Next Article in Journal
Green Synthesis of Characterized Silver Nanoparticle Using Cullen tomentosum and Assessment of Its Antibacterial Activity
Previous Article in Journal
Three Innovations of Next-Generation Antibiotics: Evolvability, Specificity, and Non-Immunogenicity
Previous Article in Special Issue
Molecular Basis of Non-β-Lactam Antibiotics Resistance in Staphylococcus aureus
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers

by
Hanan A. Zaher
1,
Shimaa El Baz
2,
Abdulaziz S. Alothaim
3,
Sulaiman A. Alsalamah
4,
Mohammed Ibrahim Alghonaim
4,
Abdullah S. Alawam
4 and
Mostafa M. Eraqi
3,5,*
1
Food Hygiene and Control Department, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt
2
Department of Hygiene and Zoonoses, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt
3
Department of Biology, College of Science in Zulfi, Majmaah University, Majmaah 11952, Saudi Arabia
4
Department of Biology, College of Science, Imam Mohammad Ibn Saud Islamic University, Riyadh 11623, Saudi Arabia
5
Microbiology and Immunology Department, Veterinary Research Institute, National Research Centre, Dokki, Giza 12622, Egypt
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(2), 205; https://doi.org/10.3390/antibiotics12020205
Submission received: 21 December 2022 / Revised: 13 January 2023 / Accepted: 14 January 2023 / Published: 18 January 2023

Abstract

Staphylococcus aureus (S. aureus) is a serious infection-causing pathogen in humans and animal. In particular, methicillin-resistant S. aureus (MRSA) is considered one of the major life-threatening pathogens due to its rapid resistance to several antibiotics in clinical practice. MRSA strains have recently been isolated in a number of animals utilized in food production processes, and these species are thought to be the important sources of the spread of infection and disease in both humans and animals. The main objective of the current study was to assess the prevalence of drug-resistant S. aureus, particularly vancomycin-resistant S. aureus (VRSA) and MRSA, by molecular methods. To address this issue, a total of three hundred samples (200 meat samples from cattle and sheep carcasses (100 of each), 50 hand swabs, and 50 stool samples from abattoir workers) were obtained from slaughterhouses in Egypt provinces. In total, 19% S. aureus was isolated by standard culture techniques, and the antibiotic resistance was confirmed genotypically by amplification nucA gen. Characteristic resistance genes were identified by PCR with incidence of 31.5%, 19.3%, 8.7%, and 7% for the mecA, VanA, ermA, and tet L genes, respectively, while the aac6-aph gene was not found in any of the isolates. In this study, the virulence genes responsible for S. aureus’ resistance to antibiotics had the highest potential for infection or disease transmission to animal carcasses, slaughterhouse workers, and meat products.

1. Introduction

Staphylococcus aureus is one of the most common causes of foodborne disease worldwide [1]. This is crucial for the livestock and food industries in particular, as outbreaks could cause significant financial losses [2]. The S. aureus infection is considered to be one of the most important zoonotic diseases among farm animals and human accomplices. In animals, the bacterium causes mastitis, sepsis, followed by wound infection [3]. Via the food chain, animal to human infection may lead to food poisoning, bacteremia, pneumonia, arthritis, sepsis, and nosocomial infections [4].
Furthermore, S. aureus infection may affect the productivity and quality of the meat, restricting international supply [5,6]. Consumers and food handlers may become easy targets for the spread of S. aureus through the food chain [7]. It has been proven that Staphylococcus contamination either during or after preparation is an indication of poor food hygiene standards, making the meat unfit for refrigeration and transportation [8].
More than half of S. aureus isolates found in animal-origin foods, especially raw meat products, are enterotoxigenic [9]. S. aureus produces enterotoxins (SEs), which are harmful to both human and animal digestive systems [10].
The protection of public health and the safety of food are significantly impacted by the rise in multidrug resistance (MDR) bacterial strains in farm animals [11]. The abuse of antibiotics in livestock, either for growth promotion or treatment, may be lead to increased S. aureus resistance to antibiotics [12].
The first discovered antibiotic was penicillin, and in the year 1940 S. aureus emerged as a clinical issue as a result of developing resistance to penicillin, by creating β-lactamase enzyme that rendered penicillin inactive [13,14,15]. Additionally, the prevalence of MRSA strains that are resistant to a variety of non-β-lactam antibiotics has continuously increased [13]. S. aureus has a wide range of different virulence factors, including staphylococcal protein A (spa), in addition to its ability to resist a variety of antibiotics [16]. S. aureus from animal sources carries resistance genes, such as methicillin-resistance (mecA), vancomycin-resistance (van), penicillin-resistance (blaZ), chloramphenicol/florfenicol-resistance (cfr), apramycin-resistance (apm), and spectinomycin-resistance (spc) genes [17,18,19,20,21,22]. In addition, S. aureus exhibits a variety of virulence genes, including SEs, Panton-Valentine leucocidin (pvl), clumping factor A (clfA), and toxic shock syndrome toxin (tst) [23,24,25].
Methicillin resistance is mediated by the mecA gene [26], which was acquired through horizontal transfer of the staphylococcal cassette chromosome mec (SCCmec) [27]. β-lactams antibiotics have a poor affinity for the alternative penicillin-binding protein 2a (PBP 2A) [28] that the mecA gene produces, leading to antibiotic resistance in the entire family [29]. MRSA strains are frequently resistant to antibiotics other than β-lactams, such as oxazolidinones, lipopeptides, glycopeptides lincosamides, aminoglycosides, and macrolides [30,31].
In recent years, the frequency of S. aureus mutants resistant to vancomycin has progressively increased [32,33]. The antagonistic effects of mecA and vanA resistance determinants may be the cause of VRSA infections in clinical settings [15,34].
In S. aureus, the aminoglycoside-modifying enzyme (AME) often mediates resistance to aminoglycosides [35]. The first instance of gentamicin-resistant S. aureus was noted in 1975 [36]. The aac 6-aph 2 gene is the most prevalent in aminoglycoside-resistant S. aureus isolates [37,38]. Multiple processes can lead to macrolide resistance, such as erythromycin, but the most common one is target alteration produced by one or more erm genes that encode a 23S rRNA methylase, and this resistance type is referred to as MLSB resistance phenotypically [39]. It has also been proven that staphylococci with macrolide efflux pumps (encoded by msrA or msrB) exhibit resistance to MLS antibiotics [40].
Tetracycline resistance genes are present in the majority of bacteria with tetracycline resistance genes (tet) [41,42].
Major public health problems concern food-associated microorganisms that carry genes for antibiotic resistance. This is due to the fact that they can disseminate antibiotic resistance genes to commensal and enteric bacteria through horizontal gene transfer of mobile genetic elements and can result in foodborne diseases [43]. The frequency of MDR changes over time and varies based on the host species and place of origin, due to variances in antimicrobial consumption and antibiotic abuse [44]. The cost of treating these conditions is significant. As a result, it is critical to keep track of the prevalence and antibiotic resistance of food-borne pathogens in order to plan effectively for food safety and to implement focused interventions [45]. Furthermore, there are no data available in Egypt on the prevalence of MRSA and VRSA at the level of the abattoir.
The main objective of the current study was to assess the prevalence of drug-resistant S. aureus, particularly vancomycin-resistant S. aureus (VRSA) and MRSA, by molecular methods from cattle, sheep carcasses, and slaughterhouses workers.

2. Results

2.1. Prevalence of S. aureus in Examined Sample

A total of 300 samples (200 meat samples from cattle and sheep carcasses (100 of each), 50 hand swabs, and 50 stool samples from abattoir workers) were obtained from Egypt governorates and screened for S. aureus. Among these, 57 (19%) S. aureus strains were identified using morphological, biochemical, and molecular methods, including nucA gene detection. The findings demonstrated that all strains carried the nucA gene. S. aureus was present in all of the examined samples with a prevalence of 20% (20/100), 15% (15/100), 34% (17/50), and 10% (5/50) from examined cattle carcass, sheep carcass, hand swabs, and stool samples, respectively (Table 1).

2.2. Molecular Characterization of Isolated S. aureus

All examined isolates were owed the nucA gene. Of the detected S. aureus, 35% (7/20), 26.6 (4/15), 29.4 (5/17), and 40% (2/5) were carried to the mecA gene in cattle, sheep carcass, hand swab, and human stool, respectively. vanA were determined in 35% (7/20), 20% (3/15), 11.7% (2/17) of cattle, sheep carcass, and hand swabs, respectively, while none of the examined human stool samples were carried to vanA gene. The percentages of isolates that owed tet (L) in cattle, sheep carcass, hand swabs, and human stool were 5% (1/20), 6% (1/15), 5.8% (1/17), and 20% (1/5), respectively; however, the ermA gene was found in 10% (2/20), 13.3% (2/15), and 5.8% (1/17), respectively, in same tested strains while it was not found in human stool, whereas the aac6-aph gene was not detected in any of the tested isolates (Table 1; Figure 1).

2.3. Antibiotic Susceptibility Test of S. aureus

For the antimicrobial susceptibility test, the tested isolates showed high resistance to cephalexin (78.9%) while they showed high susceptibility to telavancin and daptomycin (100% per each) (Table 2). The MAR index values showed multiple resistant patterns, revealing that the MAR index average of S. aureus was 0.343 (Table 3).

3. Discussion

Cutler et al. (2010) [46] estimated that about 60% of emerging human diseases are zoonotic. The use of antibiotics for treatment and as growth promoters in livestock may encourage the spread of novel diseases in animals, particularly those that are resistant to antibiotics [47]. The current phenotypic study found that the prevalence of S. aureus was 19% among all samples assessed. The genotypic amplification proved to have 100% of the nucA gene in all the isolates of S. aureus. In contrast to earlier findings, S. aureus’ prevalence in raw meat was 15% in Egypt [48] and 20.5% in China [49]. However, other studies reported a prevalence comparable to the present research finding; for example, a higher prevalence of S. aureus found in raw red meat was 29.4% in Algeria [50], 32.8% in Japan [51], 34.3% in Ethiopia [52], 40.38% in Morocco [53], 45% in Ghana [54], and a low prevalence was 1.3% in Nigeria [55].
In the current study, among 57 S. aureus isolates, only 18 isolates (31.5%) have the mecA gene. MRSA prevalence based on mecA identification is the highest in human stools (40%), followed by beef (35%), hand swab (29.4%), and sheep (26.6%). According to a similar study conducted in African countries, beef has a higher potential risk of transmitting MRSA to humans than other red meats, with a total prevalence of 33.08% of MRSA in beef samples and 24.5% in other red meat samples [56]. Previous studies have reported that the highest prevalence for the mecA gene was detected amongst the isolates of cows, buffaloes, and humans (80% each). However, just one isolate (20%) was recovered from a sheep. In a study carried out in Pakistan, the prevalence of MRSA was 63% in beef, 50% in mutton, 45% in knives, 28% in the working area, 25% in rectal swabs, 18% in hooks, and 18% in butchers’ hands [57]. Similarly, earlier research also discovered 33.3% MRSA isolates from hand swabs [58].
In the current study, among 57 S. aureus isolates, only 11 isolates (19.3%) have the vanA gene, the highest percentage (35%) was found in cattle samples, followed by sheep (20%), and hand swab (11.7%). However, the gene was not detected in human stool samples. Unlike our findings, higher recovery rates (60%) and (40%) were reported in hand swabs of food handlers and diarrheic stool in Egypt, respectively [59]. In previous studies, the highest prevalence was noticed among S. aureus isolated from sheep (100%), while isolates recovered from cow, buffalo, and goat milk revealed a prevalence rate of 40% for each host species. On the opposite side, all the tested human samples were negative for the vanA gene [60,61]. In another study carried out by J. Kaszanyitzky et al. (2007), the prevalence of S. aureus was 14.5% in camel meat and 55% in slaughterhouse workers. The VRSA incidence was 27% and 54% in camel meat and slaughterhouse workers, respectively, which were identified as MRSA with presence of the vanA gene. The analysis of the vanA gene sequences from camel meat and humans revealed that they were identical to each other, suggesting the zoonotic importance of this pathogen and/or horizontal gene transfer [62]. In general, VRSA in livestock can spread through the hands of slaughterhouse workers or through the consumption of viscera-contaminated meat during the process. The bacterial colonization could enhance the risk of zoonotic disease transmission [63].
An MAR index above 0.2 is a parameter used to reveal the spread of bacterial resistance in certain populations, and this bacteria originated from a habitat in which different antibiotics are used and often abused [64]. A high incidence of MAR is permitted by genetic exchange between MAR pathogens and other bacteria [65]. In this study, the MAR indices of S. aureus isolates were 0.343, revealing that these isolates were derived from samples from high-risk sources. These findings are consistent with a past study, which found the MAR index of the majority of the S. aureus isolated from pork meat was 0.3 [66].
The microbial contamination at the slaughter, storage, or at the meat processing units are potential sources of meat contamination in and around Africa and throughout the world [67]. As per our understanding, the antimicrobial drugs are irrationally utilized internationally to prevent bacterial and fungal contamination in meat and meat products, which may further lead to the high incidence of MRSA and VRSA prevalence [10,12]. It is imperative to note some limitations of this study. In this research, the phenotypic and molecular analyses were carried out in vitro to prove the virulence efficiency, and not in vivo, due to the research objective, facilities, and limited funding. While we identified some important antimicrobial resistance genes and a limited number of S. aureus, a total of 300 samples were analyzed for this research with informed consent and agreement from human participants and slaughter market proprietors. In the future, these limitations can be controlled by using a larger number of S. aureus isolates from different demographic regions in Egypt provinces to predict the antimicrobial resistance and virulence trend. Furthermore, it would allow for further genotyping studies of multidrug resistance strains using multilocus sequence typing and whole-genome sequencing methods, to offer data for better understanding and evaluating global methicillin-resistant S. aureus/methicillin-sensitive S. aureus strains. Moreover, guidelines and programs that prevent the abuse of antibiotics to prevent the occurrence of antimicrobial resistance in livestock must be developed.

4. Materials and Methods

4.1. Samples Collection and Preparation

4.1.1. Animal Samples

For the bacteriological analysis, the sheep and cattle samples were collected, packed in sterile bags, and transported at 4 °C using an ice box to the meat hygiene laboratory, Food Hygiene and Control Department, College of Veterinary Medicine, Mansoura University, Egypt.

4.1.2. Human Samples

From 50 adult male slaughterhouse workers, hand swabs were taken. Both hands’ palm surfaces were cleaned using cotton-tipped swabs that had been saturated with TSB. For sampling, sterile gloves were worn to reduce sample contamination. All stool samples were transported on ice to the laboratory for additional analysis after being collected in sterile cups (sample collection was carried out after handling meat for at least an hour and all workers were clinically free of any bacterial skin infections at the time of examination and asked not to wash their hands before sampling).

4.2. Isolation and Identification of S. aureus

Each sample was put into 9 mL of Tryptone Soya Broth (TSB) with 70 mg of NaCl per mL, and it was all left to sit for 24 h at 37 °C. After incubation, a loopful from all inoculated samples were cultured on selective media for S. aureus, Baird-Parker agar (oxoid, 277) supplemented with 5% egg yolk-tellurite emulsion and incubated at 37 °C for 24–48 h. Black, shiny, cylindrical, smooth, convex colonies with a zone of clearing around them were selected and purified for additional biochemical analysis. The biochemical tests, such as catalase activity, deoxyribonucleases (DNase), coagulase production, thermostable nuclease production, and the mannitol fermentation test, were performed for phenotypic identification [68].

4.3. Molecular Characterization of Isolated S. aureus:

The phenotypically identified S. aureus isolates were examined by PCR for the nucA gene then all positive isolates for the nucA gene were further examined for other virulence and resistance genes.

4.3.1. DNA Extraction

Bacterial DNA was prepared by method mentioned before by Guran and Kahya [69], in which three to five colonies of biochemically identified S. aureus isolates were mixed with 100 μL of sterilized distilled water, then exposed to heat block at 95 °C for 15 min. After that, heated lysates were centrifuged at 13,000 rpm for 10 min. The supernatants were transferred to clean tubes and kept at −20 °C for use as DNA template.

4.3.2. DNA Amplification

PCR was carried out according to the method mentioned before by Guran and Kahya with the primers listed in Table 1 and performed in an ABI Veriti Thermal Cycler (Applied Bio-systems Asia Pte Ltd., Singapore). A total reaction volume of 50 µL consisting of 6 µL of 10 × PCR buffer, 8 µL of 25 mmol/L MgCl2, 8 µL of 10 mmol/L deoxynucleoside triphosphate mixtures, 1 µL Taq polymerase, 5 µL of template DNA (5 ng/µL), 1 µL of 25 pmol each gene, and 12 µL of molecular grade water was used in the PCR. PCR reaction was started with an initial denaturation at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 45 s, annealing at 54 °C for 45 s, 62 °C for 45 s, extension at 72 °C for 45 s, and a final extension at 72 °C for 7 min. PCR products were separated and visualized in a 1.5% agarose gel (Table 4).

4.4. Reference Strain

For the present antimicrobial susceptibility tests (AST), the following reference strains were used: 1. Staphylococcus aureus-ATCC: 25,923 for MSSA, 2. ATCC: 43,300 for MRSA. The reference strains were obtained from the Food Analysis Center, Faculty of Veterinary Medicine, Benha University, Egypt.

4.5. Antimicrobial Susceptibility Testing

All positive isolates for S. aureus (n = 57) were tested for antimicrobial susceptibility by the agar disk diffusion method using disks as shown in Table 5. The procedure followed guidelines from the CLSI Inst [70]. Multiple Antibiotic Resistance (MAR) index for each strain was determined according to the following formula: MAR index = No. of resistance/Total No. of antibiotic [71,72].

5. Conclusions

Staphylococcus aureus in meat, especially MRSA and VRSA, poses a zoonotic and public health threat and raises concerns about food safety. It is directly linked to poor hygienic practices by individuals involved in various stages of meat processing, such as production, handling, shipping, slicing, storage, and point of sale. To prevent food contamination with S. aureus, continual tracking and deployment of better management techniques inside the food chain are necessary. The cutting edge molecular-based diagnostics is the need of the hour in order to deliver high quality meat products to ensure the public health and food safety of end users.

Author Contributions

H.A.Z. and S.E.B. proposed the research idea, investigation, methodology, resources formal analysis concept, carried out experimental model development and samples collection. A.S.A. (Abdulaziz S. Alothaim), S.A.A., M.I.A. and A.S.A. (Abdullah S. Alawam) provided funding acquisition and software. M.M.E. provided methodology, project administration, investigation, visualization, supervision, writing—original draft and review and editing of the final manuscript, which contributed to the interpretation of the results, reviewing, and revising of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Deputyship for Research & Innovation, Ministry of Education in Saudi Arabia, grant number (IFP-2020-107).

Institutional Review Board Statement

Not applicable (Ethical review board approval is not recommended since the study is not involved with human or animal invasive sampling procedures).

Informed Consent Statement

Informed consent was obtained from the participants before sampling.

Data Availability Statement

Not applicable.

Acknowledgments

The authors extend their appreciation to the Deputyship for Research & Innovation, Minis-try of Education in Saudi Arabia for funding this research work through the project (IFP-2020-107).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kadariya, J.; Smith, T.C.; Thapaliya, D. Staphylococcus aureus and Staphylococcal Food-Borne Disease: An Ongoing Challenge in Public Health. Biomed Res. Int. 2014, 2014, 827965. [Google Scholar] [CrossRef] [Scilit]
  2. Peton, V.; Le Loir, Y. Staphylococcus aureus in Veterinary Medicine. Infect. Genet. Evol. 2014, 21, 602–615. [Google Scholar] [CrossRef] [Scilit]
  3. Algammal, A.M.; Hetta, H.F.; Elkelish, A.; Alkhalifah, D.H.H.; Hozzein, W.N.; Batiha, G.E.S.; El Nahhas, N.; Mabrok, M.A. Methicillin-Resistant Staphylococcus aureus (MRSA): One Health Perspective Approach to the Bacterium Epidemiology, Virulence Factors, Antibiotic-Resistance, and Zoonotic Impact. Infect. Drug Resist. 2020, 13, 3255–3265. [Google Scholar] [CrossRef] [Scilit]
  4. Nandhini, P.; Kumar, P.; Mickymaray, S.; Alothaim, A.S.; Somasundaram, J.; Rajan, M. Recent Developments in Methicillin-Resistant Staphylococcus aureus (MRSA) Treatment: A Review. Antibiotics 2022, 11, 606. [Google Scholar] [CrossRef] [Scilit]
  5. Mechesso, A.F.; Moon, D.C.; Ryoo, G.S.; Song, H.J.; Chung, H.Y.; Kim, S.U.; Choi, J.H.; Kim, S.J.; Kang, H.Y.; Na, S.H.; et al. Resistance Profiling and Molecular Characterization of Staphylococcus aureus Isolated from Goats in Korea. Int. J. Food Microbiol. 2021, 336, 108901. [Google Scholar] [CrossRef] [Scilit]
  6. Dweba, C.C.; Zishiri, O.T.; El Zowalaty, M.E. Methicillin-Resistant Staphylococcus aureus: Livestock-Associated, Antimicrobial, and Heavy Metal Resistance. Infect. Drug Resist. 2018, 11, 2497–2509. [Google Scholar] [CrossRef] [Scilit]
  7. Vanderhaeghen, W.; Hermans, K.; Haesebrouck, F.; Butaye, P. Methicillin-Resistant Staphylococcus aureus (MRSA) in Food Production Animals. Epidemiol. Infect. 2010, 138, 606–625. [Google Scholar] [CrossRef] [Scilit]
  8. Dai, X.H.; Li, H.E.; Lu, C.J.; Wang, J.F.; Dong, J.; Wei, J.Y.; Zhang, Y.; Wang, X.; Tan, W.; Deng, X.M.; et al. Liquiritigenin Prevents Staphylococcus aureus-Mediated Lung Cell Injury via Inhibiting the Production of α-Hemolysin. J. Asian Nat. Prod. Res. 2013, 15, 390–399. [Google Scholar] [CrossRef] [Scilit]
  9. Song, M.; Bai, Y.; Xu, J.; Carter, M.Q.; Shi, C.; Shi, X. Genetic Diversity and Virulence Potential of Staphylococcus aureus Isolates from Raw and Processed Food Commodities in Shanghai. Int. J. Food Microbiol. 2015, 195, 1–8. [Google Scholar] [CrossRef] [Scilit]
  10. Kim, Y.B.; Seo, K.W.; Jeon, H.Y.; Lim, S.K.; Lee, Y.J. Erratum: Corrigendum to “Characteristics of the Antimicrobial Resistance of Staphylococcus aureus Isolated from Chicken Mean Produced by Different Integrated Broiler Operations in Korea” (Poultry Science (2018) 97 3 (962–969)). Poult. Sci. 2018, 97, 3762. [Google Scholar] [CrossRef] [Scilit]
  11. Gebreyes, W.A.; Jackwood, D.; de Oliveira, C.J.B.; Lee, C.-W.; Hoet, A.E.; Thakur, S. Molecular Epidemiology of Infectious Zoonotic and Livestock Diseases. Microbiol. Spectr. 2020, 8, 2–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Chambers, H.F.; DeLeo, F.R. Waves of Resistance: Staphylococcus aureus in the Antibiotic Era. Nat. Rev. Microbiol. 2009, 7, 629–641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Rammelkamp, C.H. Observations on Resistance of Staphylococcus aureus to Action of Tyrothricin. Proc. Soc. Exp. Biol. Med. 1942, 49, 346–350. [Google Scholar] [CrossRef] [Scilit]
  15. Lade, H.; Joo, H.S.; Kim, J.S. Molecular Basis of Non-β-Lactam Antibiotics Resistance in Staphylococcus aureus. Antibiotics 2022, 11, 1378. [Google Scholar] [CrossRef] [Scilit]
  16. Faccone, D.; Togneri, A.M.; Podesta, L.; Perez, M.; Gagetti, P.; Sanchez, S.; Romero, G.; Corso, A. MRSA Pediatric Clone Expressing ermC plus lnuA Genes Causing Nosocomial Transmission and Healthcare Workers Colonization in a Neonatal Intensive Care Unit. Infect. Genet. Evol. 2014, 25, 78–80. [Google Scholar] [CrossRef] [Scilit]
  17. Sattler, C.A.; Mason, E.O.; Kaplan, S.L. Prospective Comparison of Risk Factors and Demographic and Clinical Characteristics of Community-Acquired, Methicillin-Resistant versus Methicillin-Susceptible Staphylococcus aureus Infection in Children. Pediatr. Infect. Dis. J. 2002, 21, 910–916. [Google Scholar] [CrossRef] [Scilit]
  18. Osman, K.M.; Badr, J.; Orabi, A.; Elbehiry, A.; Saad, A.; Ibrahim, M.D.S.; Hanafy, M.H. Poultry as a Vector for Emerging Multidrug Resistant Enterococcus Spp.: First Report of Vancomycin (van) and the Chloramphenicol–Florfenicol (Cat-Fex-Cfr) Resistance Genes from Pigeon and Duck Faeces. Microb. Pathog. 2019, 128, 195–205. [Google Scholar] [CrossRef] [Scilit]
  19. Feßler, A.T.; Kadlec, K.; Schwarz, S. Novel Apramycin Resistance Gene apmA in Bovine and Porcine Methicillin-Resistant Staphylococcus aureus ST398 Isolates. Antimicrob. Agents Chemother. 2011, 55, 373–375. [Google Scholar] [CrossRef] [Scilit]
  20. Argudín, M.A.; Mendoza, M.C.; González-Hevia, M.A.; Bances, M.; Guerra, B.; Rodicio, M.R. Genotypes, Exotoxin Gene Content, and Antimicrobial Resistance of Staphylococcus aureus Strains Recovered from Foods and Food Handlers. Appl. Environ. Microbiol. 2012, 78, 2930–2935. [Google Scholar] [CrossRef] [Scilit]
  21. Azimian, A.; Havaei, S.A.; Fazeli, H.; Naderi, M.; Ghazvini, K.; Samiee, S.M.; Soleimani, M.; Peerayeh, S.N. Genetic Characterization of a Vancomycin-Resistant Staphylococcus aureus Isolate from the Respiratory Tract of a Patient in a University Hospital in Northeastern Iran. J. Clin. Microbiol. 2012, 50, 3581–3585. [Google Scholar] [CrossRef] [Scilit]
  22. Wendlandt, S.; Feßler, A.T.; Monecke, S.; Ehricht, R.; Schwarz, S.; Kadlec, K. The Diversity of Antimicrobial Resistance Genes among Staphylococci of Animal Origin. Int. J. Med. Microbiol. 2013, 303, 338–349. [Google Scholar] [CrossRef] [Scilit]
  23. Li, X.; Huang, T.; Xu, K.; Li, C.; Li, Y. Molecular Characteristics and Virulence Gene Profiles of Staphylococcus aureus Isolates in Hainan, China. BMC Infect. Dis. 2019, 19, 487–494. [Google Scholar] [CrossRef] [Scilit]
  24. Mehrotra, M.; Wang, G.; Johnson, W.M. Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. J. Clin. Microbiol. 2000, 38, 1032–1035. [Google Scholar] [CrossRef] [Scilit]
  25. Tristan, A.; Ying, L.; Bes, M.; Etienne, J.; Vandenesch, F.; Lina, G. Use of Multiplex PCR to Identify Staphylococcus aureus Adhesins Involved in Human Hematogenous Infections. J. Clin. Microbiol. 2003, 41, 4465–4467. [Google Scholar] [CrossRef] [Scilit]
  26. Matsuhashi, M.; Song, M.D.; Ishino, F.; Wachi, M.; Doi, M.; Inoue, M.; Ubukata, K.; Yamashita, N.; Konno, M. Molecular Cloning of the Gene of a Penicillin-Binding Protein Supposed to Cause High Resistance to β-Lactam Antibiotics in Staphylococcus aureus. J. Bacteriol. 1986, 167, 975–980. [Google Scholar] [CrossRef] [Scilit]
  27. Itou, T.; Katayama, Y.; Hiramatsu, K. A New Mobile Genetic Element, Staphylococcal Cassette Chromosome Mec, Encodes Methicillin Resistance in Staphylococcus aureus. Nippon. Saikingaku Zasshi. Jpn. J. Bacteriol. 2000, 55, 483–498. [Google Scholar] [CrossRef]
  28. Vijayaraj, R.; Altaff, K.; Lakshmanan, G.; Jayaprakashvel, M.; Mickymaray, S.; Gunapriya, R.; Palanisamy, M.; Alothaim, A.S. Inhibitory Activity of Chitin, (2-Acetamido-2-Deoxy-Hexopyranose) against Penicillin-Binding Proteins of Staphylococcus aureus. Coatings 2022, 12, 1854. [Google Scholar] [CrossRef] [Scilit]
  29. Utsui, Y.; Yokota, T. Role of an Altered Penicillin-Binding Protein in Methicillin- and Cephem-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 1985, 28, 397–403. [Google Scholar] [CrossRef] [Scilit]
  30. Lade, H.; Kim, J.S. Bacterial Targets of Antibiotics in Methicillin-Resistant Staphylococcus aureus. Antibiotics 2021, 10, 398. [Google Scholar] [CrossRef] [Scilit]
  31. Watkins, R.R.; Holubar, M.; David, M.Z. Antimicrobial Resistance in Methicillin-Resistant Staphylococcus aureus to Newer Antimicrobial Agents. Antimicrob. Agents Chemother. 2019, 63, e01216-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Fisher, J.F.; Mobashery, S. Enzymology of Bacterial Resistance. Compr. Nat. Prod. II Chem. Biol. 2010, 8, 443–487. [Google Scholar] [CrossRef] [Scilit]
  33. Périchon, B.; Courvalin, P. VanA-Type Vancomycin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2009, 53, 4580–4587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Münch, D.; Sahl, H.G. Structural Variations of the Cell Wall Precursor Lipid II in Gram-Positive Bacteria—Impact on Binding and Efficacy of Antimicrobial Peptides. Biochim. Biophys. Acta Biomembr. 2015, 1848, 3062–3071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Rouch, D.A.; Byrne, M.E.; Kong, Y.C.; Skurray, R.A. The AacA-AphD Gentamicin and Kanamycin Resistance Determinant of Tn4001 from Staphylococcus aureus: Expression and Nucleotide Sequence Analysis. Microbiology 1987, 133, 3039–3052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Ubukata, K.; Konno, M.; Shirahata, K.; Iida, T. Gentamicin Resistance in Staphylococcus aureus Isolated in Japan. Chemotherapy 1982, 30, 546–553. [Google Scholar] [CrossRef]
  37. Ida, T.; Okamoto, R.; Shimauchi, C.; Okubo, T.; Kuga, A.; Inoue, M. Identification of Aminoglycoside-Modifying Enzymes by Susceptibility Testing: Epidemiology of Methicillin-Resistant Staphylococcus aureus in Japan. J. Clin. Microbiol. 2001, 39, 3115–3121. [Google Scholar] [CrossRef] [Scilit]
  38. Martineau, F.; Picard, F.J.; Lansac, N.; Ménard, C.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Correlation between the Resistance Genotype Determined by Multiplex PCR Assays and the Antibiotic Susceptibility Patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob. Agents Chemother. 2000, 44, 231–238. [Google Scholar] [CrossRef] [Scilit]
  39. Leclercq, R.; Courvalin, P. Bacterial Resistance to Macrolide, Lincosamide, and Streptogramin Antibiotics by Target Modification. Antimicrob. Agents Chemother. 1991, 35, 1267–1272. [Google Scholar] [CrossRef] [Scilit]
  40. Ross, J.I.; Eady, E.A.; Cove, J.H.; Cunliffe, W.J.; Baumberg, S.; Wootton, J.C. Inducible Erythromycin Resistance in Staphlyococci Is Encoded by a Member of the ATP-binding Transport Super-gene Family. Mol. Microbiol. 1990, 4, 1207–1214. [Google Scholar] [CrossRef] [Scilit]
  41. Emaneini, M.; Bigverdi, R.; Kalantar, D.; Soroush, S.; Jabalameli, F.; Noorazar Khoshgnab, B.; Asadollahi, P.; Taherikalani, M. Distribution of Genes Encoding Tetracycline Resistance and Aminoglycoside Modifying Enzymes in Staphylococcus aureus Strains Isolated from a Burn Center. Ann. Burn. Fire Disasters 2013, 26, 76–80. [Google Scholar]
  42. Ardic, N.; Ozyurt, M.; Sareyyupoglu, B.; Haznedaroglu, T. Investigation of Erythromycin and Tetracycline Resistance Genes in Methicillin-Resistant Staphylococci. Int. J. Antimicrob. Agents 2005, 26, 213–218. [Google Scholar] [CrossRef] [Scilit]
  43. Marty, E.; Bodenmann, C.; Buchs, J.; Hadorn, R.; Eugster-Meier, E.; Lacroix, C.; Meile, L. Prevalence of Antibiotic Resistance in Coagulase-Negative Staphylococci from Spontaneously Fermented Meat Products and Safety Assessment for New Starters. Int. J. Food Microbiol. 2012, 159, 74–83. [Google Scholar] [CrossRef] [Scilit]
  44. Kenawy, E.R.; Ali, S.S.; Al-Etewy, M.; Sun, J.; Wu, J.; El-Zawawy, N. Synthesis, Characterization and Biomedical Applications of a Novel Schiff Base on Methyl Acrylate-Functionalized Chitosan Bearing p-Nitrobenzaldehyde Groups. Int. J. Biol. Macromol. 2019, 122, 833–843. [Google Scholar] [CrossRef] [Scilit]
  45. Van, T.T.H.; Nguyen, H.N.K.; Smooker, P.M.; Coloe, P.J. The Antibiotic Resistance Characteristics of Non-Typhoidal Salmonella enterica Isolated from Food-Producing Animals, Retail Meat and Humans in South East Asia. Int. J. Food Microbiol. 2012, 154, 98–106. [Google Scholar] [CrossRef] [Scilit]
  46. Cutler, S.J.; Fooks, A.R.; Van Der Poel, W.H.M. Public Health Threat of New, Reemerging, and Neglected Zoonoses in the Industrialized World. Emerg. Infect. Dis. 2010, 16, 1–7. [Google Scholar] [CrossRef] [Scilit]
  47. Pantosti, A. Methicillin-Resistant Staphylococcus aureus Associated with Animals and Its Relevance to Human Health. Front. Microbiol. 2012, 3, 127. [Google Scholar] [CrossRef] [Scilit]
  48. Osman, K.M.; Amer, A.M.; Badr, J.M.; Helmy, N.M.; Elhelw, R.A.; Orabi, A.; Bakry, M.; Saad, A.S.A. Antimicrobial Resistance, Biofilm Formation and mecA Characterization of Methicillin-Susceptible S. aureus and Non-S. aureus of Beef Meat Origin in Egypt. Front. Microbiol. 2016, 7, 222. [Google Scholar] [CrossRef] [Scilit]
  49. Li, Q.; Li, Y.; Tang, Y.; Meng, C.; Ingmer, H.; Jiao, X. Prevalence and Characterization of Staphylococcus aureus and Staphylococcus argenteus in Chicken from Retail Markets in China. Food Control. 2019, 96, 158–164. [Google Scholar] [CrossRef] [Scilit]
  50. Chaalal, W.; Chaalal, N.; Bourafa, N.; Kihal, M.; Diene, S.M.; Rolain, J.M. Characterization of Staphylococcus aureus Isolated from Food Products in Western Algeria. Foodborne Pathog. Dis. 2018, 15, 353–360. [Google Scholar] [CrossRef] [Scilit]
  51. Hiroi, M.; Kawamori, F.; Harada, T.; Sano, Y.; Miwa, N.; Sugiyama, K.; Hara-Kudo, Y.; Masuda, T. Antibiotic Resistance in Bacterial Pathogens from Retail Raw Meats and Food-Producing Animals in Japan. J. Food Prot. 2012, 75, 1774–1782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Hassan, A.; Hiko, A.; Bogale, K.; Abera, B.; Tsegaye, B. Antimicrobial Resistance Profiles of Staphylococcus aureus Isolates along Asella Municipal Beef Abattoir Line, South Eastern Ethiopia. J. Vet. Sci. Technol. 2018, 9, 1–5. [Google Scholar] [CrossRef]
  53. Ed-Dra, A.; Filali, F.R.; Bouymajane, A.; Benhallam, F.; Allaoui, A.E.; Chaiba, A.; Giarratana, F. Antibiotic Susceptibility Profile of Staphylococcus aureus Isolated from Sausages in Meknes, Morocco. Vet. World 2018, 11, 1459–1465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Effah, C.Y.; Akwasi, B.; Otoo, F.; Ntiefo, R.A. Prevalence and Phenotypic Antibiotic Bioassay of Methicillin-Resistant Staphylococcus aureus in Raw Meats Sold at Various Retail Outlets in the Cape Coast Metropolis of Ghana. Above Minim. Threshold. Again Retail. Outlet 2018, 2, 3. [Google Scholar]
  55. Iroha, I.R.; Ugbo, E.C.; Ilang, D.C.; Oji, A.E.; Ayogu, T.E. Bacteria Contamination of Raw Meat Sold in Abakaliki, Ebonyi State Nigeria. J. Public Health Epidemiol. 2011, 3, 49–53. [Google Scholar]
  56. Thwala, T.; Madoroba, E.; Basson, A.; Butaye, P. Prevalence and Characteristics of Staphylococcus aureus Associated with Meat and Meat Products in African Countries: A Review. Antibiotics 2021, 10, 1108. [Google Scholar] [CrossRef] [Scilit]
  57. Sadiq, A.; Samad, M.; Saddam, M.; Basharat, N.; Ali, S.; Roohullah, S.; Saad, Z.; Khan, A.N.; Ahmad, Y.; Khan, A.; et al. Methicillin-Resistant Staphylococcus aureus (MRSA) in Slaughter Houses and Meat Shops in Capital Territory of Pakistan During 2018–2019. Front. Microbiol. 2020, 11, 577707. [Google Scholar] [CrossRef] [Scilit]
  58. Gwida, M.; Saad, T.; Elgohary, A.; Mohamed, A. Characterization of Methicillin-Susceptible and Methicillin-Resistant Staphylococcus aureus from Healthy Cattle and Buffaloes in a Linked Community. Mansoura Vet. Med. J. 2021, 22, 76–81. [Google Scholar] [CrossRef] [Scilit]
  59. El-Zamkan, M.A.; Mubarak, A.G.; Ali, A.O. Prevalence and Phylogenetic Relationship among Methicillin- and Vancomycin-Resistant Staphylococci Isolated from Hospital’s Dairy Food, Food Handlers, and Patients. J. Adv. Vet. Anim. Res. 2019, 6, 463–473. [Google Scholar] [CrossRef] [Scilit]
  60. Abdul-Hameed, R.A.; Ayoub, N.S. Vancomycin Resistance among Methicillin-Resistant Staphylococcus aureus Isolates from General Hospitals. Kcmj 2014, 10, 82–86. [Google Scholar]
  61. Akgul, O.; Bora, G.; Guducuoglu, H. Investigation of the Gene Carriage Rates for Staphylococcus aureus, MecA, VanA and Nuc Genes in the Nasal and Milk Specimens from the Sheep Caretakers with Sheep. Large Anim. Rev. 2021, 27, 259–268. [Google Scholar]
  62. Al-Amery, K.; Elhariri, M.; Elsayed, A.; El-Moghazy, G.; Elhelw, R.; El-Mahallawy, H.; El Hariri, M.; Hamza, D. Vancomycin-Resistant Staphylococcus aureus Isolated from Camel Meat and Slaughterhouse Workers in Egypt. Antimicrob. Resist. Infect. Control 2019, 8, 1–8. [Google Scholar] [CrossRef] [Scilit]
  63. Juhász-Kaszanyitzky, É.; Jánosi, S.; Somogyi, P.; Dán, Á.; Van Der Graaf-van Bloois, L.; Van Duijkeren, E.; Wagenaar, J.A. MRSA Transmission between Cows and Humans. Emerg. Infect. Dis. 2007, 13, 630–632. [Google Scholar] [CrossRef] [Scilit]
  64. Pokhrel, H.; Baishya, S.; Phukan, B.; Pillai, D.; Ashraf Rather, M. Occurrence and Distribution of Multiple Antibiotic Resistance Bacteria of Public Health Significance in Backwaters and Aquaculture Farm. Int. J. Curr. Microbiol. Appl. Sci. 2018, 7, 975–987. [Google Scholar] [CrossRef] [Scilit]
  65. Titilawo, Y.; Sibanda, T.; Obi, L.; Okoh, A. Multiple Antibiotic Resistance Indexing of Escherichia coli to Identify High-Risk Sources of Faecal Contamination of Water. Environ. Sci. Pollut. Res. 2015, 22, 10969–10980. [Google Scholar] [CrossRef] [Scilit]
  66. Savariraj, W.R.; Ravindran, N.B.; Kannan, P.; Paramasivam, R.; Senthilkumar, T.M.A.; Kumarasamy, P.; Rao, V.A. Prevalence, Antimicrobial Susceptibility and Virulence Genes of Staphylococcus aureus Isolated from Pork Meat in Retail Outlets in India. J. Food Saf. 2019, 39, e12589. [Google Scholar] [CrossRef] [Scilit]
  67. Lozano, C.; Gharsa, H.; Ben Slama, K.; Zarazaga, M.; Torres, C. Staphylococcus aureus in Animals and Food: Methicillin Resistance, Prevalence and Population Structure. a Review in the African Continent. Microorganisms 2016, 4, 12. [Google Scholar] [CrossRef] [Scilit]
  68. International Organization for Standardization. Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Enumeration of Coagulase-Positive Staphylococci (Staphylococcus aureus and Other Species); ISO 6888-1:999/Amd.1:2003; International Organization for Standardization: Geneva, Switzerland, 2003; Available online: https://www.iso.org/standard/23036.html (accessed on 10 November 2017).
  69. Guran, H.S.; Kahya, S. Species Diversity and Pheno- and Genotypic Antibiotic Resistance Patterns of Staphylococci Isolated from Retail Ground Meats. J. Food Sci. 2015, 80, M1291–M1298. [Google Scholar] [CrossRef] [Scilit]
  70. Abbey, T.C.; Deak, E. What’s New from the CLSI Subcommittee on Antimicrobial Susceptibility Testing M100, 29th Edition. Clin. Microbiol. Newsl. 2019, 41, 203–209. [Google Scholar] [CrossRef] [Scilit]
  71. Zaher, H.A.; Nofal, M.I.; Hendam, B.M.; Elshaer, M.M.; Alothaim, A.S.; Eraqi, M.M. Prevalence and Antibiogram of Vibrio parahaemolyticus and Aeromonas hydrophila in the Flesh of Nile Tilapia, with Special Reference to Their Virulence Genes Detected Using Multiplex Pcr Technique. Antibiotics 2021, 10, 654. [Google Scholar] [CrossRef] [Scilit]
  72. Singh, V.; Rathore, G.; Kapoor, D.; Mishra, B.N.; Lakra, W.S. Detection of Aerolysin Gene in Aeromonas Hydrophila Isolated from Fish and Pond Water. Indian J. Microbiol. 2008, 48, 453–458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Agarose gel electrophoresis of multiplex PCR of nucA (279), mecA (154 bp), aac 6-aph 2 (348 bp), tet L (475 bp), ermA (645 bp), and vanA (1030 bp) antibiotic resistance genes of S. aureus. Lane M: 100 bp ladder as molecular size DNA marker. Lane C+: Control positive for nucA, mecA, aac 6-aph 2, tet L, ermA, and vanA genes. Lane C−: Control negative. Lanes from 1 to 19: positive S. aureus strains for nucA gene. Lanes 2, 5, 9, 10, 15, 16, and 19: positive S. aureus strains for mecA gene. Lanes 5, 7, 13, and 19: positive S. aureus strains for tet L gene. Lanes 1, 7, 11, 13, and 14: positive S. aureus strains for ermA gene. Lanes 8 and 18: positive S. aureus strains for vanA gene. Lanes from 1 to 19: negative S. aureus strains for aac 6-aph 2 gene.
Figure 1. Agarose gel electrophoresis of multiplex PCR of nucA (279), mecA (154 bp), aac 6-aph 2 (348 bp), tet L (475 bp), ermA (645 bp), and vanA (1030 bp) antibiotic resistance genes of S. aureus. Lane M: 100 bp ladder as molecular size DNA marker. Lane C+: Control positive for nucA, mecA, aac 6-aph 2, tet L, ermA, and vanA genes. Lane C−: Control negative. Lanes from 1 to 19: positive S. aureus strains for nucA gene. Lanes 2, 5, 9, 10, 15, 16, and 19: positive S. aureus strains for mecA gene. Lanes 5, 7, 13, and 19: positive S. aureus strains for tet L gene. Lanes 1, 7, 11, 13, and 14: positive S. aureus strains for ermA gene. Lanes 8 and 18: positive S. aureus strains for vanA gene. Lanes from 1 to 19: negative S. aureus strains for aac 6-aph 2 gene.
Antibiotics 12 00205 g001
Table 1. Prevalence of S. aureus and its antibiotic resistance genes isolated from cattle, sheep carcass, human stools, and hand swabs samples.
Table 1. Prevalence of S. aureus and its antibiotic resistance genes isolated from cattle, sheep carcass, human stools, and hand swabs samples.
Types of SamplesNo. of Examined SamplesS. aureus IsolatesnucAmecATet (L)ermAvanAaac 6-aph
%%%%%%%
Cattle1002010035510350
Sheep1001510026.6613.3200
Hand swabs503410029.45.85.811.70
Human stools50101004020000
Total3001910031.578.719.30
Table 2. Antibiogram susceptibility of S. aureus strains (n = 57).
Table 2. Antibiogram susceptibility of S. aureus strains (n = 57).
Antimicrobial AgentSymbolSR
%%
CephalexinCE15.878.9
Oxacillin OX26.373.7
Cephalothin CN36.852.6
Flucloxacillin FL47.447.4
Sulphamethoxazol SXT47.436.8
Dicloxacillin DC52.636.8
Erythromycin E63.231.6
Clindamycin CL63.226.3
Lincomycin L68.426.3
Cefazolin CZ73.721.1
Ceftibiprole CB84.210.5
Dalbavancin D84.25.3
Tigecycline TG89.55.3
Oritavancin O94.75.3
Linezolid LZ89.5-
TelavancinT100-
DeptomycinD100-
S: sensitive. R: resistance.
Table 3. MAR index of S. aureus isolates (n = 57).
Table 3. MAR index of S. aureus isolates (n = 57).
No. of StrainAntimicrobial Resistance ProfileMAR Index
6CE, OX, CN, FL, SXT, DC, E, CL, L, CZ, CB, D, TG, O0.823
3CE, OX, CN, FL, SXT, DC, E, CL, L, CZ, CB0.647
5CE, OX, CN, FL, SXT, DC, E, CL, L, CZ0.588
4CE, OX, CN, FL, SXT, DC, E, CL, L, CZ0.588
4CE, OX, CN, FL, SXT, DC, E, CL, L0.474
3CE, OX, CN, FL, SXT, DC, E0.412
3CE, OX, CN, FL, SXT, DC0.353
4CE, OX, CN, FL, SXT0.294
4CE, OX, CN, FL, SXT0.294
4CE, OX, CN0.158
3CE, OX0.117
4CE, OX0.117
3CE, OX0.117
3CE, OX0.117
4CE0.059
Average0.343
Table 4. Oligonucleotide primers used for identification for S. aureus.
Table 4. Oligonucleotide primers used for identification for S. aureus.
PrimerOligonucleotide Sequence (5′ → 3′)Product Size (bp)References
nucA(F): 5′ GCGATTGATGGTGATACGGTT ′3279[69]
(R): 5′ AGCCAAGCCTTGACGAACTAAAGC ′3
mecA(F): 5′ TAGAAATGACTGAACGTCCG ′3154
(R): 5′ TTGCGATCAATGTTACCGTAG ′3
aac 6-aph 2(F): 5′ CAGAGCCTTGGGAAGATGAAG ′3348
(R): 5′ CCTCGTGTAATTCATGTTCTGGC ′3
Tet (L)(F): 5′ CATTTGGTCTTATTGGATCG ′3475
(R): 5′ ATTACACTTCCGATTTCGG ′3
ermA(F): 5′ TCTAAAAAGCATGTAAAAGAA ′3645
(R): 5′ CTTCGATAGTTTATTAATATTAGT ′3
vanA(F): 5′CATGAATAGAATAAAAGTTGCAATA′31030
(R): 5′ CCCCTTTAACGCTAATACGATCAA ′3
Table 5. Antimicrobial discs, concentration, and interpretation of their action on the isolated pathogens (μg).
Table 5. Antimicrobial discs, concentration, and interpretation of their action on the isolated pathogens (μg).
AntibioticsSymbolConcentration
Tigecycline TG30
Lincomycin L15
Cefazolin CZ30
Ceftibiprole CB30
Dicloxacillin DC1
Linezolid LZ30
Telavancin T5
Cephalothin CN30
Flucloxacillin FL1
Clindamycin CL10
Dalbavancin D30
Oxacillin OX1
Oritavancin O5
Deptomycin D30
Erythromycin E15
Cephalexin CE30
Sulphamethoxazol SXT25
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zaher, H.A.; El Baz, S.; Alothaim, A.S.; Alsalamah, S.A.; Alghonaim, M.I.; Alawam, A.S.; Eraqi, M.M. Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers. Antibiotics 2023, 12, 205. https://doi.org/10.3390/antibiotics12020205

AMA Style

Zaher HA, El Baz S, Alothaim AS, Alsalamah SA, Alghonaim MI, Alawam AS, Eraqi MM. Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers. Antibiotics. 2023; 12(2):205. https://doi.org/10.3390/antibiotics12020205

Chicago/Turabian Style

Zaher, Hanan A., Shimaa El Baz, Abdulaziz S. Alothaim, Sulaiman A. Alsalamah, Mohammed Ibrahim Alghonaim, Abdullah S. Alawam, and Mostafa M. Eraqi. 2023. "Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers" Antibiotics 12, no. 2: 205. https://doi.org/10.3390/antibiotics12020205

APA Style

Zaher, H. A., El Baz, S., Alothaim, A. S., Alsalamah, S. A., Alghonaim, M. I., Alawam, A. S., & Eraqi, M. M. (2023). Molecular Basis of Methicillin and Vancomycin Resistance in Staphylococcus aureus from Cattle, Sheep Carcasses and Slaughterhouse Workers. Antibiotics, 12(2), 205. https://doi.org/10.3390/antibiotics12020205

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop