Effects of Silibinin on Delaying Aging in Drosophila melanogaster
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Drosophila Strain and Culture
2.3. Lifespan Assay
2.4. Food Intake Detection
2.5. Body Weight Detection
2.6. Climbing Assay
2.7. Smurf Assay
2.8. Hydrogen Peroxide (H2O2) Challenge Assay
2.9. Intensive Paraquat Challenge Assay
2.10. Antioxidant Enzyme Activities and MDA Content
2.11. RNA-Seq
2.12. Real-Time PCR
2.13. Statistical Analyses
3. Results
3.1. SIL Supplementation Extends the Lifespan in Drosophila
3.2. Sil Fails to Affect Food Intake and Body Weight of Flies
3.3. SIL Improves the Locomotor Ability
3.4. SIL Prevents the Intestinal Barrier Dysfunction in Aged Flies
3.5. SIL Enhances the Antioxidant Capacity
3.6. SIL Inhibits Toll Signaling Pathway and Activates ER Proteins Processing-Related Pathway in Flies
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- He, S.; Sharpless, N.E. Senescence in health and disease. Cell 2017, 169, 1000–1011. [Google Scholar] [CrossRef]
- Bonomini, F.; Rodella, L.F.; Rezzani, R. Metabolic syndrome, aging and involvement of oxidative stress. Aging Dis. 2015, 6, 109–120. [Google Scholar] [CrossRef]
- Guan, X.L.; Wu, P.F.; Wang, S.; Zhang, J.J.; Shen, Z.C.; Luo, H.; Chen, H.; Long, L.H.; Chen, J.G.; Wang, F. Dimethyl sulfide protects against oxidative stress and extends lifespan via a methionine sulfoxide reductase A-dependent catalytic mechanism. Aging Cell. 2017, 16, 226–236. [Google Scholar] [CrossRef] [PubMed]
- Jones, E.; Sheng, J.; Carlson, J.; Wang, S. Aging-induced fragility of the immune system. J. Theor. Biol. 2021, 510, 110473. [Google Scholar] [CrossRef]
- Bandaranayake, T.; Shaw, A.C. Host resistance and immune aging. Clin. Geriatr. Med. 2016, 32, 415–432. [Google Scholar] [CrossRef] [PubMed]
- Pattabiraman, G.; Palasiewicz, K.; Galvin, J.P.; Ucker, D.S. Aging-associated dysregulation of homeostatic immune response termination (and not initiation). Aging Cell 2017, 16, 585–593. [Google Scholar] [CrossRef] [PubMed]
- Kovacs, E.J.; Palmer, J.L.; Fortin, C.F.; Fülöp, T., Jr.; Goldstein, D.R.; Linton, P.J. Aging and innate immunity in the mouse: Impact of intrinsic and extrinsic factors. Trends Immunol. 2009, 30, 319–324. [Google Scholar] [CrossRef] [PubMed]
- Plowden, J.; Renshaw-Hoelscher, M.; Engleman, C.; Katz, J.; Sambhara, S. Innate immunity in aging: Impact on macrophage function. Aging Cell 2004, 3, 161–167. [Google Scholar] [CrossRef]
- Badinloo, M.; Nguyen, E.; Suh, W.; Alzahrani, F.; Castellanos, J.; Klichko, V.I.; Orr, W.C.; Radyuk, S.N. Overexpression of antimicrobial peptides contributes to aging through cytotoxic effects in Drosophila tissues. Arch. Insect Biochem. Physiol. 2018, 98, e21464. [Google Scholar] [CrossRef] [PubMed]
- Lieberman, D.E.; Kistner, T.M.; Richard, D.; Lee, I.M.; Baggish, A.L. The active grandparent hypothesis: Physical activity and the evolution of extended human healthspans and lifespans. Proc. Natl. Acad. Sci. USA 2021, 118, e2107621118. [Google Scholar] [CrossRef] [PubMed]
- Spadaro, O.; Youm, Y.; Shchukina, I.; Ryu, S.; Sidorov, S.; Ravussin, A.; Nguyen, K.; Aladyeva, E.; Predeus, A.N.; Smith, S.R.; et al. Caloric restriction in humans reveals immunometabolic regulators of health span. Science 2022, 375, 671–677. [Google Scholar] [CrossRef] [PubMed]
- Singh, P.; Gollapalli, K.; Mangiola, S.; Schranner, D.; Yusuf, M.A.; Chamoli, M.; Shi, S.L.; Lopes Bastos, B.; Nair, T.; Riermeier, A.; et al. Taurine deficiency as a driver of aging. Science 2023, 380, eabn9257. [Google Scholar] [CrossRef]
- Jafari, M.; Schriner, S.E.; Kil, Y.S.; Pham, S.T.; Seo, E.K. Angelica keiskei impacts the lifespan and healthspan of Drosophila melanogaster in a sex and strain-dependent manner. Pharmaceuticals 2023, 16, 738. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Li, X.; Yang, S.; Li, Y.; Lin, X.; Xiu, M.; Li, X.; Liu, Y. Gastrodin extends the lifespan and protects against neurodegeneration in the Drosophila PINK1 model of Parkinson’s disease. Food Funct. 2021, 12, 7816–7824. [Google Scholar] [CrossRef]
- Liu, X.; Wu, L.; Tong, A.; Zhen, H.; Han, D.; Yuan, H.; Li, F.; Wang, C.; Fan, G. Anti-aging effect of Agrocybe aegerita polysaccharide through regulation of oxidative stress and gut microbiota. Foods 2022, 11, 3783. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Wang, X.; Jin, C.; Qiao, J.; Wang, C.; Jiang, L.; Yu, S.; Pan, D.; Zhao, D.; Wang, S.; et al. Total ginsenosides extend healthspan of aging Drosophila by suppressing imbalances in intestinal stem cells and microbiota. Phytomedicine 2024, 129, 155650. [Google Scholar] [CrossRef] [PubMed]
- Staats, S.; Lüersen, K.; Wagner, A.E.; Rimbach, G. Drosophila melanogaster as a versatile model organism in food and nutrition research. J. Agric. Food Chem. 2018, 66, 3737–3753. [Google Scholar] [CrossRef]
- Yamaguchi, M.; Yoshidam, H. Drosophila as a model organism. Adv. Exp. Med. Biol. 2018, 1076, 1–10. [Google Scholar] [PubMed]
- Halim, M.A.; Tan, F.H.P.; Azlan, A.; Rasyid, I.I.; Rosli, N.; Shamsuddin, S.; Azzam, G. Ageing, Drosophila melanogaster and epigenetics. Malays. J. Med. Sci. 2020, 27, 7–19. [Google Scholar] [CrossRef] [PubMed]
- Stephenson, R.; Metcalfe, N.H. Drosophila melanogaster: A fly through its history and current use. J. R. Coll. Physicians Edinb. 2013, 43, 70–75. [Google Scholar] [CrossRef]
- Jaffar, H.M.; Al-Asmari, F.; Khan, F.A.; Rahim, M.A.; Zongo, E. Silymarin: Unveiling its pharmacological spectrum and therapeutic potential in liver diseases-A comprehensive narrative review. Food Sci. Nutr. 2024, 12, 3097–3111. [Google Scholar] [CrossRef]
- Zhang, X.; Liu, M.; Wang, Z.; Wang, P.; Kong, L.; Wu, J.; Wu, W.; Ma, L.; Jiang, S.; Ren, W.; et al. A review of the botany, phytochemistry, pharmacology, synthetic biology and comprehensive utilization of Silybum marianum. Front. Pharmacol. 2024, 15, 1417655. [Google Scholar] [CrossRef] [PubMed]
- Firouzi, J.; Sotoodehnejadnematalahi, F.; Shokouhifar, A.; Rahimi, M.; Sodeifi, N.; Sahranavardfar, P.; Azimi, M.; Janzamin, E.; Safa, M.; Ebrahimi, M. Silibinin exhibits anti-tumor effects in a breast cancer stem cell model by targeting stemness and induction of differentiation and apoptosis. Bioimpacts 2022, 12, 415–429. [Google Scholar] [CrossRef] [PubMed]
- Deep, G.; Kumar, R.; Nambiar, D.K.; Jain, A.K.; Ramteke, A.M.; Serkova, N.J.; Agarwal, C.; Agarwal, R. Silibinin inhibits hypoxia-induced HIF-1α-mediated signaling, angiogenesis and lipogenesis in prostate cancer cells: In vitro evidence and in vivo functional imaging and metabolomics. Mol. Carcinog. 2017, 56, 833–848. [Google Scholar] [CrossRef]
- Yang, Z.; Pan, Q.; Zhang, D.; Chen, J.; Qiu, Y.; Chen, X.; Zheng, F.; Lin, F. Silibinin restores the sensitivity of cisplatin and taxol in A2780-resistant cell and reduces drug-induced hepatotoxicity. Cancer Manag. Res. 2019, 11, 7111–7122. [Google Scholar] [CrossRef] [PubMed]
- Boojar, M.M.A.; Golmohammad, S. Overview of Silibinin anti-tumor effects. Herb. Med. 2020, 23, 100375. [Google Scholar] [CrossRef]
- Ray, P.P.; Islam, M.A.; Islam, M.S.; Han, A.; Geng, P.; Aziz, M.A.; Mamun, A.A. A comprehensive evaluation of the therapeutic potential of silibinin: A ray of hope in cancer treatment. Front. Pharmacol. 2024, 15, 1349745. [Google Scholar] [CrossRef]
- Guo, H.; Wang, Y.; Liu, D. Silibinin ameliorats H2O2-induced cell apoptosis and oxidative stress response by activating Nrf2 signaling in trophoblast cells. Acta Histochem. 2020, 122, 151620. [Google Scholar] [CrossRef] [PubMed]
- Salomone, F.; Barbagallo, I.; Godos, J.; Lembo, V.; Currenti, W.; Cinà, D.; Avola, R.; D’Orazio, N.; Morisco, F.; Galvano, F.; et al. Silibinin restores NAD⁺ levels and induces the SIRT1/AMPK pathway in non-alcoholic fatty liver. Nutrients 2017, 9, 1086. [Google Scholar] [CrossRef]
- Yan, L.; Zhou, J.; Yuan, L.; Ye, J.; Zhao, X.; Ren, G.; Chen, H. Silibinin alleviates intestinal inflammation via inhibiting JNK signaling in Drosophila. Front. Pharmacol. 2023, 14, 1246960. [Google Scholar] [CrossRef]
- Islam, A.; Mishra, A.; Siddiqui, M.A.; Siddiquie, S. Recapitulation of evidence of phytochemical, pharmacokinetic and biomedical application of silybin. Drug Res. 2021, 71, 489–503. [Google Scholar] [CrossRef]
- Han, Y.; Guo, Y.; Cui, S.W.; Li, H.; Shan, Y.; Wang, H. Purple Sweet Potato Extract extends lifespan by activating autophagy pathway in male Drosophila melanogaster. Exp. Gerontol. 2021, 144, 111190. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, H.; Han, Y.; Pei, Y.; Guo, Y.; Cui, S.W. Purple sweet potato extract maintains intestinal homeostasis and extend lifespan through increasing autophagy in female Drosophila melanogaster. J. Food Biochem. 2021, 45, e13861. [Google Scholar] [CrossRef]
- Zhu, Y.; Cai, Q.; Zheng, X.; Liu, L.; Hua, Y.; Du, B.; Zhao, G.; Yu, J.; Zhuo, Z.; Xie, Z.; et al. Aspirin positively contributes to Drosophila intestinal homeostasis and delays aging through targeting Imd. Aging Dis. 2021, 12, 1821–1834. [Google Scholar] [CrossRef]
- Liu, X.; Feng, Y.; Zhen, H.; Zhao, L.; Wu, H.; Liu, B.; Fan, G.; Tong, A. Agrocybe aegerita polysaccharide combined with bifidobacterium lactis Bb-12 attenuates aging-related oxidative stress and restores gut microbiota. Foods 2023, 12, 4381. [Google Scholar] [CrossRef]
- Le Couteur, D.G.; Raubenheimer, D.; Solon-Biet, S.; de Cabo, R.; Simpson, S.J. Does diet influence aging? Evidence from animal studies. J. Intern. Med. 2024, 295, 400–415. [Google Scholar] [CrossRef] [PubMed]
- Dorling, J.L.; van Vliet, S.; Huffman, K.M.; Kraus, W.E.; Bhapkar, M.; Pieper, C.F.; Stewart, T.; Das, S.K.; Racette, S.B.; Roberts, S.B.; et al. Effects of caloric restriction on human physiological, psychological, and behavioral outcomes: Highlights from CALERIE phase 2. Nutr. Rev. 2021, 79, 98–113. [Google Scholar] [CrossRef]
- Zhong, L.; Yang, Z.; Tang, H.; Xu, Y.; Liu, X.; Shen, J. Differential analysis of negative geotaxis climbing trajectories in Drosophila under different conditions. Arch. Insect Biochem. Physiol. 2022, 111, e21922. [Google Scholar] [CrossRef] [PubMed]
- Salazar, A.M.; Aparicio, R.; Clark, R.I.; Rera, M.; Walker, D.W. Intestinal barrier dysfunction: An evolutionarily conserved hallmark of aging. Dis. Model. Mech. 2023, 16, dmm049969. [Google Scholar] [CrossRef]
- Zhang, G.; Gu, Y.; Dai, X. Protective effect of bilberry anthocyanin extracts on dextran sulfate sodium-induced intestinal damage in Drosophila melanogaster. Nutrients 2022, 14, 2875. [Google Scholar] [CrossRef]
- Wei, J.J.; Li, X.J.; Liu, W.; Chai, X.J.; Zhu, X.Y.; Sun, P.H.; Liu, F.; Zhao, Y.K.; Huang, J.L.; Liu, Y.F.; et al. Eucommia polysaccharides ameliorate aging-associated gut dysbiosis: A potential mechanism for life extension in Drosophila. Int. J. Mol. Sci. 2023, 24, 5881. [Google Scholar] [CrossRef]
- Yang, K.; Li, Q.; Zhang, G.; Ma, C.; Dai, X. The Protective effects of carrageenan oligosaccharides on intestinal oxidative stress damage of female Drosophila melanogaster. Antioxidants 2021, 10, 1996. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Li, Y.M.; Lei, L.; Liu, Y.; Wang, X.; Ma, K.Y.; Chen, Z.Y. Cranberry anthocyanin extract prolongs lifespan of fruit flies. Exp. Gerontol. 2015, 69, 189–195. [Google Scholar] [CrossRef]
- Zhao, Q.; Liu, Y.; Zhang, S.; Zhao, Y.; Wang, C.; Li, K.; Jin, Z.; Qiao, J.; Liu, M. Studies on the regulation and molecular mechanism of Panax ginseng saponins on senescence and related behaviors of Drosophila melanogaster. Front. Aging Neurosci. 2022, 14, 870326. [Google Scholar] [CrossRef]
- Salazar, G.J.T.; Ecker, A.; Adefegha, S.A.; da Costa, J.G.M. Advances in evaluation of antioxidant and toxicological properties of Stryphnodendron rotundifolium Mart. in Drosophila melanogaster model. Foods 2022, 11, 2236. [Google Scholar] [CrossRef] [PubMed]
- la Torre, A.; Lo Vecchio, F.; Greco, A. Epigenetic mechanisms of aging and aging-associated diseases. Cells 2023, 12, 1163. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; Liu, X.; Luo, X.; Lou, X.; Li, P.; Li, X.; Liu, X. Antiaging effects of dietary supplements and natural products. Front. Pharmacol. 2023, 14, 1192714. [Google Scholar] [CrossRef]
- Wongchum, N.; Dechakhamphu, A. Xanthohumol prolongs lifespan and decreases stress-induced mortality in Drosophila melanogaster. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021, 244, 108994. [Google Scholar] [CrossRef]
- Barouki, R. Stress oxydant et vieillissement [Ageing free radicals and cellular stress]. Med. Sci. 2006, 22, 266–272. [Google Scholar]
- El Assar, M.; Angulo, J.; Rodríguez-Mañas, L. Frailty as a phenotypic manifestation of underlying oxidative stress. Free. Radic. Biol. Med. 2020, 149, 72–77. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Cai, H.F.; Tao, Z.; Yuan, C.; Jiang, Z.J.; Liu, J.Y.; Kurihara, H.; Xu, W.D. Ganoderma lucidum spore oil (GLSO), a novel antioxidant, extends the average life span in Drosophila melanogaster. Food Sci. Hum. Wellness 2021, 10, 38–44. [Google Scholar] [CrossRef]
- Deepashree, S.; Shivanandappa, T.; Ramesh, S.R. Genetic repression of the antioxidant enzymes reduces the lifespan in Drosophila melanogaster. J. Comp. Physiol. B 2022, 192, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Kumar, J.; Park, K.C.; Awasthi, A.; Prasad, B. Silymarin extends lifespan and reduces proteotoxicity in C. elegans Alzheimer’s model. CNS Neurol. Disord. Drug Targets 2015, 14, 295–302. [Google Scholar] [CrossRef] [PubMed]
- Peng, C.; Chan, H.Y.; Huang, Y.; Yu, H.; Chen, Z.Y. Apple polyphenols extend the mean lifespan of Drosophila melanogaster. J. Agric. Food Chem. 2011, 59, 2097–2106. [Google Scholar] [CrossRef]
- Liu, B.; Liu, W.; Liu, P.; Liu, X.; Song, X.; Hayashi, T.; Onodera, S.; Ikejima, T. Silibinin alleviates the learning and memory defects in overtrained rats accompanying reduced neuronal apoptosis and senescence. Neurochem. Res. 2019, 44, 1818–1829. [Google Scholar] [CrossRef]
- Taylor, R.C.; Hetz, C. Mastering organismal aging through the endoplasmic reticulum proteostasis network. Aging Cell 2020, 19, e13265. [Google Scholar] [CrossRef]
- Garschall, K.; Flatt, T. The interplay between immunity and aging in Drosophila. F1000Res. 2018, 7, 160. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Tang, J.; Tang, M.; Luo, S.; Zhou, X. Reactive oxygen species are regulated by immune deficiency and Toll pathways in determining the host specificity of honeybee gut bacteria. Proc. Natl. Acad. Sci. USA 2023, 120, e2219634120. [Google Scholar] [CrossRef] [PubMed]
Ingredients | Proportions |
---|---|
Corn powder | 75.0 g/L |
Sucrose | 30.0 g/L |
Yeast | 25.0 g/L |
Agar | 10.0 g/L |
Methylparaben | 1.5 g/L |
Propionic acid | 2 mL/L |
Gene Name | Forward Primer | Reverse Primer | Gene Accession Number |
---|---|---|---|
IM2 | AGTCGTCACCGTCTTTGTGTT | CAGTATTTGCAGTCCCCGTTG | NM_166277.3 |
IM3 | TCACTCGCCTTCGTTTTGGG | TTAGGCCCTCACATTGCAGAC | NM_001299640.1 |
Drsl3 | GTTTTGGCACGTGATTGCCT | TCCACTGACATGTCCCTCCT | NM_168020.3 |
CG7556 | GAGACCAACTGGACGCAAGA | GGCACTCCTCCTTGGTCTTC | NM_001298498.1 |
GCS1 | ACTTCGGCATGAAGACCAGG | TCTTGAACGCCAAAACTGCG | NM_132479.3 |
TRAM | TGGCCATTAAACCGGGACTC | GACGTTGTGGTGCAGGGATA | NM_166867.2 |
rp49 | CCAGTCGGATCGATATGCTA | GTTGTGCACCAGGAACTTCT | NM_170460.2 |
Mean (±SEM, d) | Maximum (d) | Median (d) | |
---|---|---|---|
Control | 39.71 ± 1.09 | 64 | 40 |
Low | 40.92 ± 1.11 | 64 | 43 |
Medium | 46.19 ± 1.02 a | 67 | 46 |
High | 40.21 ± 1.29 | 67 | 40 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, K.; Ni, H.; Hafeez, E.; Hu, Y.; Hu, F.; Du, D.; Chen, D. Effects of Silibinin on Delaying Aging in Drosophila melanogaster. Antioxidants 2025, 14, 147. https://doi.org/10.3390/antiox14020147
Zhu K, Ni H, Hafeez E, Hu Y, Hu F, Du D, Chen D. Effects of Silibinin on Delaying Aging in Drosophila melanogaster. Antioxidants. 2025; 14(2):147. https://doi.org/10.3390/antiox14020147
Chicago/Turabian StyleZhu, Kai, Hang Ni, Eqra Hafeez, Yaxuan Hu, Fan Hu, Dongsheng Du, and Dongsheng Chen. 2025. "Effects of Silibinin on Delaying Aging in Drosophila melanogaster" Antioxidants 14, no. 2: 147. https://doi.org/10.3390/antiox14020147
APA StyleZhu, K., Ni, H., Hafeez, E., Hu, Y., Hu, F., Du, D., & Chen, D. (2025). Effects of Silibinin on Delaying Aging in Drosophila melanogaster. Antioxidants, 14(2), 147. https://doi.org/10.3390/antiox14020147