Gene of a Penicillin-Binding Protein Supposed to Cause High Resistance to β-Lactam Antibiotics in Staphylococcus aureus. J. Bacteriol. 1986, 167, 975–980. [Google Scholar] [CrossRef] [Scilit]
- Itou, T.; Katayama, Y.; Hiramatsu, K. A New Mobile Genetic Element, Staphylococcal Cassette Chromosome Mec, Encodes Methicillin Resistance in Staphylococcus aureus. Nippon. Saikingaku Zasshi. Jpn. J. Bacteriol. 2000, 55, 483–498. [Google Scholar] [CrossRef]
- Vijayaraj, R.; Altaff, K.; Lakshmanan, G.; Jayaprakashvel, M.; Mickymaray, S.; Gunapriya, R.; Palanisamy, M.; Alothaim, A.S. Inhibitory Activity of Chitin, (2-Acetamido-2-Deoxy-Hexopyranose) against Penicillin-Binding Proteins of Staphylococcus aureus. Coatings 2022, 12, 1854. [Google Scholar] [CrossRef] [Scilit]
- Utsui, Y.; Yokota, T. Role of an Altered Penicillin-Binding Protein in Methicillin- and Cephem-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 1985, 28, 397–403. [Google Scholar] [CrossRef] [Scilit]
- Lade, H.; Kim, J.S. Bacterial Targets of Antibiotics in Methicillin-Resistant Staphylococcus aureus. Antibiotics 2021, 10, 398. [Google Scholar] [CrossRef] [Scilit]
- Watkins, R.R.; Holubar, M.; David, M.Z. Antimicrobial Resistance in Methicillin-Resistant Staphylococcus aureus to Newer Antimicrobial Agents. Antimicrob. Agents Chemother. 2019, 63, e01216-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fisher, J.F.; Mobashery, S. Enzymology of Bacterial Resistance. Compr. Nat. Prod. II Chem. Biol. 2010, 8, 443–487. [Google Scholar] [CrossRef] [Scilit]
- Périchon, B.; Courvalin, P. VanA-Type Vancomycin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2009, 53, 4580–4587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Münch, D.; Sahl, H.G. Structural Variations of the Cell Wall Precursor Lipid II in Gram-Positive Bacteria—Impact on Binding and Efficacy of Antimicrobial Peptides. Biochim. Biophys. Acta Biomembr. 2015, 1848, 3062–3071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rouch, D.A.; Byrne, M.E.; Kong, Y.C.; Skurray, R.A. The AacA-AphD Gentamicin and Kanamycin Resistance Determinant of Tn4001 from Staphylococcus aureus: Expression and Nucleotide Sequence Analysis. Microbiology 1987, 133, 3039–3052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ubukata, K.; Konno, M.; Shirahata, K.; Iida, T. Gentamicin Resistance in Staphylococcus aureus Isolated in Japan. Chemotherapy 1982, 30, 546–553. [Google Scholar] [CrossRef]
- Ida, T.; Okamoto, R.; Shimauchi, C.; Okubo, T.; Kuga, A.; Inoue, M. Identification of Aminoglycoside-Modifying Enzymes by Susceptibility Testing: Epidemiology of Methicillin-Resistant Staphylococcus aureus in Japan. J. Clin. Microbiol. 2001, 39, 3115–3121. [Google Scholar] [CrossRef] [Scilit]
- Martineau, F.; Picard, F.J.; Lansac, N.; Ménard, C.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Correlation between the Resistance Genotype Determined by Multiplex PCR Assays and the Antibiotic Susceptibility Patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob. Agents Chemother. 2000, 44, 231–238. [Google Scholar] [CrossRef] [Scilit]
- Leclercq, R.; Courvalin, P. Bacterial Resistance to Macrolide, Lincosamide, and Streptogramin Antibiotics by Target Modification. Antimicrob. Agents Chemother. 1991, 35, 1267–1272. [Google Scholar] [CrossRef] [Scilit]
- Ross, J.I.; Eady, E.A.; Cove, J.H.; Cunliffe, W.J.; Baumberg, S.; Wootton, J.C. Inducible Erythromycin Resistance in Staphlyococci Is Encoded by a Member of the ATP-binding Transport Super-gene Family. Mol. Microbiol. 1990, 4, 1207–1214. [Google Scholar] [CrossRef] [Scilit]
- Emaneini, M.; Bigverdi, R.; Kalantar, D.; Soroush, S.; Jabalameli, F.; Noorazar Khoshgnab, B.; Asadollahi, P.; Taherikalani, M. Distribution of Genes Encoding Tetracycline Resistance and Aminoglycoside Modifying Enzymes in Staphylococcus aureus Strains Isolated from a Burn Center. Ann. Burn. Fire Disasters 2013, 26, 76–80. [Google Scholar]
- Ardic, N.; Ozyurt, M.; Sareyyupoglu, B.; Haznedaroglu, T. Investigation of Erythromycin and Tetracycline Resistance Genes in Methicillin-Resistant Staphylococci. Int. J. Antimicrob. Agents 2005, 26, 213–218. [Google Scholar] [CrossRef] [Scilit]
- Marty, E.; Bodenmann, C.; Buchs, J.; Hadorn, R.; Eugster-Meier, E.; Lacroix, C.; Meile, L. Prevalence of Antibiotic Resistance in Coagulase-Negative Staphylococci from Spontaneously Fermented Meat Products and Safety Assessment for New Starters. Int. J. Food Microbiol. 2012, 159, 74–83. [Google Scholar] [CrossRef] [Scilit]
- Kenawy, E.R.; Ali, S.S.; Al-Etewy, M.; Sun, J.; Wu, J.; El-Zawawy, N. Synthesis, Characterization and Biomedical Applications of a Novel Schiff Base on Methyl Acrylate-Functionalized Chitosan Bearing p-Nitrobenzaldehyde Groups. Int. J. Biol. Macromol. 2019, 122, 833–843. [Google Scholar] [CrossRef] [Scilit]
- Van, T.T.H.; Nguyen, H.N.K.; Smooker, P.M.; Coloe, P.J. The Antibiotic Resistance Characteristics of Non-Typhoidal Salmonella enterica Isolated from Food-Producing Animals, Retail Meat and Humans in South East Asia. Int. J. Food Microbiol. 2012, 154, 98–106. [Google Scholar] [CrossRef] [Scilit]
- Cutler, S.J.; Fooks, A.R.; Van Der Poel, W.H.M. Public Health Threat of New, Reemerging, and Neglected Zoonoses in the Industrialized World. Emerg. Infect. Dis. 2010, 16, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Pantosti, A. Methicillin-Resistant Staphylococcus aureus Associated with Animals and Its Relevance to Human Health. Front. Microbiol. 2012, 3, 127. [Google Scholar] [CrossRef] [Scilit]
- Osman, K.M.; Amer, A.M.; Badr, J.M.; Helmy, N.M.; Elhelw, R.A.; Orabi, A.; Bakry, M.; Saad, A.S.A. Antimicrobial Resistance, Biofilm Formation and mecA Characterization of Methicillin-Susceptible S. aureus and Non-S. aureus of Beef Meat Origin in Egypt. Front. Microbiol. 2016, 7, 222. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Li, Y.; Tang, Y.; Meng, C.; Ingmer, H.; Jiao, X. Prevalence and Characterization of Staphylococcus aureus and Staphylococcus argenteus in Chicken from Retail Markets in China. Food Control. 2019, 96, 158–164. [Google Scholar] [CrossRef] [Scilit]
- Chaalal, W.; Chaalal, N.; Bourafa, N.; Kihal, M.; Diene, S.M.; Rolain, J.M. Characterization of Staphylococcus aureus Isolated from Food Products in Western Algeria. Foodborne Pathog. Dis. 2018, 15, 353–360. [Google Scholar] [CrossRef] [Scilit]
- Hiroi, M.; Kawamori, F.; Harada, T.; Sano, Y.; Miwa, N.; Sugiyama, K.; Hara-Kudo, Y.; Masuda, T. Antibiotic Resistance in Bacterial Pathogens from Retail Raw Meats and Food-Producing Animals in Japan. J. Food Prot. 2012, 75, 1774–1782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hassan, A.; Hiko, A.; Bogale, K.; Abera, B.; Tsegaye, B. Antimicrobial Resistance Profiles of Staphylococcus aureus Isolates along Asella Municipal Beef Abattoir Line, South Eastern Ethiopia. J. Vet. Sci. Technol. 2018, 9, 1–5. [Google Scholar] [CrossRef]
- Ed-Dra, A.; Filali, F.R.; Bouymajane, A.; Benhallam, F.; Allaoui, A.E.; Chaiba, A.; Giarratana, F. Antibiotic Susceptibility Profile of Staphylococcus aureus Isolated from Sausages in Meknes, Morocco. Vet. World 2018, 11, 1459–1465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Effah, C.Y.; Akwasi, B.; Otoo, F.; Ntiefo, R.A. Prevalence and Phenotypic Antibiotic Bioassay of Methicillin-Resistant Staphylococcus aureus in Raw Meats Sold at Various Retail Outlets in the Cape Coast Metropolis of Ghana. Above Minim. Threshold. Again Retail. Outlet 2018, 2, 3. [Google Scholar]
- Iroha, I.R.; Ugbo, E.C.; Ilang, D.C.; Oji, A.E.; Ayogu, T.E. Bacteria Contamination of Raw Meat Sold in Abakaliki, Ebonyi State Nigeria. J. Public Health Epidemiol. 2011, 3, 49–53. [Google Scholar]
- Thwala, T.; Madoroba, E.; Basson, A.; Butaye, P. Prevalence and Characteristics of Staphylococcus aureus Associated with Meat and Meat Products in African Countries: A Review. Antibiotics 2021, 10, 1108. [Google Scholar] [CrossRef] [Scilit]
- Sadiq, A.; Samad, M.; Saddam, M.; Basharat, N.; Ali, S.; Roohullah, S.; Saad, Z.; Khan, A.N.; Ahmad, Y.; Khan, A.; et al. Methicillin-Resistant Staphylococcus aureus (MRSA) in Slaughter Houses and Meat Shops in Capital Territory of Pakistan During 2018–2019. Front. Microbiol. 2020, 11, 577707. [Google Scholar] [CrossRef] [Scilit]
- Gwida, M.; Saad, T.; Elgohary, A.; Mohamed, A. Characterization of Methicillin-Susceptible and Methicillin-Resistant Staphylococcus aureus from Healthy Cattle and Buffaloes in a Linked Community. Mansoura Vet. Med. J. 2021, 22, 76–81. [Google Scholar] [CrossRef] [Scilit]
- El-Zamkan, M.A.; Mubarak, A.G.; Ali, A.O. Prevalence and Phylogenetic Relationship among Methicillin- and Vancomycin-Resistant Staphylococci Isolated from Hospital’s Dairy Food, Food Handlers, and Patients. J. Adv. Vet. Anim. Res. 2019, 6, 463–473. [Google Scholar] [CrossRef] [Scilit]
- Abdul-Hameed, R.A.; Ayoub, N.S. Vancomycin Resistance among Methicillin-Resistant Staphylococcus aureus Isolates from General Hospitals. Kcmj 2014, 10, 82–86. [Google Scholar]
- Akgul, O.; Bora, G.; Guducuoglu, H. Investigation of the Gene Carriage Rates for Staphylococcus aureus, MecA, VanA and Nuc Genes in the Nasal and Milk Specimens from the Sheep Caretakers with Sheep. Large Anim. Rev. 2021, 27, 259–268. [Google Scholar]
- Al-Amery, K.; Elhariri, M.; Elsayed, A.; El-Moghazy, G.; Elhelw, R.; El-Mahallawy, H.; El Hariri, M.; Hamza, D. Vancomycin-Resistant Staphylococcus aureus Isolated from Camel Meat and Slaughterhouse Workers in Egypt. Antimicrob. Resist. Infect. Control 2019, 8, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Juhász-Kaszanyitzky, É.; Jánosi, S.; Somogyi, P.; Dán, Á.; Van Der Graaf-van Bloois, L.; Van Duijkeren, E.; Wagenaar, J.A. MRSA Transmission between Cows and Humans. Emerg. Infect. Dis. 2007, 13, 630–632. [Google Scholar] [CrossRef] [Scilit]
- Pokhrel, H.; Baishya, S.; Phukan, B.; Pillai, D.; Ashraf Rather, M. Occurrence and Distribution of Multiple Antibiotic Resistance Bacteria of Public Health Significance in Backwaters and Aquaculture Farm. Int. J. Curr. Microbiol. Appl. Sci. 2018, 7, 975–987. [Google Scholar] [CrossRef] [Scilit]
- Titilawo, Y.; Sibanda, T.; Obi, L.; Okoh, A. Multiple Antibiotic Resistance Indexing of Escherichia coli to Identify High-Risk Sources of Faecal Contamination of Water. Environ. Sci. Pollut. Res. 2015, 22, 10969–10980. [Google Scholar] [CrossRef] [Scilit]
- Savariraj, W.R.; Ravindran, N.B.; Kannan, P.; Paramasivam, R.; Senthilkumar, T.M.A.; Kumarasamy, P.; Rao, V.A. Prevalence, Antimicrobial Susceptibility and Virulence Genes of Staphylococcus aureus Isolated from Pork Meat in Retail Outlets in India. J. Food Saf. 2019, 39, e12589. [Google Scholar] [CrossRef] [Scilit]
- Lozano, C.; Gharsa, H.; Ben Slama, K.; Zarazaga, M.; Torres, C. Staphylococcus aureus in Animals and Food: Methicillin Resistance, Prevalence and Population Structure. a Review in the African Continent. Microorganisms 2016, 4, 12. [Google Scholar] [CrossRef] [Scilit]
- International Organization for Standardization. Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Enumeration of Coagulase-Positive Staphylococci (Staphylococcus aureus and Other Species); ISO 6888-1:999/Amd.1:2003; International Organization for Standardization: Geneva, Switzerland, 2003; Available online: https://www.iso.org/standard/23036.html (accessed on 10 November 2017).
- Guran, H.S.; Kahya, S. Species Diversity and Pheno- and Genotypic Antibiotic Resistance Patterns of Staphylococci Isolated from Retail Ground Meats. J. Food Sci. 2015, 80, M1291–M1298. [Google Scholar] [CrossRef] [Scilit]
- Abbey, T.C.; Deak, E. What’s New from the CLSI Subcommittee on Antimicrobial Susceptibility Testing M100, 29th Edition. Clin. Microbiol. Newsl. 2019, 41, 203–209. [Google Scholar] [CrossRef] [Scilit]
- Zaher, H.A.; Nofal, M.I.; Hendam, B.M.; Elshaer, M.M.; Alothaim, A.S.; Eraqi, M.M. Prevalence and Antibiogram of Vibrio parahaemolyticus and Aeromonas hydrophila in the Flesh of Nile Tilapia, with Special Reference to Their Virulence Genes Detected Using Multiplex Pcr Technique. Antibiotics 2021, 10, 654. [Google Scholar] [CrossRef] [Scilit]
- Singh, V.; Rathore, G.; Kapoor, D.; Mishra, B.N.; Lakra, W.S. Detection of Aerolysin Gene in Aeromonas Hydrophila Isolated from Fish and Pond Water. Indian J. Microbiol. 2008, 48, 453–458. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Types of Samples | No. of Examined Samples | S. aureus Isolates | nucA | mecA | Tet (L) | ermA | vanA | aac 6-aph |
|---|---|---|---|---|---|---|---|---|
| % | % | % | % | % | % | % | ||
| Cattle | 100 | 20 | 100 | 35 | 5 | 10 | 35 | 0 |
| Sheep | 100 | 15 | 100 | 26.6 | 6 | 13.3 | 20 | 0 |
| Hand swabs | 50 | 34 | 100 | 29.4 | 5.8 | 5.8 | 11.7 | 0 |
| Human stools | 50 | 10 | 100 | 40 | 20 | 0 | 0 | 0 |
| Total | 300 | 19 | 100 | 31.5 | 7 | 8.7 | 19.3 | 0 |
| Antimicrobial Agent | Symbol | S | R |
|---|---|---|---|
| % | % | ||
| Cephalexin | CE | 15.8 | 78.9 |
| Oxacillin | OX | 26.3 | 73.7 |
| Cephalothin | CN | 36.8 | 52.6 |
| Flucloxacillin | FL | 47.4 | 47.4 |
| Sulphamethoxazol | SXT | 47.4 | 36.8 |
| Dicloxacillin | DC | 52.6 | 36.8 |
| Erythromycin | E | 63.2 | 31.6 |
| Clindamycin | CL | 63.2 | 26.3 |
| Lincomycin | L | 68.4 | 26.3 |
| Cefazolin | CZ | 73.7 | 21.1 |
| Ceftibiprole | CB | 84.2 | 10.5 |
| Dalbavancin | D | 84.2 | 5.3 |
| Tigecycline | TG | 89.5 | 5.3 |
| Oritavancin | O | 94.7 | 5.3 |
| Linezolid | LZ | 89.5 | - |
| Telavancin | T | 100 | - |
| Deptomycin | D | 100 | - |
| No. of Strain | Antimicrobial Resistance Profile | MAR Index |
|---|---|---|
| 6 | CE, OX, CN, FL, SXT, DC, E, CL, L, CZ, CB, D, TG, O | 0.823 |
| 3 | CE, OX, CN, FL, SXT, DC, E, CL, L, CZ, CB | 0.647 |
| 5 | CE, OX, CN, FL, SXT, DC, E, CL, L, CZ | 0.588 |
| 4 | CE, OX, CN, FL, SXT, DC, E, CL, L, CZ | 0.588 |
| 4 | CE, OX, CN, FL, SXT, DC, E, CL, L | 0.474 |
| 3 | CE, OX, CN, FL, SXT, DC, E | 0.412 |
| 3 | CE, OX, CN, FL, SXT, DC | 0.353 |
| 4 | CE, OX, CN, FL, SXT | 0.294 |
| 4 | CE, OX, CN, FL, SXT | 0.294 |
| 4 | CE, OX, CN | 0.158 |
| 3 | CE, OX | 0.117 |
| 4 | CE, OX | 0.117 |
| 3 | CE, OX | 0.117 |
| 3 | CE, OX | 0.117 |
| 4 | CE | 0.059 |
| Average | 0.343 | |
| Primer | Oligonucleotide Sequence (5′ → 3′) | Product Size (bp) | References |
|---|---|---|---|
| nucA | (F): 5′ GCGATTGATGGTGATACGGTT ′3 | 279 | [69] |
| (R): 5′ AGCCAAGCCTTGACGAACTAAAGC ′3 | |||
| mecA | (F): 5′ TAGAAATGACTGAACGTCCG ′3 | 154 | |
| (R): 5′ TTGCGATCAATGTTACCGTAG ′3 | |||
| aac 6-aph 2 | (F): 5′ CAGAGCCTTGGGAAGATGAAG ′3 | 348 | |
| (R): 5′ CCTCGTGTAATTCATGTTCTGGC ′3 | |||
| Tet (L) | (F): 5′ CATTTGGTCTTATTGGATCG ′3 | 475 | |
| (R): 5′ ATTACACTTCCGATTTCGG ′3 | |||
| ermA | (F): 5′ TCTAAAAAGCATGTAAAAGAA ′3 | 645 | |
| (R): 5′ CTTCGATAGTTTATTAATATTAGT ′3 | |||
| vanA | (F): 5′CATGAATAGAATAAAAGTTGCAATA′3 | 1030 | |
| (R): 5′ CCCCTTTAACGCTAATACGATCAA ′3 |
| Antibiotics | Symbol | Concentration |
|---|---|---|
| Tigecycline | TG | 30 |
| Lincomycin | L | 15 |
| Cefazolin | CZ | 30 |
| Ceftibiprole | CB | 30 |
| Dicloxacillin | DC | 1 |
| Linezolid | LZ | 30 |
| Telavancin | T | 5 |
| Cephalothin | CN | 30 |
| Flucloxacillin | FL | 1 |
| Clindamycin | CL | 10 |
| Dalbavancin | D | 30 |
| Oxacillin | OX | 1 |
| Oritavancin | O | 5 |
| Deptomycin | D | 30 |
| Erythromycin | E | 15 |
| Cephalexin | CE | 30 |
| Sulphamethoxazol | SXT | 25 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zaher, H.A.; El Baz, S.; Alothaim, A.S.; Alsalamah, S.A.; Alghonaim, M.I.; Alawam, A.S.; Eraqi, M.M. Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers. Antibiotics 2023, 12, 205. https://doi.org/10.3390/antibiotics12020205
Zaher HA, El Baz S, Alothaim AS, Alsalamah SA, Alghonaim MI, Alawam AS, Eraqi MM. Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers. Antibiotics. 2023; 12(2):205. https://doi.org/10.3390/antibiotics12020205
Chicago/Turabian StyleZaher, Hanan A., Shimaa El Baz, Abdulaziz S. Alothaim, Sulaiman A. Alsalamah, Mohammed Ibrahim Alghonaim, Abdullah S. Alawam, and Mostafa M. Eraqi. 2023. "Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers" Antibiotics 12, no. 2: 205. https://doi.org/10.3390/antibiotics12020205
APA StyleZaher, H. A., El Baz, S., Alothaim, A. S., Alsalamah, S. A., Alghonaim, M. I., Alawam, A. S., & Eraqi, M. M. (2023). Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers. Antibiotics, 12(2), 205. https://doi.org/10.3390/antibiotics12020205

