Chemical Profile and Promising Applications of Cucurbita pepo L. Flowers
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Sampling
2.3. Cucurbita pepo L. Flowers Extract Preparation
2.4. UHPLC and Orbitrap HRMS Analysis
2.5. Carotenoid Extraction and Determination
2.6. Total Phenolic Content
2.7. Antioxidant Activity
2.7.1. DPPH Assay
2.7.2. ABTS Assay
2.7.3. FRAP Assay
2.8. Cell Culture
2.8.1. Cell Treatments
2.8.2. Intracellular ROS Detection
2.8.3. UVB Irradiation
2.8.4. Analysis of Cell Viability
2.8.5. Real-Time PCR Analysis
2.9. Clinical Trial
2.9.1. Inclusion Conditions
2.9.2. Test Samples
2.9.3. Instructions of Use
2.9.4. Skin Condition Analysis
2.10. Statistical Analysis
3. Results
3.1. Identification of Polyphenolic Compounds in Cucurbita pepo L. Flower
3.2. Quantification of Polyphenolic Compounds in Cucurbita pepo L. Flowers
3.3. Quantification of Carotenoids in Cucurbita pepo L. Flowers
3.4. Antioxidant Capacity and Total Phenolic Content in Cucurbita pepo L. Flowers
3.5. Intracellular ROS Levels in HaCaT Cells
3.6. Protective Effects of CpL Flower Extract on UVB-Induced Cell Damage
3.7. Effect of CpLfe on Aquaporin-3 (AQP-3) and Ceramide Synthase (CerS2, CerS4, and CerS6) Expression Levels
3.8. Physicochemical Characterization of Formulations
3.9. Skin Wellness Assessment
3.10. Skin Youth Evaluation
3.11. Skin Lightening Activity Assessment
4. Discussion
4.1. Bioactive Compounds in CpL Flowers and Their Potential for Skin Health
4.2. Research Limitations and Strengths
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rop, O.; Mlcek, J.; Jurikova, T.; Neugebauerova, J.; Vabkova, J. Edible Flowers—A New Promising Source of Mineral Elements in Human Nutrition. Molecules 2012, 17, 6672–6683. [Google Scholar] [CrossRef] [PubMed]
- Pires, T.C.S.P.; Barros, L.; Santos-Buelga, C.; Ferreira, I.C.F.R. Edible Flowers: Emerging Components in the Diet. Trends Food Sci. Technol. 2019, 93, 244–258. [Google Scholar] [CrossRef]
- Rolnik, A.; Olas, B. Vegetables from the Cucurbitaceae Family and Their Products: Positive Effect on Human Health. Nutrition 2020, 78, 110788. [Google Scholar] [CrossRef] [PubMed]
- Morittu, V.M.; Mastellone, V.; Tundis, R.; Loizzo, M.R.; Tudisco, R.; Figoli, A.; Cassano, A.; Musco, N.; Britti, D.; Infascelli, F.; et al. Antioxidant, Biochemical, and in-Life Effects of Punica granatum L. Natural Juice vs. Clarified Juice by Polyvinylidene Fluoride Membrane. Foods 2020, 9, 242. [Google Scholar] [CrossRef] [PubMed]
- Dimitrios, B. Sources of Natural Phenolic Antioxidants. Trends Food Sci. Technol. 2006, 17, 505–512. [Google Scholar] [CrossRef]
- Pavelková, P.; Krmela, A.; Schulzová, V. Determination of Carotenoids in Flowers and Food Supplements by HPLC-DAD. Acta Chim. Slovaca 2020, 13, 6–12. [Google Scholar] [CrossRef]
- Castaldo, L.; Izzo, L.; Lombardi, S.; Gaspari, A.; De Pascale, S.; Grosso, M.; Ritieni, A. Analysis of Polyphenolic Compounds in Water-Based Extracts of Vicia faba L.: A Potential Innovative Source of Nutraceutical Ingredients. Antioxidants 2022, 11, 2453. [Google Scholar] [CrossRef]
- Dini, I.; Di Lorenzo, R.; Senatore, A.; Coppola, D.; Laneri, S. Validation of Rapid Enzymatic Quantification of Acetic Acid in Vinegar on Automated Spectrophotometric System. Foods 2020, 9, 761. [Google Scholar] [CrossRef]
- Castaldo, L.; Lombardi, S.; Gaspari, A.; Rubino, M.; Izzo, L.; Narváez, A.; Ritieni, A.; Grosso, M. In Vitro Bioaccessibility and Antioxidant Activity of Polyphenolic Compounds from Spent Coffee Grounds-Enriched Cookies. Foods 2021, 10, 1837. [Google Scholar] [CrossRef]
- Schiano, E.; Piccolo, V.; Novellino, E.; Maisto, M.; Iannuzzo, F.; Summa, V.; Tenore, G.C. Thinned Nectarines, an Agro-Food Waste with Antidiabetic Potential: HPLC-HESI-MS/MS Phenolic Characterization and In Vitro Evaluation of Their Beneficial Activities. Foods 2022, 11, 1010. [Google Scholar] [CrossRef]
- Maisto, M.; Piccolo, V.; Novellino, E.; Schiano, E.; Iannuzzo, F.; Ciampaglia, R.; Summa, V.; Tenore, G.C. Optimization of Phlorizin Extraction from Annurca Apple Tree Leaves Using Response Surface Methodology. Antioxidants 2022, 11, 1933. [Google Scholar] [CrossRef] [PubMed]
- Riccio, G.; Maisto, M.; Bottone, S.; Badolati, N.; Rossi, G.B.; Tenore, G.C.; Stornaiuolo, M.; Novellino, E. WNT Inhibitory Activity of Malus Pumila Miller Cv Annurca and Malus domestica Cv Limoncella Apple Extracts on Human Colon-Rectal Cells Carrying Familial Adenomatous Polyposis Mutations. Nutrients 2017, 9, 1262. [Google Scholar] [CrossRef] [PubMed]
- Maisto, M.; Schiano, E.; Novellino, E.; Piccolo, V.; Iannuzzo, F.; Salviati, E.; Summa, V.; Annunziata, G.; Tenore, G.C. Application of a Rapid and Simple Technological Process to Increase Levels and Bioccessibility of Free Phenolic Compounds in Annurca Apple Nutraceutical Product. Foods 2022, 11, 1453. [Google Scholar] [CrossRef]
- Zillich, O.V.; Schweiggert-Weisz, U.; Eisner, P.; Kerscher, M. Polyphenols as Active Ingredients for Cosmetic Products. Int. J. Cosmet. Sci. 2015, 37, 455–464. [Google Scholar] [CrossRef] [PubMed]
- Ratz-Yko, A.; Arct, J.; Majewski, S.; Pytkowska, K. Influence of Polyphenols on the Physiological Processes in the Skin. Phytother. Res. 2015, 29, 509–517. [Google Scholar] [CrossRef] [PubMed]
- Aceto, G.; Di Muzio, L.; Di Lorenzo, R.; Laneri, S.; Cairone, F.; Cesa, S.; Petralito, S.; Paolicelli, P.; Casadei, M.A. Dual Delivery of Ginger Oil and Hexylresorcinol with Lipid Nanoparticles for the Effective Treatment of Cutaneous Hyperpigmentation. J. Drug Deliv. Sci. Technol. 2023, 87, 104790. [Google Scholar] [CrossRef]
- Farhan, M. The Promising Role of Polyphenols in Skin Disorders. Molecules 2024, 29, 865. [Google Scholar] [CrossRef]
- Chen, Q.; Xu, B.; Huang, W.; Amrouche, A.T.; Maurizio, B.; Simal-Gandara, J.; Tundis, R.; Xiao, J.; Zou, L.; Lu, B. Edible Flowers as Functional Raw Materials: A Review on Anti-Aging Properties. Trends Food Sci. Technol. 2020, 106, 30–47. [Google Scholar] [CrossRef]
- Charles Dorni, A.I.; Amalraj, A.; Gopi, S.; Varma, K.; Anjana, S.N. Novel Cosmeceuticals from Plants—An Industry Guided Review. J. Appl. Res. Med. Aromat. Plants 2017, 7, 1–26. [Google Scholar] [CrossRef]
- Si, Y.X.; Wang, Z.J.; Park, D.; Jeong, H.O.; Ye, S.; Chung, H.Y.; Yang, J.M.; Yin, S.J.; Qian, G.Y. Effects of Isorhamnetin on Tyrosinase: Inhibition Kinetics and Computational Simulation. Biosci. Biotechnol. Biochem. 2012, 76, 1091–1097. [Google Scholar] [CrossRef]
- Nascimento, L.B.D.S.; Gori, A.; Raffaelli, A.; Ferrini, F.; Brunetti, C. Phenolic Compounds from Leaves and Flowers of Hibiscus Roseus: Potential Skin Cosmetic Applications of an Under-investigated Species. Plants 2021, 10, 522. [Google Scholar] [CrossRef] [PubMed]
- Di Lorenzo, R.; Falanga, D.; Ricci, L.; Colantuono, A.; Greco, G.; Angelillo, M.; Nugnes, F.; Di Serio, T.; Costa, D.; Tito, A.; et al. NAD-Driven Sirtuin Activation by Cordyceps Sinensis Extract: Exploring the Adaptogenic Potential to Promote Skin Longevity. Int. J. Mol. Sci. 2024, 25, 4282. [Google Scholar] [CrossRef] [PubMed]
- Milc, J.; Caffagni, A.; Ronga, D.; Francia, E.; Pasquariello, M.; Laviano, L.; Mazzamurro, V.; Pecchioni, N. Evaluation of Cucurbita Pepo Germplasm for Staminate Flower Production and Adaptation to the Frozen Food Industry. Sci. Hortic. 2016, 213, 321–330. [Google Scholar] [CrossRef]
- Liu, X.; Wang, S.; Cui, L.; Zhou, H.; Liu, Y.; Meng, L.; Chen, S.; Xi, X.; Zhang, Y.; Kang, W. Flowers: Precious Food and Medicine Resources. Food Sci. Hum. Wellness 2023, 12, 1020–1052. [Google Scholar] [CrossRef]
- Menaa, F.; Menaa, A.; Tréton, J. Polyphenols against Skin Aging. Polyphen. Hum. Health Dis. 2014, 1, 819–830. [Google Scholar] [CrossRef]
- Sun, M.; Deng, Y.; Cao, X.; Xiao, L.; Ding, Q.; Luo, F.; Huang, P.; Gao, Y.; Liu, M.; Zhao, H. Effects of Natural Polyphenols on Skin and Hair Health: A Review. Molecules 2022, 27, 7832. [Google Scholar] [CrossRef] [PubMed]
- Re, T.A.; Mooney, D.; Antignac, E.; Dufour, E.; Bark, I.; Srinivasan, V.; Nohynek, G. Application of the Threshold of Toxicological Concern Approach for the Safety Evaluation of Calendula Flower (Calendula officinalis) Petals and Extracts Used in Cosmetic and Personal Care Products. Food Chem. Toxicol. 2009, 47, 1246–1254. [Google Scholar] [CrossRef] [PubMed]
- Campa, M.; Baron, E. Anti-Aging Effects of Select Botanicals: Scientific Evidence and Current Trends. Cosmetics 2018, 5, 54. [Google Scholar] [CrossRef]
- Michalak, M. Plant-Derived Antioxidants: Significance in Skin Health and the Ageing Process. Int. J. Mol. Sci. 2022, 23, 585. [Google Scholar] [CrossRef]
- Greco, G.; Di Lorenzo, R.; Ricci, L.; Di Serio, T.; Vardaro, E.; Laneri, S. Clinical Studies Using Topical Melatonin. Int. J. Mol. Sci. 2024, 25, 5167. [Google Scholar] [CrossRef]
- Maldonado, E.; Morales-Pison, S.; Urbina, F.; Solari, A. Aging Hallmarks and the Role of Oxidative Stress. Antioxidants 2023, 12, 651. [Google Scholar] [CrossRef] [PubMed]
- Van Der Paal, J.; Neyts, E.C.; Verlackt, C.C.W.; Bogaerts, A. Effect of Lipid Peroxidation on Membrane Permeability of Cancer and Normal Cells Subjected to Oxidative Stress. Chem. Sci. 2016, 7, 489–498. [Google Scholar] [CrossRef]
- Birben, E.; Sahiner, U.M.; Sackesen, C.; Erzurum, S.; Kalayci, O. Oxidative Stress and Antioxidant Defense. World Allergy Organ. J. 2012, 5, 9–19. [Google Scholar] [CrossRef] [PubMed]
- Di Lorenzo, R.; Forgione, F.; Bernardi, A.; Sacchi, A.; Laneri, S.; Greco, G. Clinical Studies on Topical Curcumin. Skin Pharmacol. Physiol. 2023, 36, 235–248. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Liu, Y.; Zhao, Z.; Qiu, J. Oxidative Stress in the Skin: Impact and Related Protection. Int. J. Cosmet. Sci. 2021, 43, 495–509. [Google Scholar] [CrossRef]
- La Verde, G.; Sasso, A.; Rusciano, G.; Capaccio, A.; Fusco, S.; Mayol, L.; Biondi, M.; Silvestri, T.; Netti, P.A.; La Commara, M.; et al. Characterization of Hyaluronic Acid-Coated PLGA Nanoparticles by Surface-Enhanced Raman Spectroscopy. Int. J. Mol. Sci. 2022, 24, 601. [Google Scholar] [CrossRef]
- Masaki, H. Role of Antioxidants in the Skin: Anti-Aging Effects. J. Dermatol. Sci. 2010, 58, 85–90. [Google Scholar] [CrossRef]
- Addor, F.A.S. Antioxidants in Dermatology. An. Bras. Dermatol. 2017, 92, 356–362. [Google Scholar] [CrossRef]
- Nele, V.; D’Aria, F.; Campani, V.; Silvestri, T.; Biondi, M.; Giancola, C.; De Rosa, G. Unravelling the Role of Lipid Composition on Liposome-Protein Interactions. J. Liposome Res. 2024, 34, 88–96. [Google Scholar] [CrossRef]
- Son, Y.; Cheong, Y.-K.; Kim, N.-H.; Chung, H.-T.; Kang, D.G.; Pae, H.-O. Mitogen-Activated Protein Kinases and Reactive Oxygen Species: How Can ROS Activate MAPK Pathways? J. Signal Transduct. 2011, 2011, 792639. [Google Scholar] [CrossRef]
- Wölfle, U.; Seelinger, G.; Bauer, G.; Meinke, M.C.; Lademann, J.; Schempp, C.M. Reactive Molecule Species and Antioxidative Mechanisms in Normal Skin and Skin Aging. Skin Pharmacol. Physiol. 2014, 27, 316–332. [Google Scholar] [CrossRef] [PubMed]
- Faccio, G. Plant Complexity and Cosmetic Innovation. iScience 2020, 23, 101358. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, I.A.; Mikail, M.A.; Zamakshshari, N.H.; Mustafa, M.R.; Hashim, N.M.; Othman, R. Trends and Challenges in Phytotherapy and Phytocosmetics for Skin Aging. Saudi J. Biol. Sci. 2022, 29, 103363. [Google Scholar] [CrossRef] [PubMed]
- Tenore, G.C.; Carotenuto, A.; Caruso, D.; Buonomo, G.; D’Avino, M.; Brancaccio, D.; Ciampaglia, R.; Maisto, M.; Schisano, C.; Novellino, E. A Nutraceutical Formulation Based on Annurca Apple Polyphenolic Extract Is Effective on Intestinal Cholesterol Absorption: A Randomised, Placebo-Controlled, Crossover Study. PharmaNutrition 2018, 6, 85–94. [Google Scholar] [CrossRef]
- Sarfraz, M.; Shabbir, K.; Adnan, Q.; Khan, H.M.S.; Shirazi, J.H.; Sabir, H.; Mehmood, N.; Bin Jardan, Y.A.; Khan, K.U.; Basit, A. Fabrication, Organoleptic Evaluation and in Vitro Characterization of Cream Loaded with Carica Papaya Seed Extract. J. Cosmet. Dermatol. 2024, 23, 1045–1054. [Google Scholar] [CrossRef]
- Barbulova, A.; Colucci, G.; Apone, F. New Trends in Cosmetics: By-Products of Plant Origin and Their Potential Use as Cosmetic Active Ingredients. Cosmetics 2015, 2, 82–92. [Google Scholar] [CrossRef]
- Nizioł-Łukaszewska, Z. Extracts of Cherry and Sweet Cherry Fruit as Active Ingredients of Body Wash Formulations. Not. Bot. Horti Agrobot. Cluj Napoca 2019, 47, 100–107. [Google Scholar] [CrossRef]
- Iannuzzo, F.; Piccolo, V.; Novellino, E.; Schiano, E.; Salviati, E.; Summa, V.; Campiglia, P.; Tenore, G.C.; Maisto, M. A Food-Grade Method for Enhancing the Levels of Low Molecular Weight Proanthocyanidins with Potentially High Intestinal Bioavailability. Int. J. Mol. Sci. 2022, 23, 13557. [Google Scholar] [CrossRef] [PubMed]
- Di Lorenzo, R.; Grumetto, L.; Sacchi, A.; Laneri, S.; Dini, I. Dermocosmetic Evaluation of a Nutricosmetic Formulation Based on Curcuma. Phytother. Res. 2023, 37, 1900–1910. [Google Scholar] [CrossRef]
- López-Agama, I.; Ramos-García, M.d.L.; Zamilpa, A.; Bautista-Baños, S.; Ventura-Aguilar, R.I. Comparative Analysis of the Antioxidant Compounds of Raw Edible Flowers and Ethanolic Extracts of Cucurbita pepo, Tagetes erecta, and Erythrina americana during Storage. J. Food Process. Preserv. 2021, 45, e15842. [Google Scholar] [CrossRef]
- Dujmović, M.; Radman, S.; Opačić, N.; Uher, S.F.; Mikuličin, V.; Voća, S.; Žlabur, J. Edible Flower Species as a Promising Source of Specialized Metabolites. Plants 2022, 11, 2529. [Google Scholar] [CrossRef] [PubMed]
- Frankič, T.; Salobir, K.; Salobir, J. The Comparison of in Vivo Antigenotoxic and Antioxidative Capacity of Two Propylene Glycol Extracts of Calendula officinalis (Marigold) and Vitamin e in Young Growing Pigs. J. Anim. Physiol. Anim. Nutr. 2009, 93, 688–694. [Google Scholar] [CrossRef] [PubMed]
- Izzo, L.; Castaldo, L.; Lombardi, S.; Gaspari, A.; Grosso, M.; Ritieni, A. Bioaccessibility and Antioxidant Capacity of Bioactive Compounds From Various Typologies of Canned Tomatoes. Front. Nutr. 2022, 9, 849163. [Google Scholar] [CrossRef] [PubMed]
- Castaldo, L.; Izzo, L.; Gaspari, A.; Lombardi, S.; Rodríguez-Carrasco, Y.; Narváez, A.; Grosso, M.; Ritieni, A. Chemical Composition of Green Pea (Pisum sativum L.) Pods Extracts and Their Potential Exploitation as Ingredients in Nutraceutical Formulations. Antioxidants 2022, 11, 105. [Google Scholar] [CrossRef] [PubMed]
- Castaldo, L.; Toriello, M.; Izzo, L.; Sessa, R.; Lombardi, S.; Trombetti, S.; Rodríguez-Carrasco, Y.; Ritieni, A.; Grosso, M. Effect of Different Coffee Brews on Tryptophan Metabolite-Induced Cytotoxicity in HT-29 Human Colon Cancer Cells. Antioxidants 2022, 11, 2458. [Google Scholar] [CrossRef]
- Castaldo, L.; Toriello, M.; Sessa, R.; Izzo, L.; Lombardi, S.; Narváez, A.; Ritieni, A.; Grosso, M. Antioxidant and Anti-Inflammatory Activity of Coffee Brew Evaluated after Simulated Gastrointestinal Digestion. Nutrients 2021, 13, 4368. [Google Scholar] [CrossRef]
- Yoon, D.; Lee, M.-H.; Cha, D. Measurement of Intracellular ROS in Caenorhabditis Elegans Using 2′,7′-Dichlorodihydrofluorescein Diacetate. Bio-Protocol 2018, 8, e2774. [Google Scholar] [CrossRef]
- Bode, K.; Link, C.; Krammer, P.H.; Weyd, H. Flow-Cytometric Detection of Low-Level Reactive Oxygen Species in Cell Lines and Primary Immune Cells. Bio-Protocol 2020, 10, e3737. [Google Scholar] [CrossRef]
- Kim, G.; Han, D.W.; Lee, J.H. The Cytoprotective Effects of Baicalein on H2O2-Induced ROS by Maintaining Mitochondrial Homeostasis and Cellular Tight Junction in HaCaT Keratinocytes. Antioxidants 2023, 12, 902. [Google Scholar] [CrossRef]
- Wang, S.-H.; Chen, Y.-S.; Lai, K.-H.; Lu, C.-K.; Chang, H.-S.; Wu, H.-C.; Yen, F.-L.; Chen, L.-Y.; Lee, J.-C.; Yen, C.-H. Prinsepiae Nux Extract Activates NRF2 Activity and Protects UVB-Induced Damage in Keratinocyte. Antioxidants 2022, 11, 1755. [Google Scholar] [CrossRef]
- Park, J.; Woo, Y.-K.; Cho, H.-J. Regulation of Anti-Oxidative, Anti-Inflammatory, and Anti-Apoptotic Activity of Advanced Cooling Composition (ACC) in UVB-Irradiated Human HaCaT Keratinocytes. Int. J. Mol. Sci. 2020, 21, 6527. [Google Scholar] [CrossRef] [PubMed]
- Mahendra, C.K.; Tan, L.T.-H.; Yap, W.H.; Chan, C.K.; Pusparajah, P.; Goh, B.H. An Optimized Cosmetic Screening Assay for Ultraviolet B (UVB) Protective Property of Natural Products. Progress. Drug Discov. Biomed. Sci. 2019, 2. [Google Scholar] [CrossRef]
- Catapano, R.; Sessa, R.; Trombetti, S.; Cesaro, E.; Russo, F.; Izzo, P.; Makis, A.; Grosso, M. Identification and Functional Analysis of Known and New Mutations in the Transcription Factor KLF1 Linked with β-Thalassemia-like Phenotypes. Biology 2023, 12, 510. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.; Xiong, L.; Shu, X.; Chen, W.; Li, W.; Li, J.; Ma, L.; Xiao, Y.; Li, L. Antioxidant Effects of Bioactive Compounds Isolated from Cordyceps and Their Protective Effects against UVB-Irradiated HaCaT Cells. J. Cosmet. Dermatol. 2019, 18, 1899–1906. [Google Scholar] [CrossRef] [PubMed]
- Oh, S.; Zheng, S.; Fang, M.; Kim, M.; Bellere, A.D.; Jeong, J.; Yi, T.-H. Anti-Photoaging Effect of Phaseolus Angularis L. Extract on UVB-Exposed HaCaT Keratinocytes and Possibilities as Cosmetic Materials. Molecules 2023, 28, 1407. [Google Scholar] [CrossRef] [PubMed]
- Quan, T. Human Skin Aging and the Anti-Aging Properties of Retinol. Biomolecules 2023, 13, 1614. [Google Scholar] [CrossRef] [PubMed]
- Ding, W.; Fan, L.; Tian, Y.; He, C. Study of the Protective Effects of Cosmetic Ingredients on the Skin Barrier, Based on the Expression of Barrier-Related Genes and Cytokines. Mol. Biol. Rep. 2022, 49, 989–995. [Google Scholar] [CrossRef]
- Li, J.; Tang, H.; Hu, X.; Chen, M.; Xie, H. Aquaporin-3 Gene and Protein Expression in Sun-protected Human Skin Decreases with Skin Ageing. Australas. J. Dermatol. 2010, 51, 106–112. [Google Scholar] [CrossRef]
- Kahraman, E.; Kaykın, M.; Şahin Bektay, H.; Güngör, S. Recent Advances on Topical Application of Ceramides to Restore Barrier Function of Skin. Cosmetics 2019, 6, 52. [Google Scholar] [CrossRef]
- Larese Filon, F.; Maculan, P.; Crivellaro, M.A.; Mauro, M. Effectiveness of a Skin Care Program with a Cream Containing Ceramide C and a Personalized Training for Secondary Prevention of Hand Contact Dermatitis. Dermatitis 2023, 34, 127–134. [Google Scholar] [CrossRef]
- Michalak, M.; Pierzak, M.; Kręcisz, B.; Suliga, E. Bioactive Compounds for Skin Health: A Review. Nutrients 2021, 13, 203. [Google Scholar] [CrossRef] [PubMed]
- Gȩgotek, A.; Rybałtowska-Kawałko, P.; Skrzydlewska, E. Rutin as a Mediator of Lipid Metabolism and Cellular Signaling Pathways Interactions in Fibroblasts Altered by UVA and UVB Radiation. Oxid. Med. Cell. Longev. 2017, 2017, 4721352. [Google Scholar] [CrossRef] [PubMed]
- Tomazelli, L.C.; de Assis Ramos, M.M.; Sauce, R.; Cândido, T.M.; Sarruf, F.D.; de Oliveira Pinto, C.A.S.; de Oliveira, C.A.; Rosado, C.; Velasco, M.V.R.; Baby, A.R. SPF Enhancement Provided by Rutin in a Multifunctional Sunscreen. Int. J. Pharm. 2018, 552, 401–406. [Google Scholar] [CrossRef]
- Sebghatollahi, Z.; Ghanadian, M.; Agarwal, P.; Ghaheh, H.S.; Mahato, N.; Yogesh, R.; Hejazi, S.H. Citrus Flavonoids: Biological Activities, Implementation in Skin Health, and Topical Applications: A Review. ACS Food Sci. Technol. 2022, 2, 1417–1432. [Google Scholar] [CrossRef]
- Fiorentini, D.; Zambonin, L.; Vieceli Dalla Sega, F.; Hrelia, S. Polyphenols as Modulators of Aquaporin Family in Health and Disease. Oxid. Med. Cell. Longev. 2015, 2015, 196914. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.J.; Lee, S.-N.; Kim, K.; Joo, D.H.; Shin, S.; Lee, J.; Lee, H.K.; Kim, J.; Kwon, S.B.; Kim, M.J.; et al. Biological Effects of Rutin on Skin Aging. Int. J. Mol. Med. 2016, 38, 357–363. [Google Scholar] [CrossRef] [PubMed]
- Zulkefli, N.; Che Zahari, C.N.M.; Sayuti, N.H.; Kamarudin, A.A.; Saad, N.; Hamezah, H.S.; Bunawan, H.; Baharum, S.N.; Mediani, A.; Ahmed, Q.U.; et al. Flavonoids as Potential Wound-Healing Molecules: Emphasis on Pathways Perspective. Int. J. Mol. Sci. 2023, 24, 4607. [Google Scholar] [CrossRef]
- Magdy, I. Mohamed Optimization of Chlorphenesin Emulgel Formulation. AAPS J. 2004, 6, 81–87. [Google Scholar] [CrossRef]
- Gervasi, T.; Calderaro, A.; Barreca, D.; Tellone, E.; Trombetta, D.; Ficarra, S.; Smeriglio, A.; Mandalari, G.; Gattuso, G. Biotechnological Applications and Health-Promoting Properties of Flavonols: An Updated View. Int. J. Mol. Sci. 2022, 23, 1710. [Google Scholar] [CrossRef]
- Piccolo, M.; Ferraro, M.G.; Maione, F.; Maisto, M.; Stornaiuolo, M.; Tenore, G.C.; Santamaria, R.; Irace, C.; Novellino, E. Induction of Hair Keratins Expression by an Annurca Apple-Based Nutraceutical Formulation in Human Follicular Cells. Nutrients 2019, 11, 3041. [Google Scholar] [CrossRef]
- González, L. Efecto de Diferentes Métodos de Cocción Sobre El Contenido y Capacidad Antioxidante de La Flor de Calabaza (Cucurbita pepo L.). Doctoral Dissertation, Universidad Autónoma de Querétaro, Querétaro, México, 2018. [Google Scholar]
- Majumder, S.; Mishra, N. Edible Flowers of India as Alternate Source of High Quantity of Lycopene. Vegetos 2023, 37, 433–437. [Google Scholar] [CrossRef]
- Anunciato, T.P.; da Rocha Filho, P.A. Carotenoids and Polyphenols in Nutricosmetics, Nutraceuticals, and Cosmeceuticals. J. Cosmet. Dermatol. 2012, 11, 51–54. [Google Scholar] [CrossRef] [PubMed]
- Bin-Jumah, M.; Alwakeel, S.S.; Moga, M.; Buvnariu, L.; Bigiu, N.; Zia-Ul-Haq, M. Application of Carotenoids in Cosmetics. Carotenoids Struct. Funct. Hum. Body 2021, 747–756. [Google Scholar]
- Wal, P.; Vig, H.; Khare, R.; Wal, A.; Tondon, G.; Kishore, A.; Kumar, S. A Detailed Analysis of the Carotenoids and Their Derivatives, Including Their Multiple Health Advantages. Open Med. Chem. J. 2023, 17. [Google Scholar] [CrossRef]
- Sommonte, F.; Arduino, I.; Iacobazzi, R.M.; Laera, L.; Silvestri, T.; Lopedota, A.A.; Castegna, A.; Denora, N. Microfluidic Development of Brain-Derived Neurotrophic Factor Loaded Solid Lipid Nanoparticles: An in Vitro Evaluation in the Post-Traumatic Brain Injury Neuroinflammation Model. J. Drug Deliv. Sci. Technol. 2024, 96, 105699. [Google Scholar] [CrossRef]
- Sohail, M.; Muhammad Faran Ashraf Baig, M.; Akhtar, N.; Chen, Y.; Xie, B.; Li, B. Topical Lycopene Emulgel Significantly Improves Biophysical Parameters of Human Skin. Eur. J. Pharm. Biopharm. 2022, 180, 281–288. [Google Scholar] [CrossRef] [PubMed]
- Abir, M.H.; Mahamud, A.G.M.S.U.; Tonny, S.H.; Anu, M.S.; Hossain, K.H.S.; Protic, I.A.; Khan, M.S.U.; Baroi, A.; Moni, A.; Uddin, M.J. Pharmacological Potentials of Lycopene against Aging and Aging-Related Disorders: A Review. Food Sci. Nutr. 2023, 11, 5701–5735. [Google Scholar] [CrossRef]
- Bzioueche, H.; Tamelghaghet, M.; Chignon-Sicard, B.; Bazile, N.; Hauchecorne, P.; Barbero Calderón, M.; Meunier, P.; Rocchi, S.; Passeron, T.; Tulic, M.K. Ceramide ADTM Restores Skin Integrity and Function Following Exposure to House Dust Mite. Int. J. Mol. Sci. 2023, 24, 9234. [Google Scholar] [CrossRef]
- Kono, T.; Miyachi, Y.; Kawashima, M. Clinical Significance of the Water Retention and Barrier Function-Improving Capabilities of Ceramide-Containing Formulations: A Qualitative Review. J. Dermatol. 2021, 48, 1807–1816. [Google Scholar] [CrossRef] [PubMed]
- Vovesná, A.; Zhigunov, A.; Balouch, M.; Zbytovská, J. Ceramide Liposomes for Skin Barrier Recovery: A Novel Formulation Based on Natural Skin Lipids. Int. J. Pharm. 2021, 596, 120264. [Google Scholar] [CrossRef]
- Racaniello, G.F.; Silvestri, T.; Pistone, M.; D’Amico, V.; Arduino, I.; Denora, N.; Lopedota, A.A. Innovative Pharmaceutical Techniques for Paediatric Dosage Forms: A Systematic Review on 3D Printing, Prilling/Vibration and Microfluidic Platform. J. Pharm. Sci. 2024, 113, 1726–1748. [Google Scholar] [CrossRef] [PubMed]
- Silvestri, T.; Grumetto, L.; Neri, I.; De Falco, M.; Graziano, S.F.; Damiano, S.; Giaquinto, D.; Maruccio, L.; de Girolamo, P.; Villapiano, F.; et al. Investigating the Effect of Surface Hydrophilicity on the Destiny of PLGA-Poloxamer Nanoparticles in an In Vivo Animal Model. Int. J. Mol. Sci. 2023, 24, 14523. [Google Scholar] [CrossRef]
- Bollag, W.B.; Aitkens, L.; White, J.; Hyndman, K.A. Aquaporin-3 in the Epidermis: More than Skin Deep. Am. J. Physiol.-Cell Physiol. 2020, 318, C1144–C1153. [Google Scholar] [CrossRef] [PubMed]








| Transcript (Accession Number) | Primer | Sequence 5′-3′ | Amplicon Size (bp) |
|---|---|---|---|
| AQP3 (NM_004925.5) | For | AGATGCTCCACATCCGCTAC | 143 |
| Rev | GGTTGATGGTGAGGAAACCA | ||
| CERS2 (NM_022075.5) | For | CCGATTACCTGCTGGAGTCAG | 121 |
| Rev | GAAGGGCAGGATGACCAGTC | ||
| CERS4 (NM_024552.3) | For | CTTCGTGGCGGTCATCCTG | 77 |
| Rev | TGTAACAGCAGCACCAGAGAG | ||
| CERS6 (NM_001256126.2) | For | GGGATCTTAGCCTGGTTCTGG | 183 |
| Rev | CGCACGGTTTGGCTACAAATC | ||
| MMP-1 (NM_002421.4) | For | TGCGTGCGCACAAATCCCTTCTAC | 79 |
| Rev | TTCAAGCCCATTTGGCAGTT | ||
| GAPDH (NM_002046.7) | For | GAGCCACATCGCTCAGACAC | 116 |
| Rev | GGCAACAATATCCACTTTACCA |
| CpLfe | Placebo | ||||
|---|---|---|---|---|---|
| Phase | Ingredients (INCI) | Quantity (%) | Phase | Ingredients (INCI) | Quantity (%) |
| W | Aqua | qs to 100 | W | Aqua | qs to 100 |
| Sodium Gluconate | 0.2 | Sodium Gluconate | 0.2 | ||
| Glycerin | 3.0 | Glycerin | 3.0 | ||
| Carbomer | 0.3 | Carbomer | 0.3 | ||
| O | Sodium Polyacrylate (and) Dicaprylyl Carbonate (and) Polyglyceryl-3 Caprate | 1.5 | O | Sodium Polyacrylate (and) Dicaprylyl Carbonate (and) Polyglyceryl-3 Caprate | 1.5 |
| Caprylic/Capril Triglycerides | 5.0 | Caprylic/Capril Triglycerides | 5.0 | ||
| Coconut Alkanes (and) Coco-Caprylate Caprate | 7.0 | Coconut Alkanes (and) Coco-Caprylate Caprate | 7.0 | ||
| Octil 2-Dodecanol | 5.0 | Octil 2-Dodecanol | 5.0 | ||
| C | Phenoxyethanol and Ethylhexylglycerin | 0.9 | C | Phenoxyethanol and Ethylhexylglycerin | 0.9 |
| CpLfe 5%w/v | 0.5 | NaOH sol. 20% | 0.1 | ||
| NaOH sol. 20% | 0.1 | ||||
| Analytes | Adduct Ion | Chemical Formula | RT (min) | Theoretical Mass (m/z) | Measured Mass (m/z) | Accuracy (Δ ppm) | LOD (mg/kg) | LOQ (mg/kg) |
|---|---|---|---|---|---|---|---|---|
| Quinic acid | [M-H]− | C7H12O6 | 0.47 | 191.05531 | 191.05611 | 4.19 | 0.026 | 0.078 |
| Protocatechuic acid | [M-H]− | C7H6O4 | 2.31 | 153.01930 | 153.01857 | −4.77 | 0.013 | 0.039 |
| Clorogenic Acid | [M-H]− | C16H18O9 | 3.00 | 353.08780 | 353.08798 | 0.51 | 0.013 | 0.039 |
| Epicatechin | [M-H]− | C15H14O7 | 3.17 | 289.07176 | 289.07202 | 0.90 | 0.013 | 0.039 |
| Caffeic acid | [M-H]− | C9H8O4 | 3.23 | 179.03498 | 179.03455 | −2.40 | 0.013 | 0.039 |
| Catechin | [M-H]− | C15H14O6 | 3.34 | 289.07175 | 289.07205 | 1.04 | 0.026 | 0.078 |
| p-Coumaric acid | [M-H]− | C9H8O3 | 3.46 | 163.04001 | 163.03937 | −3.92 | 0.013 | 0.039 |
| Vitexin | [M-H]− | C21H20O10 | 3.48 | 431.09837 | 431.09711 | −2.92 | 0.013 | 0.039 |
| Apigenin-7-O-glucoside | [M-H]− | C15H10O5 | 3.49 | 269.04555 | 269.04526 | −1.08 | 0.026 | 0.078 |
| Ferulic acid | [M-H]− | C10H10O4 | 3.55 | 193.05063 | 193.05016 | −2.43 | 0.026 | 0.078 |
| Naringin | [M-H]− | C27H32O14 | 3.56 | 579.17193 | 579.17212 | 0.33 | 0.013 | 0.039 |
| Quercetin 3 galactoside | [M-H]− | C21H20O12 | 3.58 | 463.08820 | 463.08817 | −0.06 | 0.026 | 0.078 |
| Rutin | [M-H]− | C27H30O16 | 3.59 | 609.14611 | 609.14673 | 1.02 | 0.013 | 0.039 |
| Diosmin | [M-H]− | C28H31O15 | 3.64 | 607.16684 | 607.16534 | −2.47 | 0.013 | 0.039 |
| Kaempferol 3-glucoside | [M-H]− | C21H20O11 | 3.68 | 447.09195 | 447.09329 | 3.00 | 0.013 | 0.039 |
| Isorhamnetin 3-rutinoside | [M-H]− | C28H32O16 | 3.72 | 623.16176 | 623.16174 | −0.03 | 0.013 | 0.039 |
| Miricetin | [M-H]− | C14H10O8 | 3.73 | 317.03029 | 317.02924 | −3.31 | 0.013 | 0.039 |
| Daidzein | [M-H]− | C15100O4 | 3.77 | 253.05063 | 253.05035 | −1.11 | 0.026 | 0.078 |
| Quercetin | [M-H]− | C15H10O7 | 3.88 | 301.03538 | 301.03508 | −1.00 | 0.013 | 0.039 |
| Naringenin | [M-H]− | C15H12O5 | 3.91 | 271.06120 | 271.06110 | −0.37 | 0.013 | 0.039 |
| Luteolin | [M-H]− | C15H10O6 | 3.98 | 285.04046 | 285.04086 | 1.40 | 0.026 | 0.078 |
| Kaempferol | [M-H]− | C15H10O6 | 4.01 | 285.04046 | 285.04086 | 1.41 | 0.013 | 0.039 |
| Genistein | [M-H]− | C15H10O5 | 4.05 | 269.04554 | 269.04562 | 0.30 | 0.013 | 0.039 |
| Apigenin | [M-H]− | C15H10O5 | 4.08 | 269.04555 | 269.04556 | 0.04 | 0.026 | 0.078 |
| Analyte | Average (mg/kg) | ±SD |
|---|---|---|
| p-Coumaric acid | 11.68 | 0.11 |
| Naringin | <LOQ | |
| Quercetin 3-galactoside | 26.9 | 0.71 |
| Rutin | 2359.5 | 0.28 |
| Kaempferol 3-glucoside | 6.58 | 0.09 |
| Isorhamnetin 3-rutinoside | 497.8 | 2.55 |
| Myricetin | 2.78 | 0.04 |
| Quercetin | 0.52 | 0.06 |
| Kaempferol | 0.82 | 0.09 |
| Apigenin | <LOQ | |
| Sample | Lutein | β-Carotene | Lycopene | |||
|---|---|---|---|---|---|---|
| Mean | ±SD | Mean | ±SD | Mean | ±SD | |
| Cucurbita pepo L. flower | 407 | 32 | 83 | 12 | 513 | 41 |
| Sample | DPPH | ABTS | FRAP | TPC | ||||
|---|---|---|---|---|---|---|---|---|
| Mean | ±SD | Mean | ±SD | Mean | ±SD | Mean | ±SD | |
| Cucurbita pepo L. flower extract | 10.7 | 0.2 | 12.4 | 0.4 | 77.5 | 0.6 | 534.2 | 12.9 |
| Sample | pH | mPa (L4, 20 rpm) | ||
|---|---|---|---|---|
| After Preparation | After 24 h | After Preparation | After 24 h | |
| CpLfe | 5.3 | 5.5 | 21.254 | 22.156 |
| Placebo | 5.2 | 5.4 | 21.136 | 21.723 |
| Baseline (T0) Mean ± SD | Week 2 (T2w) Mean ± SD | ∆% from Baseline | Week 4 (T4w) Mean ± SD | ∆% from Baseline | ||
|---|---|---|---|---|---|---|
| CpLfe | TEWL (g/h/m2) | 6.5 ± 0.4 | 6.0 ± 0.4 | −7.5% *** | 5.8 ± 0.2 | −10.2% *** |
| Hydration (U.A.) | 65.6 ± 4.0 | 74.3 ± 1.3 | 13.7% *** | 75.2 ± 2.4 | 15.0% *** | |
| Placebo | TEWL (g/h/m2) | 6.4 ± 0.8 | 6.7 ± 0.6 | 6.4% | 6.5 ± 0.3 | 2.9% |
| Hydration (U.A.) | 55.7 ± 2.2 | 58.6 ± 1.2 | 5.3% *** | 60.5 ± 1.2 | 8.8% *** |
| Collagen Index | ||||
|---|---|---|---|---|
| CpLfe | Placebo | |||
| Timing | Average ± SD | Average ∆% vs. Baseline | Average ± SD | Average ∆% vs. Baseline |
| Baseline | 44.2 ± 1.6 | 47.2 ± 1.9 | ||
| After 2-week treatment (T2w) | 45.6 ± 0.8 | 3.4% ** | 47.8 ± 2.4 | 1.3% |
| After 4-week treatment (T4w) | 47.9 ± 0.9 | 8.5% *** | 48.3 ± 2.3 | 2.1% |
| L* | ||||
|---|---|---|---|---|
| CpLfe | Placebo | |||
| Timing | Average ± SD | Average ∆% vs. Baseline | Average ± SD | Average ∆% vs. Baseline |
| Baseline | 63.1 ± 0.7 | 62.5 ± 0.9 | ||
| After 2-week treatment (T2w) | 63.8 ± 0.8 | 1.0% ** | 62.4 ± 0.8 | 0.00% |
| After 4-week treatment (T4w) | 64.5 ± 0.7 | 2.2% *** | 62.8 ± 0.7 | 0.60% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di Lorenzo, R.; Castaldo, L.; Sessa, R.; Ricci, L.; Vardaro, E.; Izzo, L.; Grosso, M.; Ritieni, A.; Laneri, S. Chemical Profile and Promising Applications of Cucurbita pepo L. Flowers. Antioxidants 2024, 13, 1476. https://doi.org/10.3390/antiox13121476
Di Lorenzo R, Castaldo L, Sessa R, Ricci L, Vardaro E, Izzo L, Grosso M, Ritieni A, Laneri S. Chemical Profile and Promising Applications of Cucurbita pepo L. Flowers. Antioxidants. 2024; 13(12):1476. https://doi.org/10.3390/antiox13121476
Chicago/Turabian StyleDi Lorenzo, Ritamaria, Luigi Castaldo, Raffaele Sessa, Lucia Ricci, Eleonora Vardaro, Luana Izzo, Michela Grosso, Alberto Ritieni, and Sonia Laneri. 2024. "Chemical Profile and Promising Applications of Cucurbita pepo L. Flowers" Antioxidants 13, no. 12: 1476. https://doi.org/10.3390/antiox13121476
APA StyleDi Lorenzo, R., Castaldo, L., Sessa, R., Ricci, L., Vardaro, E., Izzo, L., Grosso, M., Ritieni, A., & Laneri, S. (2024). Chemical Profile and Promising Applications of Cucurbita pepo L. Flowers. Antioxidants, 13(12), 1476. https://doi.org/10.3390/antiox13121476

