Rapid Multiplex Strip Test for the Detection of Circulating Tumor DNA Mutations for Liquid Biopsy Applications
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Apparatus
2.2. Cell Lines and Clinical Samples
2.3. DNA Extraction from Cell Lines and Tissue Samples
2.4. Cell-Free DNA (cfDNA) Extraction from Blood Samples
2.5. Preparation of Streptavidin-Conjugated Gold Nanoparticles (SA-AuNPs)
2.6. Synthesis of Functionalized Microspheres
2.7. KRAS Gene Amplification
2.8. Multiplex Primer Extension Reaction (PEXT) for Single-Point Mutation Discrimination in ctDNA
2.9. Fabrication of the Multiplex Rapid Strip Test
2.10. Multi-Allele Detection by the Rapid Strip Test
3. Results
3.1. Synthetic DNA Targets
3.2. Cell Lines
3.3. Tissue Samples
3.4. Detectability of the Method
3.5. Application of the Multiplex Rapid Strip Test to Blood Samples for the Detection of KRAS Mutations in cf/ctDNA
3.6. Repeatability of the Multiplex Rapid Strip Test
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- El-Deiry, W.S.; Goldberg, R.M.; Lenz, H.-J.; Shields, A.F.; Gibney, G.T.; Tan, A.R.; Brown, J.; Eisenberg, B.; Heath, E.I.; Phuphanich, S.; et al. The current state of molecular testing in the treatment of patients with solid tumors, 2019. CA Cancer J. Clin. 2019, 69, 305–343. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D.; Weinberg, R.A. The Hallmarks of Cancer. Cell 2000, 100, 57–70. [Google Scholar] [CrossRef]
- Iranzo, J.; Martincorena, I.; Koonin, E.V. Cancer-mutation network and the number and specificity of driver mutations. Proc. Natl. Acad. Sci. USA 2018, 115, E6010–E6019. [Google Scholar] [CrossRef] [PubMed]
- Martincorena, I.; Campbell, P.J. Somatic mutation in cancer and normal cells. Science 2015, 349, 1483–1489. [Google Scholar] [CrossRef]
- Slebos, R.J.C.; Kibbelaar, R.E.; Dalesio, O.; Kooistra, A.; Stam, J.; Meijer, C.J.L.M.; Wagenaar, S.S.; Vanderschueren, R.G.J.R.A.; van Zandwijk, N.; Mooi, W.J.; et al. K-ras Oncogene Activation as a Prognostic Marker in Adenocarcinoma of the Lung. N. Engl. J. Med. 1990, 323, 561–565. [Google Scholar] [CrossRef]
- Bos, J.L. Ras Oncogenes in Human Cancer: A Review. Cancer Res. 1989, 49, 4682–4689. [Google Scholar]
- Cardarella, S.; Ogino, A.; Nishino, M.; Butaney, M.; Shen, J.; Lydon, C.; Yeap, B.Y.; Sholl, L.M.; Johnson, B.E.; Jänne, P.A. Clinical, pathologic, and biologic features associated with BRAF mutations in non–small cell lung cancer. Clin. Cancer Res. 2013, 19, 4532–4540. [Google Scholar] [CrossRef]
- HARVEY, J.J. An Unidentified Virus which causes the Rapid Production of Tumours in Mice. Nature 1964, 204, 1104–1105. [Google Scholar] [CrossRef]
- Rajalingam, K.; Schreck, R.; Rapp, U.R.; Albert, Š. Ras oncogenes and their downstream targets. Biochim. Biophys. Acta Mol. Cell Res. 2007, 1773, 1177–1195. [Google Scholar] [CrossRef]
- Shackelford, R.E.; Whitling, N.A.; McNab, P.; Japa, S.; Coppola, D. KRAS Testing: A Tool for the Implementation of Personalized Medicine. Genes Cancer 2012, 3, 459–466. [Google Scholar] [CrossRef]
- McLellan, E.A.; Owen, R.A.; Stepniewska, K.A.; Sheffield, J.P.; Lemoine, N.R. High frequency of K-ras mutations in sporadic colorectal adenomas. Gut 1993, 34, 392–396. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef]
- Bettegowda, C.; Sausen, M.; Leary, R.J.; Kinde, I.; Wang, Y.; Agrawal, N.; Bartlett, B.R.; Wang, H.; Luber, B.; Alani, R.M.; et al. Detection of circulating tumor DNA in early- and late-stage human malignancies. Sci. Transl. Med. 2014, 6, 224ra24. [Google Scholar] [CrossRef]
- Elazezy, M.; Joosse, S.A. Techniques of using circulating tumor DNA as a liquid biopsy component in cancer management. Comput. Struct. Biotechnol. J. 2018, 16, 370–378. [Google Scholar] [CrossRef]
- Liebs, S.; Keilholz, U.; Kehler, I.; Schweiger, C.; Haybäck, J.; Nonnenmacher, A. Detection of mutations in circulating cell-free DNA in relation to disease stage in colorectal cancer. Cancer Med. 2019, 8, 3761–3769. [Google Scholar] [CrossRef]
- Kloten, V.; Rüchel, N.; Brüchle, N.O.; Gasthaus, J.; Freudenmacher, N.; Steib, F.; Mijnes, J.; Eschenbruch, J.; Binnebösel, M.; Knüchel, R.; et al. Liquid biopsy in colon cancer: Comparison of different circulating DNA extraction systems following absolute quantification of KRAS mutations using Intplex allele-specific PCR. Oncotarget 2017, 8, 86253–86263. [Google Scholar] [CrossRef]
- Cree, I.A.; Uttley, L.; Buckley Woods, H.; Kikuchi, H.; Reiman, A.; Harnan, S.; Whiteman, B.L.; Philips, S.T.; Messenger, M.; Cox, A.; et al. The evidence base for circulating tumour DNA blood-based biomarkers for the early detection of cancer: A systematic mapping review. BMC Cancer 2017, 17, 697. [Google Scholar] [CrossRef]
- Giannopoulou, L.; Kasimir-Bauer, S.; Lianidou, E.S. Liquid biopsy in ovarian cancer: Recent advances on circulating tumor cells and circulating tumor DNA. Clin. Chem. Lab. Med. 2018, 56, 186–197. [Google Scholar] [CrossRef]
- Chang, Y.; Tolani, B.; Nie, X.; Zhi, X.; Hu, M.; He, B. Review of the clinical applications and technological advances of circulating tumor DNA in cancer monitoring. Ther. Clin. Risk Manag. 2017, 13, 1363–1374. [Google Scholar] [CrossRef]
- Lopez, A.; Harada, K.; Mizrak Kaya, D.; Dong, X.; Song, S.; Ajani, J.A. Liquid biopsies in gastrointestinal malignancies: When is the big day? Expert Rev. Anticancer Ther. 2018, 18, 19–38. [Google Scholar] [CrossRef]
- Han, X.; Wang, J.; Sun, Y. Circulating Tumor DNA as Biomarkers for Cancer Detection. Genomics Proteom. Bioinform. 2017, 15, 59–72. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wuethrich, A.; Sina, A.A.I.; Lane, R.E.; Lin, L.L.; Wang, Y.; Cebon, J.; Behren, A.; Trau, M. Tracking extracellular vesicle phenotypic changes enables treatment monitoring in melanoma. Sci. Adv. 2020, 6, eaax3223. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Koo, K.M.; Wang, Y.; Trau, M. Engineering State-of-the-Art Plasmonic Nanomaterials for SERS-Based Clinical Liquid Biopsy Applications. Adv. Sci. 2019, 6, 1900730. [Google Scholar] [CrossRef] [PubMed]
- Das, J.; Kelley, S.O. High-Performance Nucleic Acid Sensors for Liquid Biopsy Applications. Angew. Chem. Int. Ed. 2020, 59, 2554–2564. [Google Scholar] [CrossRef]
- Li, Z.-N.; Zhao, L.; Yu, L.-F.; Wei, M.-J. BRAF and KRAS mutations in metastatic colorectal cancer: Future perspectives for personalized therapy. Gastroenterol. Rep. 2020, 8, 192–205. [Google Scholar] [CrossRef]
- Zheng, W.; Yao, L.; Teng, J.; Yan, C.; Qin, P.; Liu, G.; Chen, W. Lateral Flow Test for Visual Detection of Multiple MicroRNAs. Sens. Actuators B Chem. 2018, 264, 320–326. [Google Scholar] [CrossRef]
- Kalligosfyri, P.; Nikou, S.; Bravou, V.; Kalogianni, D.P. Liquid biopsy genotyping by a simple lateral flow strip assay with visual detection. Anal. Chim. Acta 2021, 1163, 338470. [Google Scholar] [CrossRef]
- Spyrou, E.M.; Kalogianni, D.P.; Tragoulias, S.S.; Ioannou, P.C.; Christopoulos, T.K. Digital camera and smartphone as detectors in paper-based chemiluminometric genotyping of single nucleotide polymorphisms. Anal. Bioanal. Chem. 2016, 408, 7393–7402. [Google Scholar] [CrossRef]
- Li, X.; Ye, M.; Zhang, W.; Tan, D.; Jaffrezic-Renault, N.; Yang, X.; Guo, Z. Liquid biopsy of circulating tumor DNA and biosensor applications. Biosens. Bioelectron. 2019, 126, 596–607. [Google Scholar] [CrossRef]
- Zhu, D.; Liu, W.; Cao, W.; Chao, J.; Su, S.; Wang, L.; Fan, C. Multiple Amplified Electrochemical Detection of MicroRNA-21 Using Hierarchical Flower-like Gold Nanostructures Combined with Gold-enriched Hybridization Chain Reaction. Electroanalysis 2018, 30, 1349–1356. [Google Scholar] [CrossRef]
- Magiati, M.; Sevastou, A.; Kalogianni, D.P. A fluorometric lateral flow assay for visual detection of nucleic acids using a digital camera readout. Microchim. Acta 2018, 185, 314. [Google Scholar] [CrossRef]
- Zhang, H.; Liu, X.; Zhang, C.; Xu, Y.; Su, J.; Lu, X.; Shi, J.; Wang, L.; Landry, M.P.; Zhu, Y.; et al. A DNA tetrahedral structure-mediated ultrasensitive fluorescent microarray platform for nucleic acid test. Sens. Actuators B Chem. 2020, 321, 128538. [Google Scholar] [CrossRef]
- Huang, Y.; Tao, M.; Luo, S.; Zhang, Y.; Situ, B.; Ye, X.; Chen, P.; Jiang, X.; Wang, Q.; Zheng, L. A novel nest hybridization chain reaction based electrochemical assay for sensitive detection of circulating tumor DNA. Anal. Chim. Acta 2020, 1107, 40–47. [Google Scholar] [CrossRef]
- Das, J.; Ivanov, I.; Safaei, T.S.; Sargent, E.H.; Kelley, S.O. Combinatorial Probes for High-Throughput Electrochemical Analysis of Circulating Nucleic Acids in Clinical Samples. Angew. Chem. Int. Ed. 2018, 57, 3711–3716. [Google Scholar] [CrossRef]
- Das, J.; Ivanov, I.; Sargent, E.H.; Kelley, S.O. DNA Clutch Probes for Circulating Tumor DNA Analysis. J. Am. Chem. Soc. 2016, 138, 11009–11016. [Google Scholar] [CrossRef]
- Cai, C.; Guo, Z.; Cao, Y.; Zhang, W.; Chen, Y. A dual biomarker detection platform for quantitating circulating tumor DNA (ctDNA). Nanotheranostics 2018, 2, 12–20. [Google Scholar] [CrossRef]
- Wang, H.-F.; Ma, R.-N.; Sun, F.; Jia, L.-P.; Zhang, W.; Shang, L.; Xue, Q.-W.; Jia, W.-L.; Wang, H.-S. A versatile label-free electrochemical biosensor for circulating tumor DNA based on dual enzyme assisted multiple amplification strategy. Biosens. Bioelectron. 2018, 122, 224–230. [Google Scholar] [CrossRef]
- Attoye, B.; Pou, C.; Blair, E.; Rinaldi, C.; Thomson, F.; Baker, M.J.; Corrigan, D.K. Developing a Low-Cost, Simple-to-Use Electrochemical Sensor for the Detection of Circulating Tumour DNA in Human Fluids. Biosensensors 2020, 10, 156. [Google Scholar] [CrossRef]
- Attoye, B.; Baker, M.J.; Thomson, F.; Pou, C.; Corrigan, D.K. Optimisation of an Electrochemical DNA Sensor for Measuring KRAS G12D and G13D Point Mutations in Different Tumour Types. Biosensensors 2021, 11, 42. [Google Scholar] [CrossRef]
- Yuanfeng, P.; Ruiyi, L.; Xiulan, S.; Guangli, W.; Zaijun, L. Highly sensitive electrochemical detection of circulating tumor DNA in human blood based on urchin-like gold nanocrystal-multiple graphene aerogel and target DNA-induced recycling double amplification strategy. Anal. Chim. Acta 2020, 1121, 17–25. [Google Scholar] [CrossRef]
- Zhou, Q.; Zheng, J.; Qing, Z.; Zheng, M.; Yang, J.; Yang, S.; Ying, L.; Yang, R. Detection of Circulating Tumor DNA in Human Blood via DNA-Mediated Surface-Enhanced Raman Spectroscopy of Single-Walled Carbon Nanotubes. Anal. Chem. 2016, 88, 4759–4765. [Google Scholar] [CrossRef]
- Wee, E.J.H.; Wang, Y.; Tsao, S.C.-H.; Trau, M. Simple, Sensitive and Accurate Multiplex Detection of Clinically Important Melanoma DNA Mutations in Circulating Tumour DNA with SERS Nanotags. Theranostics 2016, 6, 1506–1513. [Google Scholar] [CrossRef]
- Lyu, N.; Rajendran, V.K.; Diefenbach, R.J.; Charles, K.; Clarke, S.J.; Engel, A.; Sydney 1000 Colorectal Cancer Study Investigators; Rizos, H.; Molloy, M.P.; Wang, Y. Multiplex detection of ctDNA mutations in plasma of colorectal cancer patients by PCR/SERS assay. Nanotheranostics 2020, 4, 224–232. [Google Scholar] [CrossRef]
- Liu, Y.; Lyu, N.; Rajendran, V.K.; Piper, J.; Rodger, A.; Wang, Y. Sensitive and Direct DNA Mutation Detection by Surface-Enhanced Raman Spectroscopy Using Rational Designed and Tunable Plasmonic Nanostructures. Anal. Chem. 2020, 92, 5708–5716. [Google Scholar] [CrossRef]
- Hu, P.; Zhang, S.; Wu, T.; Ni, D.; Fan, W.; Zhu, Y.; Qian, R.; Shi, J. Fe–Au Nanoparticle-Coupling for Ultrasensitive Detections of Circulating Tumor DNA. Adv. Mater. 2018, 30, 1801690. [Google Scholar] [CrossRef]
- Tadimety, A.; Zhang, Y.; Kready, K.M.; Palinski, T.J.; Tsongalis, G.J.; Zhang, J.X.J. Design of peptide nucleic acid probes on plasmonic gold nanorods for detection of circulating tumor DNA point mutations. Biosens. Bioelectron. 2019, 130, 236–244. [Google Scholar] [CrossRef]
- Wang, C.; Chen, X.; Wu, Y.; Li, H.; Wang, Y.; Pan, X.; Tang, T.; Liu, Z.; Li, X. Lateral flow strip for visual detection of K-ras mutations based on allele-specific PCR. Biotechnol. Lett. 2016, 38, 1709–1714. [Google Scholar] [CrossRef] [PubMed]
- Abd El Kader, Y.; Emera, G.; Safwat, E.; Kassem, H.A.; Kassem, N.M. The KRAS StripAssay for detection of KRAS mutation in Egyptian patients with colorectal cancer (CRC): A pilot study. J. Egypt. Natl. Canc. Inst. 2013, 25, 37–41. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Formica, V.; Lucchetti, J.; Doldo, E.; Riondino, S.; Morelli, C.; Argirò, R.; Renzi, N.; Nitti, D.; Nardecchia, A.; Dell’Aquila, E.; et al. Clinical Utility of Plasma KRAS, NRAS and BRAF Mutational Analysis with Real Time PCR in Metastatic Colorectal Cancer Patients—The Importance of Tissue/Plasma Discordant Cases. J. Clin. Med. 2021, 10, 87. [Google Scholar] [CrossRef]
- Franczak, C.; Witz, A.; Geoffroy, K.; Demange, J.; Rouyer, M.; Husson, M.; Massard, V.; Gavoille, C.; Lambert, A.; Gilson, P.; et al. Evaluation of KRAS, NRAS and BRAF mutations detection in plasma using an automated system for patients with metastatic colorectal cancer. PLoS ONE 2020, 15, e0227294. [Google Scholar] [CrossRef] [PubMed]
- Ono, Y.; Sugitani, A.; Karasaki, H.; Ogata, M.; Nozaki, R.; Sasajima, J.; Yokochi, T.; Asahara, S.; Koizumi, K.; Ando, K.; et al. An improved digital polymerase chain reaction protocol to capture low-copy KRAS mutations in plasma cell-free DNA by resolving ‘subsampling’ issues. Mol. Oncol. 2017, 11, 1448–1458. [Google Scholar] [CrossRef]
- Milosevic, D.; Mills, J.R.; Campion, M.B.; Vidal-Folch, N.; Voss, J.S.; Halling, K.C.; Highsmith, W.E.; Liu, M.C.; Kipp, B.R.; Grebe, S.K.G. Applying Standard Clinical Chemistry Assay Validation to Droplet Digital PCR Quantitative Liquid Biopsy Testing. Clin. Chem. 2018, 64, 1732–1742. [Google Scholar] [CrossRef]
- Ou, C.-Y.; Vu, T.; Grunwald, J.T.; Toledano, M.; Zimak, J.; Toosky, M.; Shen, B.; Zell, J.A.; Gratton, E.; Abram, T.J.; et al. An ultrasensitive test for profiling circulating tumor DNA using integrated comprehensive droplet digital detection. Lab Chip 2019, 19, 993–1005. [Google Scholar] [CrossRef]
- Pratt, E.D.; Cowan, R.W.; Manning, S.L.; Qiao, E.; Cameron, H.; Schradle, K.; Simeone, D.; Zhen, D.B. Multiplex Enrichment and Detection of Rare KRAS Mutations in Liquid Biopsy Samples using Digital Droplet Pre-Amplification. Anal. Chem. 2019, 91, 7516–7523. [Google Scholar] [CrossRef]
- Alcaide, M.; Cheung, M.; Bushell, K.; Arthur, S.E.; Wong, H.-L.; Karasinska, J.; Renouf, D.; Schaeffer, D.F.; McNamara, S.; du Tertre, M.C.; et al. A Novel Multiplex Droplet Digital PCR Assay to Identify and Quantify KRAS Mutations in Clinical Specimens. J. Mol. Diagn. 2019, 21, 214–227. [Google Scholar] [CrossRef]
- Michaelidou, K.; Koutoulaki, C.; Mavridis, K.; Vorrias, E.; Papadaki, M.A.; Koutsopoulos, A.V.; Mavroudis, D.; Agelaki, S. Detection of KRAS G12/G13 Mutations in Cell Free-DNA by Droplet Digital PCR, Offers Prognostic Information for Patients with Advanced Non-Small Cell Lung Cancer. Cells 2020, 9, 2514. [Google Scholar] [CrossRef]
- Yang, Z.; LaRiviere, M.J.; Ko, J.; Till, J.E.; Christensen, T.; Yee, S.S.; Black, T.A.; Tien, K.; Lin, A.; Shen, H.; et al. A multi-analyte panel consisting of extracellular vesicle miRNAs and mRNAs, cfDNA, and CA19-9 shows utility for diagnosis and staging of pancreatic adenocarcinoma. Clin. Cancer Res. 2020, 26, 3248–3528. [Google Scholar] [CrossRef]
- Decraene, C.; Silveira, A.B.; Bidard, F.-C.; Vallée, A.; Michel, M.; Melaabi, S.; Vincent-Salomon, A.; Saliou, A.; Houy, A.; Milder, M.; et al. Multiple Hotspot Mutations Scanning by Single Droplet Digital PCR. Clin. Chem. 2018, 64, 317–328. [Google Scholar] [CrossRef]
- Zmrzljak, U.P.; Košir, R.; Krivokapić, Z.; Radojković, D.; Nikolić, A. Detection of Somatic Mutations with ddPCR from Liquid Biopsy of Colorectal Cancer Patients. Genes 2021, 12, 289. [Google Scholar] [CrossRef]
- Rowlands, V.; Rutkowski, A.J.; Meuser, E.; Carr, T.H.; Harrington, E.A.; Barrett, J.C. Optimisation of robust singleplex and multiplex droplet digital PCR assays for high confidence mutation detection in circulating tumour DNA. Sci. Rep. 2019, 9, 12620. [Google Scholar] [CrossRef]
- Li, J.; Gan, S.; Blair, A.; Min, K.; Rehage, T.; Hoeppner, C.; Halait, H.; Brophy, V.H. A Highly Verified Assay for KRAS Mutation Detection in Tissue and Plasma of Lung, Colorectal, and Pancreatic Cancer. Arch. Pathol. Lab. Med. 2018, 143, 183–189. [Google Scholar] [CrossRef] [PubMed]
- Li, B.T.; Janku, F.; Jung, B.; Hou, C.; Madwani, K.; Alden, R.; Razavi, P.; Reis-Filho, J.S.; Shen, R.; Isbell, J.M.; et al. Ultra-deep next-generation sequencing of plasma cell-free DNA in patients with advanced lung cancers: Results from the Actionable Genome Consortium. Ann. Oncol. 2019, 30, 597–603. [Google Scholar] [CrossRef] [PubMed]
- Nacchio, M.; Sgariglia, R.; Gristina, V.; Pisapia, P.; Pepe, F.; De Luca, C.; Migliatico, I.; Clery, E.; Greco, L.; Vigliar, E.; et al. KRAS mutations testing in non-small cell lung cancer: The role of Liquid biopsy in the basal setting. J. Thorac. Dis. 2020, 12, 3836. [Google Scholar] [CrossRef]
- Shen, W.; Shan, B.; Liang, S.; Zhang, J.; Yu, Y.; Zhang, Y.; Wang, G.; Bai, Y.; Qian, B.; Lu, J.; et al. Hybrid Capture-based Genomic Profiling of Circulating Tumor DNA From Patients With Advanced Ovarian Cancer. Pathol. Oncol. Res. 2021, 27, 41. [Google Scholar] [CrossRef]
- Takano, S.; Fukasawa, M.; Shindo, H.; Takahashi, E.; Fukasawa, Y.; Kawakami, S.; Hayakawa, H.; Kuratomi, N.; Kadokura, M.; Maekawa, S.; et al. Digital next-generation sequencing of cell-free DNA for pancreatic cancer. JGH Open 2021, 5, 508–516. [Google Scholar] [CrossRef]
- Lee, S.-Y.; Chae, D.-K.; Lee, S.-H.; Lim, Y.; An, J.; Chae, C.H.; Kim, B.C.; Bhak, J.; Bolser, D.; Cho, D.-H. Efficient mutation screening for cervical cancers from circulating tumor DNA in blood. BMC Cancer 2020, 20, 694. [Google Scholar] [CrossRef] [PubMed]
- Tran, L.S.; Pham, H.-A.T.; Tran, V.-U.; Tran, T.-T.; Dang, A.-T.H.; Le, D.-T.; Nguyen, S.-L.; Nguyen, N.-V.; Nguyen, T.-V.; Vo, B.T.; et al. Ultra-deep massively parallel sequencing with unique molecular identifier tagging achieves comparable performance to droplet digital PCR for detection and quantification of circulating tumor DNA from lung cancer patients. PLoS ONE 2019, 14, e0226193. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, H.T.; Tran, D.H.; Ngo, Q.D.; Pham, H.-A.T.; Tran, T.-T.; Tran, V.-U.; Pham, T.-V.N.; Le, T.K.; Le, N.-A.T.; Nguyen, N.M.; et al. Evaluation of a Liquid Biopsy Protocol using Ultra-Deep Massive Parallel Sequencing for Detecting and Quantifying Circulation Tumor DNA in Colorectal Cancer Patients. Cancer Investig. 2020, 38, 85–93. [Google Scholar] [CrossRef]
- Damin, F.; Galbiati, S.; Soriani, N.; Burgio, V.; Ronzoni, M.; Ferrari, M.; Chiari, M. Analysis of KRAS, NRAS and BRAF mutational profile by combination of in-tube hybridization and universal tag-microarray in tumor tissue and plasma of colorectal cancer patients. PLoS ONE 2018, 13, e0207876. [Google Scholar] [CrossRef]
- Wang, J.; Hua, G.; Li, L.; Li, D.; Wang, F.; Wu, J.; Ye, Z.; Zhou, X.; Ye, S.; Yang, J.; et al. Upconversion nanoparticle and gold nanocage satellite assemblies for sensitive ctDNA detection in serum. Analyst 2020, 145, 5553–5562. [Google Scholar] [CrossRef]
- Kerachian, M.A.; Azghandi, M.; Javadmanesh, A.; Ghaffarzadegan, K.; Mozaffari-Jovin, S. Selective capture of plasma cell-free tumor DNA on magnetic beads: A sensitive and versatile tool for liquid biopsy. Cell. Oncol. 2020, 43, 949–956. [Google Scholar] [CrossRef]
- Wang, B.; Wu, S.; Huang, F.; Shen, M.; Jiang, H.; Yu, Y.; Yu, Q.; Yang, Y.; Zhao, Y.; Zhou, Y.; et al. Analytical and clinical validation of a novel amplicon-based NGS assay for evaluation of circulating tumor DNA in metastatic colorectal cancer patients. Clin. Chem. Lab. Med. 2019, 57, 1501–1510. [Google Scholar] [CrossRef]
- Arnold, L.; Alexiadis, V.; Watanaskul, T.; Zarrabi, V.; Poole, J.; Singh, V. Clinical validation of qPCR Target SelectorTM assays using highly specific switch-blockers for rare mutation detection. J. Clin. Pathol. 2020, 73, 648–655. [Google Scholar] [CrossRef]
- Giménez-Capitán, A.; Bracht, J.; García, J.J.; Jordana-Ariza, N.; García, B.; Garzón, M.; Mayo-de-las-Casas, C.; Viteri-Ramirez, S.; Martinez-Bueno, A.; Aguilar, A.; et al. Multiplex Detection of Clinically Relevant Mutations in Liquid Biopsies of Cancer Patients Using a Hybridization-Based Platform. Clin. Chem. 2021, 67, 554–563. [Google Scholar] [CrossRef]
- Song, J.; Hegge, J.W.; Mauk, M.G.; Chen, J.; Till, J.E.; Bhagwat, N.; Azink, L.T.; Peng, J.; Sen, M.; Mays, J.; et al. Highly specific enrichment of rare nucleic acid fractions using Thermus thermophilus argonaute with applications in cancer diagnostics. Nucleic Acids Res. 2020, 48, e19. [Google Scholar] [CrossRef]
- Botezatu, I.V.; Kondratova, V.N.; Shelepov, V.P.; Mazurenko, N.N.; Tsyganova, I.V.; Susova, O.Y.; Lichtenstein, A.V. Asymmetric mutant-enriched polymerase chain reaction and quantitative DNA melting analysis of KRAS mutation in colorectal cancer. Anal. Biochem. 2020, 590, 113517. [Google Scholar] [CrossRef]
- Ruiz, C.; Huang, J.; Giardina, S.F.; Feinberg, P.B.; Mirza, A.H.; Bacolod, M.D.; Soper, S.A.; Barany, F. Single-molecule detection of cancer mutations using a novel PCR-LDR-qPCR assay. Hum. Mutat. 2020, 41, 1051–1068. [Google Scholar] [CrossRef]
- Andersen, R.F.; Jakobsen, A. Screening for circulating RAS/RAF mutations by multiplex digital PCR. Clin. Chim. Acta 2016, 458, 138–143. [Google Scholar] [CrossRef]
- Min, S.; Shin, S.; Chung, Y.-J. Detection of KRAS mutations in plasma cell-free DNA of colorectal cancer patients and comparison with cancer panel data for tissue samples of the same cancers. Genomics Inform. 2019, 17, e42. [Google Scholar] [CrossRef]
- Nakagawa, T.; Tanaka, J.; Harada, K.; Shiratori, A.; Shimazaki, Y.; Yokoi, T.; Uematsu, C.; Kohara, Y. 10-Plex Digital Polymerase Chain Reaction with Four-Color Melting Curve Analysis for Simultaneous KRAS and BRAF Genotyping. Anal. Chem. 2020, 92, 11705–11713. [Google Scholar] [CrossRef]
- Olmedillas López, S.; García-Olmo, D.C.; García-Arranz, M.; Guadalajara, H.; Pastor, C.; García-Olmo, D. KRAS G12V Mutation Detection by Droplet Digital PCR in Circulating Cell-Free DNA of Colorectal Cancer Patients. Int. J. Mol. Sci. 2016, 17, 484. [Google Scholar] [CrossRef] [PubMed]
- Frazzi, R.; Bizzarri, V.; Albertazzi, L.; Cusenza, V.Y.; Coppolecchia, L.; Luminari, S.; Ilariucci, F. Droplet digital PCR is a sensitive tool for the detection of TP53 deletions and point mutations in chronic lymphocytic leukaemia. Br. J. Haematol. 2020, 189, e49–e52. [Google Scholar] [CrossRef] [PubMed]
Oligonucleotide | Sequence (5′ → 3′) |
---|---|
PCR Primers | |
KRAS_Forward | GCCTGCTGAAAATGACTGAATA |
KRAS_Reverse | CAAGAGACAGGTTTCTCCATCA |
Synthetic Targets | |
KRAS-Normal | CTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCACCAGCTCCAACTACCACAAG |
KRAS-G12D | CTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCATCAGCTCCAACTACCACAAG |
KRAS-G12V | CTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTACCACAAG |
KRAS-G12A | CTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCAGCAGCTCCAACTACCACAAG |
Anti-Tag Sequences | |
KRAS-NORMAL | NH2-GGATACCGCTGCACCCATCGCCAC |
KRAS-G12D | NH2-CGTTTTAAGTTCGGATGGTGACGT |
KRAS-G12V | NH2-AGCGCACTGGTGGATGCTGGACTG |
KRAS-G12A | NH2-CTTGCTGAACTTCTGACTACGACT |
Tag-PEXT Primers | |
KRAS-NORMAL | GTGGCGATGGGTGCAGCGGTATCCCCGAATTCTCTCCTTGTGGTAGTTGGAGCTGG |
KRAS-G12D | ACGTCACCATCCGAACTTAAAACGCCGAATTCTCTCCTTGTGGTAGTTGGAGCTGA |
KRAS-G12V | CAGTCCAGCATCCACCAGTCGGCTCCGAATTCTCTCCTTGTGGTAGTTGGAGCTGT |
KRAS-G12A | AGTCGTAGTCAGAAGTTCAGCAAGCCGAATTCTCTCCTTGTGGTAGTTGGAGCTGC |
Gene | Method | Fabrication Time | Analysis Time (after Amplification) | LOD | Precision (%CV) | Multiplicity | Universality | Ref. |
---|---|---|---|---|---|---|---|---|
EGFR | HPR- and DNA nanostructure-based electrochemical biosensor | overnight | >1 h | 30 pg | 1.89 | 2 | ✓ | [31] |
PIK3CA | Alkaline-phosphatase and HCR-based electrochemical biosensor | 17 h | >1.5 h | 3 pM | - | - | - | [32] |
KRAS EGFR | Electrochemical sensor | Overnight | >30 min | 1 fg/μL | - | array of 40 sensors | - | [33,34] |
PIK3CA | Electrochemical platform | >1 h | 1 h | 10 fM | 5.3 | - | - | [35] |
KRAS | Triple-helix molecular switch-based electrochemical biosensor | >4.5 h | 3 h | 2.4 aM | 5.5–7.4 | - | ✓ | [36] |
KRAS | DNA probe-functionalized electrochemical sensor | 1 h | 3.5 h | 4 copies/ng | - | - | - | [37] |
KRAS | DNA probe-functionalized electrochemical sensor | 1 h | 3.5 h | 0.58 ng/μL | - | 3 | - | [38] |
KRAS | Urchin-like gold nanocrystal-multiple graphene aerogel | >4 h | >1 h | 0.033 fM | - | - | - | [39] |
KRAS | RNase assisted SERS platform | 58 h | - | 0.3 fM | - | - | ✓ | [40] |
BRAF, NRAS | PCR/SERS sensor | >48 h | - | 10 copies | 8.8 | 3 | ✓ | [41] |
KRAS, BRAF | PCR/ SERS sensor | - | ~30 min | - | - | 3 | - | [42] |
BRAF | PCR/SERS sensor | >50 min | - | 100 input copies | 4 | 2 | - | [43] |
KRAS | Fe–Au nanoparticle-coupling/ICP-MS | - | - | 0.1 pg/mL | - | 7 | - | [44] |
KRAS | PNA probes on gold nanorods | - | 10 min | 2 ng/mL | - | - | - | [45] |
KRAS | Strip-type biosensor | 10 min | 10 min | 50 amol(10 pM) of ssDNA or <0.1% (100 pg) mutated gene | 0.5–2.8 | 4 | ✓ | This work |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kalligosfyri, P.M.; Nikou, S.; Karteri, S.; Kalofonos, H.P.; Bravou, V.; Kalogianni, D.P. Rapid Multiplex Strip Test for the Detection of Circulating Tumor DNA Mutations for Liquid Biopsy Applications. Biosensors 2022, 12, 97. https://doi.org/10.3390/bios12020097
Kalligosfyri PM, Nikou S, Karteri S, Kalofonos HP, Bravou V, Kalogianni DP. Rapid Multiplex Strip Test for the Detection of Circulating Tumor DNA Mutations for Liquid Biopsy Applications. Biosensors. 2022; 12(2):97. https://doi.org/10.3390/bios12020097
Chicago/Turabian StyleKalligosfyri, Panagiota M., Sofia Nikou, Sofia Karteri, Haralabos P. Kalofonos, Vasiliki Bravou, and Despina P. Kalogianni. 2022. "Rapid Multiplex Strip Test for the Detection of Circulating Tumor DNA Mutations for Liquid Biopsy Applications" Biosensors 12, no. 2: 97. https://doi.org/10.3390/bios12020097
APA StyleKalligosfyri, P. M., Nikou, S., Karteri, S., Kalofonos, H. P., Bravou, V., & Kalogianni, D. P. (2022). Rapid Multiplex Strip Test for the Detection of Circulating Tumor DNA Mutations for Liquid Biopsy Applications. Biosensors, 12(2), 97. https://doi.org/10.3390/bios12020097