Epidemiological Survey of Grapevine Leafroll-Associated Virus 1 and 3 in Sicily (Italy): Genetic Structure and Molecular Variability
Abstract
1. Introduction
2. Materials and Methods
2.1. Field Surveys and Sample Collection
2.2. Preliminary Screening by Serological Analysis
2.3. Total RNA Extraction
2.4. Molecular Analyses
2.5. Sequence Analyses
3. Results
3.1. GLRaV-1 and GLRaV-3 Incidence in Sicilian Vineyards
3.2. Polymerase Chain Reaction and Sequencing
3.3. Phylogenetic Analyses
3.4. Recombination Analyses
3.5. Nucleotide Diversity and Selection Pressure Analyses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Food and Agriculture Organization of the United Nations (FAO). Transforming Our World: The 2030 Agenda for Sustainable Development. Available online: http://www.fao.org/ (accessed on 8 January 2022).
- Istituto Nazionale di Statistica—ISTAT. Available online: www.dati.istat.it (accessed on 8 January 2022).
- Ministero delle Politiche Agricole, Alimentari e Forestali—Catalogo Nazionale delle Varietà di Vite. Available online: http://catalogoviti.politicheagricole.it/catalogo.php (accessed on 8 January 2022).
- Martelli, G.P. Directory of virus and virus-like diseases of the grapevine and their agents. J. Plant Pathol. 2014, 96, 1. [Google Scholar] [CrossRef]
- Mondello, V.; Lo Piccolo, S.; Conigliaro, G.; Alfonzo, A.; Torta, L.; Burruano, S. First report of Neofusiccoccum vitifusiforme and presence of other Botryosphaeriaceae species associated with Botryosphaeria dieback of grapevine in Sicily (Italy). Phytopathol. Mediterr. 2013, 52, 388–396. [Google Scholar]
- Peluso, R.; Raio, A.; Morra, F.; Zoina, A. Physiological, biochemical and molecular analyses of an Italian collection of agrobacterium tumefaciens strains. Eur. J. Plant Pathol. 2003, 109, 291–300. [Google Scholar] [CrossRef]
- EFSA Panel on Plant Health (PLH). Scientific opinion on the pest categorisation of Xylophilus ampelinus (Panagopoulos) Willems et al. EFSA J. 2014, 12, 3921. [Google Scholar]
- Fuchs, M. Grapevine viruses: A multitude of diverse species with simple but overall poorly adopted management solutions in the vineyard. J. Plant Pathol. 2020, 102, 643–653. [Google Scholar] [CrossRef]
- Davino, S.; Panno, S.; Rangel, E.A.; Davino, M.; Bellardi, M.G.; Rubio, L. Population genetics of cucumber mosaic virus infecting medicinal, aromatic and ornamental plants from northern Italy. Arch. Virol. 2012, 157, 739–745. [Google Scholar] [CrossRef]
- Davino, S.; Panno, S.; Iacono, G.; Sabatino, L.; D’Anna, F.; Iapichino, G.; Olmos, A.; Scuderi, G.; Rubio, L.; Tomassoli, L.; et al. Genetic variation and evolutionary analysis of Pepino mosaic virus in Sicily: Insights into the dispersion and epidemiology. Plant Pathol. 2017, 66, 368–375. [Google Scholar] [CrossRef]
- Panno, S.; Caruso, A.G.; Davino, S. The nucleotide sequence of a recombinant tomato yellow leaf curl virus strain frequently detected in Sicily isolated from tomato plants carrying the Ty-1 resistance gene. Arch. Virol. 2018, 163, 795–797. [Google Scholar] [CrossRef]
- Panno, S.; Caruso, A.G.; Troiano, E.; Luigi, M.; Manglli, A.; Vatrano, T.; Iacono, G.; Marchione, S.; Bertin, S.; Tomassoli, L.; et al. Emergence of tomato leaf curl New Delhi virus in Italy: Estimation of incidence and genetic diversity. Plant Pathol. 2019, 68, 601–608. [Google Scholar] [CrossRef]
- Golino, D.A.; Fuchs, M.; Sim, S.; Farrar, K.; Martelli, G.P. Improvement of grapevine planting stock through sanitary selection and pathogen elimination. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M., Eds.; Springer: Cham, Switzerland, 2017; pp. 561–579. [Google Scholar]
- Golino, D.A.; Fuchs, M.; Al Rwahnih, M.; Farrar, K.; Schmidt, A.; Martelli, G.P. Regulatory aspects of grape viruses and virus diseases: Certification, quarantine, and harmonization. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M., Eds.; Springer: Cham, Switzerland, 2017; pp. 581–598. [Google Scholar]
- Crnogorac, A.; Panno, S.; Mandić, A.; Gašpar, M.; Caruso, A.G.; Noris, E.; Davino, S.; Matić, S. Survey of five major grapevine viruses infecting Blatina and Žilavka cultivars in Bosnia and Herzegovina. PLoS ONE 2021, 16, e0245959. [Google Scholar] [CrossRef]
- Sabella, E.; Pierro, R.; Luvisi, A.; Panattoni, A.; D’Onofrio, C.; Scalabrelli, G.; Nutricati, E.; Aprile, A.; De Bellis, L.; Materazzi, A. Phylogenetic analysis of viruses in Tuscan Vitis vinifera sylvestris (Gmeli) Hegi. PLoS ONE 2018, 13, e0200875. [Google Scholar] [CrossRef]
- Naidu, R.; Rowhani, A.; Fuchs, M.; Golino, D.; Martelli, G.P. Grapevine leafroll: A complex viral disease affecting a high-value fruit crop. Plant Dis. 2014, 98, 1172–1185. [Google Scholar] [CrossRef]
- Maree, H.J.; Almeida, R.P.P.; Bester, R.; Chooi, K.M.; Cohen, D.; Dolja, V.V.; Fuchs, M.F.; Golino, D.A.; Jooste, A.E.C.; Martelli, G.P.; et al. Grapevine leafroll-associated virus 3. Front. Microbiol. 2013, 4, 82. [Google Scholar] [CrossRef]
- Centre for Agriculture and Biosciences International—CABI. Available online: https://www.cabi.org/isc/datasheet/26189#todistribution (accessed on 8 January 2022).
- Karthikeyan, G.; Alabi, O.; Naidu, R.A. Occurrence of grapevine leafroll-associated virus 1 in two ornamental grapevine cultivars in washington state. Plant Dis. 2011, 95, 613. [Google Scholar] [CrossRef]
- Jones, T.J.; Westover, F.; Nita, M. First report of grapevine leafroll-associated virus-2 and -3 in Texas Vineyards. Plant Dis. 2014, 98, 1592. [Google Scholar] [CrossRef]
- Aboughanem, N.; Sabanadzovic, S. First report of grapevine leafroll-associated virus 2 Infecting Muscadine (Vitis rotundifolia) and Summer Grape (Vitis aestivalis) in the United States. Plant Dis. 2015, 99, 163. [Google Scholar] [CrossRef]
- Zongoma, A.M.; Dangora, D.B.; Al Rwahnih, M.; Bako, S.P.; Alegbejo, M.D.; Alabi, O.J. First report of grapevine leafroll-associated virus 1 infecting grapevines (Vitis spp.) in Nigeria. Plant Dis. 2018, 102, 258. [Google Scholar] [CrossRef]
- Rasool, S.; Naz, S.; Rowhani, A.; Diaz-Lara, A.; Golino, D.A.; Farrar, K.D.; Al Rwahnih, M. Survey of grapevine pathogens in Pakistan. J. Plant Pathol. 2019, 101, 725–732. [Google Scholar] [CrossRef]
- Porotikova, E.V.; Dmitrenko, U.D.; Yurchenko, E.; Vinogradova, S.V. First report of grapevine leafroll-associated virus 2 in Russian Grapevines (Vitis vinifera). Plant Dis. 2019, 103, 164. [Google Scholar] [CrossRef]
- Habili, N.; Komínek, P.; Little, A. Grapevine leafroll-associated virus 1 as a common grapevine pathogen. Plant Viruses 2007, 1, 63–68. [Google Scholar]
- Naidu, R.A. Grapevine leafroll-associated virus 1. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Springer: Berlin/Heidelberg, Germany, 2017; pp. 127–139. [Google Scholar] [CrossRef]
- Dolja, V.V.; Kreuze, J.F.; Valkonen, J.P. Comparative and functional genomics of closteroviruses. Virus Res. 2006, 117, 38–51. [Google Scholar] [CrossRef]
- Martelli, G.P. An overview on grapevine viruses, viroids, and the diseases they cause. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Springer: Berlin/Heidelberg, Germany, 2017; pp. 31–46. [Google Scholar] [CrossRef]
- Cabaleiro, C.; Segura, A. Field Transmission of Grapevine Leafroll Associated Virus 3 (GLRaV-3) by the Mealybug Planococcus citri. Plant Dis. 1997, 81, 283–287. [Google Scholar] [CrossRef]
- Xiao, H.; Shabanian, M.; Moore, C.; Li, C.; Meng, B. Survey for major viruses in commercial Vitis vinifera wine grapes in Ontario. Virol. J. 2018, 15, 127. [Google Scholar] [CrossRef]
- Le Maguet, J.; Beuve, M.; Herrbach, E.; Lemaire, O. Transmission of six ampeloviruses and two vitiviruses to grapevine by Phenacoccus aceris. Phytopathology 2012, 102, 717–723. [Google Scholar] [CrossRef]
- Tsai, C.-W.; Rowhani, A.; Golino, D.A.; Daane, K.M.; Almeida, R.P.P. Mealybug transmission of grapevine leafroll viruses: An analysis of virus-vector specificity. Phytopathology 2010, 100, 830–834. [Google Scholar] [CrossRef]
- Sforza, R.; Boudon-Padieu, E.; Greif, C. New Mealybug species vectoring grapevine leafroll-associated viruses-1 and -3 (GLRaV-1 and -3). Eur. J. Plant Pathol. 2003, 109, 975–981. [Google Scholar] [CrossRef]
- Fortusini, A.; Scattini, G.; Prati, S.; Cinquanta, S.; Belli, G. Transmission of Grapevine leafroll virus 1 (GLRaV-1) and Grapevine virus A (GVA) by scale insects. In Proceedings of the 12th Meeting of ICVG, Lisbon, Portugal, 28 September–2 October 1997; pp. 121–122. [Google Scholar]
- Engelbrecht, D.J.; Kasdorf, G.G.F. Transmission of grapevine leafroll disease and associated closteroviruses by the vine mealybug, Planococcus ficus. Phytophylactica 1990, 22, 341–346. [Google Scholar]
- Golino, D.A.; Sim, S.; Rowhani, A. Grapevine leafroll disease can be spread by California mealybugs. Calif. Agric. 2002, 56, 196–201. [Google Scholar] [CrossRef]
- Petersen, C.L.; Charles, J.G. Transmission of grapevine leafroll-associated closteroviruses by Pseudococcus longispinus and P. calceolariae. Plant Pathol. 1997, 46, 509–515. [Google Scholar] [CrossRef]
- Belli, G.; Fortusini, A.; Casati, P.; Belli, L.; Bianco, P.A.; Prati, S. Transmission of a grapevine leafroll associated closterovirus by the scale insect Pulvinaria vitis L. Riv. Patol. Veg. 1994, 4, 105–108. [Google Scholar]
- Zorloni, A.; Prati, S.; Bianco, P.A.; Belli, G. Transmission of Grapevine virus A and Grapevine leafroll-associated virus 3 by Heliococcus bohemicus. J. Plant Pathol. 2006, 88, 325–328. [Google Scholar]
- Gottwald, T.R.; Hughes, G. A new survey method for citrus tristeza virus disease assessment. In Proceedings of the XIV International Organization of Citrus Virologists (IOCV), Sao Paulo, Brazil, 14–21 July 2000; pp. 77–87. [Google Scholar]
- Davino, S.; Panno, S.; Arrigo, M.; La Rocca, M.; Caruso, A.G.; Lo Bosco, G. Planthology: An application system for plant diseases management. Chem. Eng. Trans. 2018, 58, 619–624. [Google Scholar]
- Clark, M.F.; Adams, A.N.; Graham, F.L.; Smiley, J.; Russell, W.C.; Nairn, R. Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 1977, 34, 475–483. [Google Scholar] [CrossRef]
- Alabi, O.J.; Al Rwahnih, M.; Karthikeyan, G.; Poojari, S.; Fuchs, M.; Rowhani, A.; Naidu, R.A. Grapevine leafroll-associated virus 1 occurs as genetically diverse populations. Phytopathology 2011, 101, 1446–1456. [Google Scholar] [CrossRef][Green Version]
- Fajardo, T.V.; Dianese, É.C.; Eiras, M.; Cerqueira, D.M.; Lopes, D.B.; Ferreira, M.A.; Martins, C.R. Variability of the coat protein gene of Grapevine leafroll-associated virus 3 in Brazil. Fitopatol. Bras. 2007, 32, 335–340. [Google Scholar] [CrossRef]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
- Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: Oxford, UK, 2000; pp. 147–164. [Google Scholar]
- Efron, B.; Halloran, E.; Holmes, S. Bootstrap confidence levels for phylogenetic trees. Proc. Natl. Acad. Sci. USA 1996, 93, 7085–7090. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef]
- Jukes, T.H.; Cantor, C.R. Evolution of protein molecules. In Mammalian Protein Metabolism; Munro, H., Ed.; Academic Press: New York, NY, USA, 1969; Volume III, Chapter 24; pp. 21–132. [Google Scholar]
- Pamilo, P.; Bianchi, N.O. Evolution of the Zfx and Zfy genes: Rates and interdependence between the genes. Mol. Biol. Evol. 1993, 10, 271–281. [Google Scholar] [CrossRef]
- Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A virus classification tool based on pairwise sequence alignment and identity calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef] [PubMed]
- Davino, S.; Calari, A.; Davino, M.; Tessitori, M.; Bertaccini, A.; Bellardi, M.G. Virescence of tenweeks stock associated to phytoplasma infection in Sicily. Bull. Insectology 2007, 60, 279–280. [Google Scholar]
- Davino, S.; Willemsen, A.; Panno, S.; Davino, M.; Catara, A.; Elena, S.F.; Rubio, L. Emergence and Phylodynamics of Citrus tristeza virus in Sicily, Italy. PLoS ONE 2013, 8, e66700. [Google Scholar] [CrossRef] [PubMed]
- Panno, S.; Ferriol, I.; Rangel, E.A.; Olmos, A.; Han, C.-G.; Martinelli, F.; Rubio, L.; Davino, S. Detection and identification of Fabavirus species by one-step RT-PCR and multiplex RT-PCR. J. Virol. Methods 2014, 197, 77–82. [Google Scholar] [CrossRef]
- Panno, S.; Caruso, A.; Blanco, G.; Davino, S. First report of tomato brown rugose fruit virus infecting sweet pepper in Italy. New Dis. Rep. 2020, 41, 20. [Google Scholar] [CrossRef]
- OIV. Statistical Report on World Vitiviniculture. 2019, pp. 1–23. Available online: www.oiv.int/public/medias/6782/oiv-2019-statistical-report-on-world-vitiviniculture.pdf (accessed on 8 January 2022).
- Gouveia, P.A.O.; Santos, M.T.; Eiras-Dias, J.E.; Nolasco, G. Five phylogenetic groups identified in the coat protein gene of grapevine leafroll-associated virus 3 obtained from Portuguese grapevine varieties. Arch. Virol. 2010, 156, 413–420. [Google Scholar] [CrossRef]
- Maliogka, V.I.; Martelli, G.P.; Fuchs, M.; Katis, N.I. Control of viruses infecting grapevine. In Control of Plant Viruses, Advances in Virus Research; Elsevier: Amsterdam, The Netherlands, 2015; Volume 91, pp. 175–227. [Google Scholar]
- Ferriol, I.; Rubio, L.; Pérez-Panadés, J.; Carbonell, E.A.; Davino, S.; Belliure, B. Transmissibility of broad bean wilt virus 1by aphids: Influence of virus accumulation in plants, virus genotype and aphid species. Ann. Appl. Biol. 2013, 162, 71–79. [Google Scholar] [CrossRef]
- López-Fabuel, I.; Wetzel, T.; Bertolini, E.; Bassler, A.; Vidal, E.; Torres, L.B.; Yuste, A.; Olmos, A. Real-time multiplex RT-PCR for the simultaneous detection of the five main grapevine viruses. J. Virol. Methods 2013, 188, 21–24. [Google Scholar] [CrossRef]
- Bester, R.; Pepler, T.; Burger, J.; Maree, H. Relative quantitation goes viral: An RT-qPCR assay for a grapevine virus. J. Virol. Methods 2014, 210, 67–75. [Google Scholar] [CrossRef]
- Bruisson, S.; Lebel, S.; Walter, B.; Prevotat, L.; Seddas, S.; Schellenbaum, P. Comparative detection of a large population of grapevine viruses by TaqMan®; RT-qPCR and ELISA. J. Virol. Methods 2017, 240, 73–77. [Google Scholar] [CrossRef]
- Diaz-Lara, A.; Klaassen, V.; Stevens, K.; Sudarshana, M.R.; Rowhani, A.; Maree, H.; Chooi, K.M.; Blouin, A.G.; Habili, N.; Song, Y.; et al. Characterization of grapevine leafroll-associated virus 3 genetic variants and application towards RT-qPCR assay design. PLoS ONE 2018, 13, e0208862. [Google Scholar] [CrossRef] [PubMed]
- Panno, S.; Ruiz-Ruiz, S.; Caruso, A.G.; Alfaro-Fernández, A.; Ambrosio, M.I.F.S.; Davino, S. Real-time reverse transcription polymerase chain reaction development for rapid detection of Tomato brown rugose fruit virus and comparison with other techniques. PeerJ 2019, 7, e7928. [Google Scholar] [CrossRef]
- Song, Y.; Hanner, R.H.; Meng, B. Genome-wide screening of novel RT-qPCR reference genes for study of GLRaV-3 infection in wine grapes and refinement of an RNA isolation protocol for grape berries. Plant Methods 2021, 17, 110. [Google Scholar] [CrossRef] [PubMed]
- Walsh, H.A.; Pietersen, G. Rapid detection of Grapevine leafroll-associated virus type 3 using a reverse transcription loop-mediated amplification method. J. Virol. Methods 2013, 194, 308–316. [Google Scholar] [CrossRef] [PubMed]
- Panno, S.; Matić, S.; Tiberini, A.; Caruso, A.G.; Bella, P.; Torta, L.; Stassi, R.; Davino, A.S. Loop Mediated Isothermal Amplification: Principles and applications in plant virology. Plants 2020, 9, 461. [Google Scholar] [CrossRef]
- Čarija, M.; Radić, T.; Černi, S.; Mucalo, A.; Zdunić, G.; Vončina, D.; Jagunić, M.; Hančević, K. Prevalence of virus infections and GLRaV-3 genetic diversity in selected clones of Croatian indigenous grapevine cultivar plavac mali. Pathogens 2022, 11, 176. [Google Scholar] [CrossRef]
- Panno, S.; Caruso, A.G.; Barone, S.; Bosco, G.L.; Rangel, E.A.; Davino, S. Spread of tomato brown rugose fruit virus in sicily and evaluation of the spatiotemporal dispersion in experimental conditions. Agronomy 2020, 10, 834. [Google Scholar] [CrossRef]
- Panno, S.; Caruso, A.; Bertacca, S.; Pisciotta, A.; Lorenzo, R.; Marchione, S.; Matić, S.; Davino, S. Genetic structure and molecular variability of grapevine fanleaf virus in Sicily. Agriculture 2021, 11, 496. [Google Scholar] [CrossRef]
Cultivar | Acronym ID | No. of Samples Analyzed | No. of Vineyards Analyzed |
---|---|---|---|
Grillo | GLL | 114 | 3 |
Zibibbo | ZIB | 106 | 3 |
Perricone | PER | 74 | 2 |
Catarratto | CAT | 66 | 2 |
Nero d’Avola | NAV | 64 | 2 |
Grecanico | GRE | 64 | 2 |
Nerello Mascalese | NMA | 43 | 1 |
Carricante | CRR | 30 | 2 |
Nerello Cappuccio | NCA | 24 | 1 |
Alicante | ALI | 21 | 1 |
Moscato | MOS | 11 | 1 |
Total | 617 | 20 |
Virus | Gene | Primer Name | Sequence (5′-3′) | Position on Virus Genome | Product Size (bp) | Reference |
---|---|---|---|---|---|---|
GLRaV-1 | CP | CPF | CGCGCTTGCAGAGTTTAAGTGGTT | 6957–6980 | 734 | [44] |
CPR | TCCGTGCTGCATTGCAACTTTCTC | 7667–7690 | ||||
GLRaV-3 | CP | LR3_8504V | ATGGCATTTGAACTGAAATT | 13,269-13,288 | 942 | [45] |
LR3_9445C | CTACTTCTTTTGCAATAGTT | 14,191-14,210 |
Cultivar | No. Samples Analyzed | GLRaV-1/3 Positive Samples | Percentage (%) of GLRaV-1/3 Incidence |
---|---|---|---|
Nerello Mascalese | 43 | 23 | 53.5 |
Nero d’Avola | 64 | 33 | 51.5 |
Carricante | 30 | 15 | 50.0 |
Alicante | 21 | 9 | 42.8 |
Catarratto | 66 | 28 | 42.4 |
Grecanico | 64 | 22 | 34.4 |
Nerello Cappuccio | 24 | 6 | 25.0 |
Perricone | 74 | 12 | 16.2 |
Zibibbo | 106 | 9 | 8.5 |
Grillo | 114 | 0 | 0 |
Moscato | 11 | 0 | 0 |
Total | 617 | 157 | 25.4 |
Cultivar | No. of Samples Analyzed | No. of GLRaV-1 Positive Samples by End Point RT-PCR | Percentage (%) of GLRaV-1 Incidence | No. of GLRaV-3 Positive Samples by End Point RT-PCR | Percentage (%) of GLRaV-3 Incidence | No. of Samples with Mixed Infection | Percentage (%) Incidence of Mixed Infection |
---|---|---|---|---|---|---|---|
Grillo | 114 | 0 | 0 | 0 | 0 | 0 | 0 |
Zibibbo | 106 | 2 | 1.9 | 7 | 6.6 | 0 | 0 |
Perricone | 74 | 2 | 2.7 | 10 | 13.5 | 0 | 0 |
Catarratto | 66 | 7 | 10.6 | 26 | 39.4 | 5 | 7.6 |
Nero d’Avola | 64 | 7 | 10.9 | 29 | 45.3 | 3 | 4.7 |
Grecanico | 64 | 5 | 7.8 | 21 | 32.8 | 4 | 6.2 |
Nerello Mascalese | 43 | 5 | 11.6 | 19 | 44.2 | 1 | 2.3 |
Carricante | 30 | 4 | 13.3 | 13 | 43.3 | 2 | 6.7 |
Nerello Cappuccio | 24 | 0 | 0 | 6 | 25.0 | 0 | 0 |
Alicante | 21 | 2 | 9.5 | 7 | 33.3 | 0 | 0 |
Moscato | 11 | 0 | 0 | 0 | 0 | 0 | 0 |
Total | 617 | 33 | 5.3 | 138 | 22.3 | 15 | 2.4 |
Province | Vineyard ID | No. of Samples Collected | No. of GLRaV-1 Positive Samples | Percentage (%) of GLRaV-1 Incidence | No. of GLRaV-3 Positive Samples | Percentage (%) of GLRaV-3 Incidence |
---|---|---|---|---|---|---|
Trapani | 1T | 30 | 1 | 3.3 | 13 | 43.3 |
2T | 30 | 0 | 0 | 9 | 30.0 | |
3T | 30 | 4 | 13.3 | 0 | 0 | |
4T | 30 | 2 | 6.7 | 23 | 76.7 | |
5T | 47 | 1 | 2.1 | 1 | 2.1 | |
TOTAL | 167 | 8 | 4.8 | 46 | 27.5 | |
Agrigento | 6A | 30 | 0 | 0 | 8 | 26.7 |
7A | 30 | 0 | 0 | 11 | 36.7 | |
8A | 30 | 0 | 0 | 6 | 20.0 | |
9A | 30 | 4 | 13.3 | 1 | 3.3 | |
10A | 30 | 2 | 6.7 | 9 | 30.0 | |
TOTAL | 150 | 6 | 4 | 35 | 23.3 | |
Ragusa | 11R | 30 | 4 | 13.3 | 0 | 0 |
12R | 30 | 1 | 3.3 | 15 | 50.0 | |
13R | 30 | 0 | 0 | 12 | 40.0 | |
14R | 30 | 2 | 6.7 | 10 | 33.3 | |
15R | 30 | 5 | 16.7 | 0 | 0 | |
TOTAL | 150 | 12 | 8 | 37 | 24.7 | |
Caltanissetta | 16C | 30 | 0 | 0 | 3 | 10.0 |
17C | 30 | 4 | 13.3 | 4 | 13.3 | |
18C | 30 | 0 | 0 | 0 | 0 | |
19C | 30 | 0 | 0 | 7 | 23.3 | |
20C | 30 | 3 | 10.0 | 6 | 20.0 | |
TOTAL | 150 | 7 | 4.7 | 20 | 13.3 |
Isolate | Algorithm | Major Parent | Minor Parent | p-Value |
---|---|---|---|---|
GLRaV-1_ZIB-1 | Bootscan | GLRaV-1_NMA-1 | MG925331 | 1.13 × 10−2 |
MaxChi | GLRaV-1_NMA-1 | MG925331 | 4.11 × 10−8 | |
3Seq | MG925331 | GLRaV-1_NMA-1 | 1.03 × 10−8 | |
GLRaV-1_CRR-1 | SiScan | GLRaV-1_CAT-2 | GLRaV-1_PER-1 | 2.99 × 10−2 |
GLRaV-1_NMA-1 | MaxChi | GLRaV-1_NAV-2 | Unknown | 1.31 × 10−2 |
GLRaV-3_ALI-1 | 3Seq | GLRaV-3_CAT-5 | JX088134 | 2.30 × 10−7 |
Bootscan | MT432372 | GLRaV-3_CAT-5 | 3.46 × 10−9 | |
3Seq | ||||
SiScan | Unknown | MK988555 | 1.11 × 10−7 | |
GLRaV-3_NCA-1 | 3Seq | GLRaV-3_NAV-1 | Unknown | 2.71 × 10−6 |
GENECONV | GLRaV-3_NAV-1 | Unknown | 7.84 × 10−9 | |
RDP | GLRaV-3_NAV-1 | Unknown | 7.27 × 10−10 | |
Bootscan | GLRaV-3_CAT-3 | Unknown | 1.39 × 10−9 | |
MaxChi | GLRaV-3_ZIB-2 | Unknown | 1.01 × 10−3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Caruso, A.G.; Bertacca, S.; Ragona, A.; Matić, S.; Davino, S.; Panno, S. Epidemiological Survey of Grapevine Leafroll-Associated Virus 1 and 3 in Sicily (Italy): Genetic Structure and Molecular Variability. Agriculture 2022, 12, 647. https://doi.org/10.3390/agriculture12050647
Caruso AG, Bertacca S, Ragona A, Matić S, Davino S, Panno S. Epidemiological Survey of Grapevine Leafroll-Associated Virus 1 and 3 in Sicily (Italy): Genetic Structure and Molecular Variability. Agriculture. 2022; 12(5):647. https://doi.org/10.3390/agriculture12050647
Chicago/Turabian StyleCaruso, Andrea Giovanni, Sofia Bertacca, Arianna Ragona, Slavica Matić, Salvatore Davino, and Stefano Panno. 2022. "Epidemiological Survey of Grapevine Leafroll-Associated Virus 1 and 3 in Sicily (Italy): Genetic Structure and Molecular Variability" Agriculture 12, no. 5: 647. https://doi.org/10.3390/agriculture12050647
APA StyleCaruso, A. G., Bertacca, S., Ragona, A., Matić, S., Davino, S., & Panno, S. (2022). Epidemiological Survey of Grapevine Leafroll-Associated Virus 1 and 3 in Sicily (Italy): Genetic Structure and Molecular Variability. Agriculture, 12(5), 647. https://doi.org/10.3390/agriculture12050647