Puffing of Turmeric (Curcuma longa L.) Enhances its Anti-Inflammatory Effects by Upregulating Macrophage Oxidative Phosphorylation
Abstract
1. Introduction
2. Materials and Methods
2.1. Puffing and Extraction of Turmeric
2.2. Quantitative Analysis of Active Compounds in the Extracts
2.3. RAW 264.7 Macrophage Culture
2.4. Mitochondrial Oxidative Phosphorylation Assessment
- (1)
- Basal respiration = OCR before oligomycin—OCR after rotenone/antimycin A
- (2)
- Maximal respiration = Maximum OCR after FCCP—OCR after rotenone/antimycin A
- (3)
- ATP production = OCR before oligomycin—OCR after oligomycin
2.5. qRT-PCR Quantification of Pro-Inflammatory mRNA
2.6. Animal Study
2.7. Statistical Analysis
3. Results
3.1. Degradation of Curcuminoids in Turmeric by Puffing
3.2. Puffing of Turmeric Enhances Mitochondrial Respiration in Macrophages
3.3. Suppressed Transcription of Pro-Inflammatory mRNA by PTE
3.4. Inhibition of High-Fat Diet-Induced Weight Gain by TE and PTE
3.5. Reciprocal Regulation of Pro- and Anti-Inflammatory Markers on Bone Marrow-Derived Macrophages (BMDM) by PT
3.6. Effects of PT Diet on Obesity-Induced Dyslipidemia
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Koh, T.J.; DiPietro, L.A. Inflammation and wound healing: The role of the macrophage. Expert Rev. Mol. Med. 2011, 13, e23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, L.; Kim, J.Y. Chondroprotective effect of curcumin and lecithin complex in human chondrocytes stimulated by IL-1β via an anti-inflammatory mechanism. Food Sci. Biotechnol. 2019, 28, 547–553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liberti, M.V.; Locasale, J.W. The Warburg effect: How does it benefit cancer cells? Trends Biochem. Sci. 2016, 41, 211–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mills, E.L.; O’Neill, L.A. Reprogramming mitochondrial metabolism in macrophages as an anti-inflammatory signal. Eur. J. Immunol. 2016, 46, 13–21. [Google Scholar] [CrossRef] [Scilit]
- Yu, S.; Go, G.W.; Kim, W. Medium chain triglyceride (MCT) oil affects the immunophenotype via reprogramming of mitochondrial respiration in murine macrophages. Foods 2019, 8, 553. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Butler, E.B.; Tan, M. Targeting cellular metabolism to improve cancer therapeutics. Cell Death Dis. 2013, 4, e532. [Google Scholar] [CrossRef] [Scilit]
- Siddiqui, F.A.; Prakasam, G.; Chattopadhyay, S.; Rehman, A.U.; Padder, R.A.; Ansari, M.A.; Irshad, R.; Mangalhara, K.; Bamezai, R.N.K.; Husain, M.; et al. Curcumin decreases Warburg effect in cancer cells by down-regulating pyruvate kinase M2 via mTOR-HIF1α inhibition. Sci. Rep. 2018, 8, 8323. [Google Scholar] [CrossRef] [Scilit]
- Krup, V.; Prakash, L.H.; Harini, A. Pharmacological Activities of Turmeric (Curcuma longa linn): A Review. J. Homeopath. Ayurvedic Med. 2013, 2, 133. [Google Scholar] [CrossRef]
- Chainani-Wu, N. Safety and Anti-Inflammatory Activity of Curcumin: A Component of Tumeric (Curcuma longa). J. Altern. Complement. Med. 2003, 9, 161–168. [Google Scholar] [CrossRef] [Scilit]
- Anand, P.; Kunnumakkara, A.B.; Newman, R.A.; Aggarwal, B.B. Bioavailability of Curcumin: Problems and Promises. Mol. Pharm. 2007, 4, 807–818. [Google Scholar] [CrossRef] [Scilit]
- Choi, Y.; Ban, I.; Lee, H.; Baik, M.-Y.; Kim, W. Puffing as a Novel Process to Enhance the Antioxidant and Anti-Inflammatory Properties of Curcuma longa L. (Turmeric). Antioxidants 2019, 8, 506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwon, Y.; Yu, S.; Choi, G.S.; Kim, J.H.; Baik, M.; Su, S.T.; Kim, W. Puffing of Rehmannia glutinosa enhances anti-oxidant capacity and down-regulates IL-6 production in RAW 264.7 cells. Food Sci. Biotechnol. 2019, 28, 1235–1240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.-J.; Lee, J.-E.; Lim, S.-M.; Kim, Y.-J.; Lee, N.-K.; Paik, H.-D. Antioxidant and immune-enhancing effects of probiotic Lactobacillus plantarum 200655 isolated from kimchi. Food Sci. Biotechnol. 2019, 28, 491–499. [Google Scholar] [CrossRef] [Scilit]
- Yayeh, T.; Oh, W.J.; Park, S.-C.; Kim, T.-H.; Cho, J.Y.; Park, H.-J.; Lee, I.-K.; Kim, S.-K.; Hong, S.-B.; Yun, B.-S.; et al. Phellinus baumii ethyl acetate extract inhibits lipopolysaccharide-induced iNOS, COX-2, and proinflammatory cytokine expression in RAW264.7 cells. J. Nat. Med. 2012, 66, 49–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiou, W.-F.; Chen, C.-F.; Lin, J.-J. Mechanisms of suppression of inducible nitric oxide synthase (iNOS) expression in RAW 264.7 cells by andrographolide. Br. J. Pharmacol. 2000, 129, 1553–1560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.H.; Soyoola, E.; Chanmugam, P.; Hart, S.; Sun, W.; Zhong, H.; Liou, S.; Simmons, D.; Hwang, D. Selective expression of mitogen-inducible cyclooxygenase in macrophages stimulated with lipopolysaccharide. J. Biol. Chem. 1992, 267, 25934–25938. [Google Scholar] [PubMed]
- Ono, Y.; Nagai, M.; Yoshino, O.; Koga, K.; Nawaz, A.; Hatta, H.; Nishizono, H.; Izumi, G.; Nakashima, A.; Imura, J.; et al. CD11c+ M1-like macrophages (MΦs) but not CD206+ M2-like MΦ are involved in folliculogenesis in mice ovary. Sci. Rep. 2018, 8, 8171. [Google Scholar] [CrossRef] [Scilit]
- Assunção, M.L.; Ferreira, H.S.; dos Santos, A.F.; Cabral, C.R.; Florêncio, T.M.M.T. Effects of Dietary Coconut Oil on the Biochemical and Anthropometric Profiles of Women Presenting Abdominal Obesity. Lipids 2009, 44, 593–601. [Google Scholar] [CrossRef] [Scilit]
- Maheshwari, R.K.; Singh, A.K.; Gaddipati, J.; Srimal, R.C. Multiple biological activities of curcumin: A short review. Life Sci. 2006, 78, 2081–2087. [Google Scholar] [CrossRef] [Scilit]
- Nelson, K.M.; Dahlin, J.L.; Bisson, J.; Graham, J.; Pauli, G.F.; Walters, M.A. The Essential Medicinal Chemistry of Curcumin. J. Med. Chem. 2017, 60, 1620–1637. [Google Scholar] [CrossRef] [Scilit]
- Cui, J.; Yu, B.; Zhao, Y.; Zhu, W.; Li, H.; Lou, H.; Zhai, G. Enhancement of oral absorption of curcumin by self-microemulsifying drug delivery systems. Int. J. Pharm. 2009, 371, 148–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tiwari, S.K.; Agarwal, S.; Seth, B.; Yadav, A.; Nair, S.; Bhatnagar, P.; Karmakar, M.; Kumari, M.; Chauhan, L.K.S.; Patel, D.K.; et al. Curcumin-Loaded Nanoparticles Potently Induce Adult Neurogenesis and Reverse Cognitive Deficits in Alzheimer’s Disease Model via Canonical Wnt/β-Catenin Pathway. ACS Nano 2014, 8, 76–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sari, T.P.; Mann, B.; Kumar, R.; Singh, R.R.B.; Sharma, R.; Bhardwaj, M.; Athira, S. Preparation and characterization of nanoemulsion encapsulating curcumin. Food Hydrocoll. 2015, 43, 540–546. [Google Scholar] [CrossRef] [Scilit]
- Majeed, A.; Majeed, M.; Thajuddin, N.; Arumugam, S.; Ali, F.; Beede, K.; Adams, S.J.; Gnanamani, M. Bioconversion of curcumin into calebin-A by the endophytic fungus Ovatospora brasiliensis EPE-10 MTCC 25236 associated with Curcuma caesia. AMB Express 2019, 9, 79. [Google Scholar] [CrossRef] [Scilit]
- Shah, B.R.; Zhang, C.; Li, Y.; Li, B. Bioaccessibility and antioxidant activity of curcumin after encapsulated by nano and Pickering emulsion based on chitosan-tripolyphosphate nanoparticles. Food Res. Int. 2016, 89, 399–407. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.-Y.; Qian, H.; Yao, W.-R. Melanoidins produced by the Maillard reaction: Structure and biological activity. Food Chem. 2011, 128, 573–584. [Google Scholar] [CrossRef] [Scilit]
- Chao, I.-C.; Wang, C.-M.; Li, S.-P.; Lin, L.-G.; Ye, W.-C.; Zhang, Q.-W. Simultaneous Quantification of Three Curcuminoids and Three Volatile Components of Curcuma longa Using Pressurized Liquid Extraction and High-Performance Liquid Chromatography. Molecules 2018, 23, 1568. [Google Scholar] [CrossRef] [Scilit]
- Esatbeyoglu, T.; Ulbrich, K.; Rehberg, C.; Rohn, S.; Rimbach, G. Thermal Stability, Antioxidant, and Anti-inflammatory Activity of Curcumin and its Degradation Product 4-vinyl guaiacol. Food Funct. 2015, 6, 887–893. [Google Scholar] [CrossRef] [Scilit]
- Shen, L.; Liu, C.-C.; An, C.-Y.; Ji, H.-F. How does curcumin work with poor bioavailability? Clues from experimental and theoretical studies. Sci. Rep. 2016, 6, 20872. [Google Scholar] [CrossRef] [Scilit]
- Shen, L.; Ji, H.F. Contribution of degradation products to the anticancer activity of curcumin. Clin. Cancer Res. 2009, 15, 7108. [Google Scholar] [CrossRef] [Scilit]
- Kim, W.; Kim, S.-Y.; Kim, D.-O.; Kim, B.; Baik, M.-Y. Puffing, a Novel Coffee Bean Processing Technique for the Enhancement of Extract Yield and Antioxidant Capacity. Food Chem. 2018, 240, 594–600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, S.H.; Ko, B.S.; Ahn, S.H.; Noh, D.O.; Suh, H.J. Comparison of the antioxidant activities of roasted and explosive puffed coffees. Int. J. Food Sci. Technol. 2017, 52, 1417–1424. [Google Scholar] [CrossRef] [Scilit]
- Zhu, L.; Zhao, Q.; Yang, T.; Ding, W.; Zhao, Y. Cellular metabolism and macrophage functional polarization. Int. Rev. Immunol. 2015, 34, 82–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujiwara, N.; Kobayashi, K. Macrophages in Inflammation. Curr. Drug Target Inflamm. Allergy 2005, 4, 281–286. [Google Scholar] [CrossRef] [Scilit]
- Galván-Peña, S.; O’Neill, L.A.J. Metabolic reprograming in macrophage polarization. Front. Immunol. 2014, 5, 420. [Google Scholar] [CrossRef] [Scilit]
- Batista-Gonzalez, A.; Vidal, R.; Criollo, A.; Carreño, L.J. New Insights on the Role of Lipid Metabolism in the Metabolic Reprogramming of Macrophages. Front. Immunol. 2020, 10, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Iuso, A.; Repp, B.; Biagosch, C.; Terrile, C.; Prokisch, H. Assessing Mitochondrial Bioenergetics in Isolated Mitochondria from Various Mouse Tissues Using Seahorse XF96 Analyzer. In Methods in Molecular Biology; Humana Press: New York, NY, USA, 2017; pp. 217–230. [Google Scholar]
- Moraes, J.C.; Coope, A.; Morari, J.; Cintra, D.E.; Roman, E.A.; Pauli, J.R.; Romanatto, T.; Carvalheira, J.B.; Oliveira, A.L.R.; Saad, M.J.; et al. High-Fat Diet Induces Apoptosis of Hypothalamic Neurons. PLoS ONE 2009, 4, e5045. [Google Scholar] [CrossRef] [Scilit]
- Murray, P.J.; Allen, J.E.; Biswas, S.K.; Fisher, E.A.; Gilroy, D.W.; Goerdt, S.; Gordon, S.; Hamilton, J.A.; Ivashkiv, L.B.; Lawrence, T.; et al. Macrophage Activation and Polarization: Nomenclature and Experimental Guidelines. Immunity 2014, 41, 14–20. [Google Scholar] [CrossRef] [Scilit]
- Esteve, E.; Ricart, W.; Fernández-Real, J.M. Dyslipidemia and inflammation: An evolutionary conserved mechanism. Clin. Nutr. 2005, 24, 16–31. [Google Scholar] [CrossRef] [Scilit]
- Oh, I.; Baek, E.J.; Lee, D.-H.; Choi, Y.H.; Bae, I.Y. Anti-obesity and anti-inflammatory effects of ginseng vinegar in high-fat diet fed mice. Food Sci. Biotechnol. 2019, 28, 1829–1836. [Google Scholar] [CrossRef] [Scilit]
- Al Amir, I.; Dubayle, D.; Héron, A.; Delayre-Orthez, C.; Anton, P.M. Maillard reaction products from highly heated food prevent mast cell number increase and inflammation in a mouse model of colitis. Nutr. Res. 2017, 48, 26–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| mRNA | Sequence (5′ → 3′) | References | |
|---|---|---|---|
| interleukin-6 | Forward | GTACTCCAGAAGACCAGAGG | [13] |
| Reverse | TGCTGGTGACAACCACGGCC | ||
| tumor necrosis factor- α | Forward | CCTGTAGCCCACGTCGTAGC | [13] |
| Reverse | CTCAGCACCCACCCGCTCA | ||
| cyclooxygenase-2 | Forward | TCTCAGCACCCACCCGCTCA | [14] |
| Reverse | TTTGACCTCAGCGCTGAGTTG | ||
| inducible nitric oxide synthase | Forward | CCCTTCCGAAGTTTCTGGCAGCAGC | [15] |
| Reverse | GGCTGTCAGAGCCTCGTGGCTTTGG | ||
| glyceraldehyde-3-phosphate dehydrogenase | Forward | CACTCACGGCAAATTCAACGGC | [11] |
| Reverse | CCTTGGCAGCACCAGTGGATGCAGG | ||
| Ingredients | Composition (g/kg) | |||
|---|---|---|---|---|
| AIN-76A (1) | HFD | HFD + T | HFD + PT | |
| Casein | 200 | 200 | 200 | 200 |
| DL-methionine | 3 | 3 | 3 | 3 |
| Corn starch | 150 | 111 | 111 | 111 |
| Sucrose | 500 | 370 | 370 | 370 |
| Corn oil | 50 | 30 | 30 | 30 |
| Lard | - | 170 | 170 | 170 |
| Mineral mix S10001 | 35 | 35 | 35 | 35 |
| Vitamin mix V10001 | 10 | 10 | 10 | 10 |
| Choline bitartarate | 2 | 2 | 2 | 2 |
| Cellulose | 50 | 50 | - | - |
| Turmeric | - | - | 50 | - |
| Puffed turmeric | - | - | - | 50 |
| VA (1) | VN | FA | 4VG | BDMC | DMC | CUR | |
|---|---|---|---|---|---|---|---|
| TE | 6.00 ± 1.30 | 21.49 ± 0.63 | 23.34 ± 0.19 | N/D (2) | 23.13 ± 0.61 | 91.66 ± 2.14 | 397.42 ± 3.75 |
| PTE | 9.87 ± 0.55 * | 90.65 ± 3.83 * | 5.67 ± 0.80 * | 99.57 ± 8.77 * | 10.07 ± 0.87 * | 60.86 ± 5.83 * | 300.57 ± 26.06 * |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, H.; Ban, I.; Choi, Y.; Yu, S.; Youn, S.J.; Baik, M.-Y.; Lee, H.; Kim, W. Puffing of Turmeric (Curcuma longa L.) Enhances its Anti-Inflammatory Effects by Upregulating Macrophage Oxidative Phosphorylation. Antioxidants 2020, 9, 931. https://doi.org/10.3390/antiox9100931
Kim H, Ban I, Choi Y, Yu S, Youn SJ, Baik M-Y, Lee H, Kim W. Puffing of Turmeric (Curcuma longa L.) Enhances its Anti-Inflammatory Effects by Upregulating Macrophage Oxidative Phosphorylation. Antioxidants. 2020; 9(10):931. https://doi.org/10.3390/antiox9100931
Chicago/Turabian StyleKim, Hyunsung, Insu Ban, Yohan Choi, Seungmin Yu, So Jung Youn, Moo-Yeol Baik, Hyungjae Lee, and Wooki Kim. 2020. "Puffing of Turmeric (Curcuma longa L.) Enhances its Anti-Inflammatory Effects by Upregulating Macrophage Oxidative Phosphorylation" Antioxidants 9, no. 10: 931. https://doi.org/10.3390/antiox9100931
APA StyleKim, H., Ban, I., Choi, Y., Yu, S., Youn, S. J., Baik, M.-Y., Lee, H., & Kim, W. (2020). Puffing of Turmeric (Curcuma longa L.) Enhances its Anti-Inflammatory Effects by Upregulating Macrophage Oxidative Phosphorylation. Antioxidants, 9(10), 931. https://doi.org/10.3390/antiox9100931

