Supplementation of Chlorogenic Acid Alleviates the Effects of H2O2-Induced Oxidative Stress on Laying Performance, Egg Quality, Antioxidant Capacity, Hepatic Inflammation, Mitochondrial Dysfunction, and Lipid Accumulation in Laying Hens
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Sample Collection and Measurement
2.3. Serum and Liver Antioxidant Enzyme Detection
2.4. Serum and Liver Lipid Assay
2.5. Hematoxylin and Eosin Staining
2.6. Oil Red O Staining
2.7. ROS Staining
2.8. Transmission Electron Microscope (TEM) Assay
2.9. Quantitative Real-Time PCR (qRT-PCR)
2.10. Western Blot Analysis
2.11. Statistical Analysis
3. Results
3.1. Effects of CGA on the Performance of Hens Subjected to H2O2
3.2. Effects of CGA on the Egg Quality of Hens Subjected to H2O2
3.3. Effects of CGA on the Serum Redox Status of Hens Subjected to H2O2
3.4. Effects of CGA on the Liver Redox Status of Hens Subjected to H2O2
3.5. Effects of CGA on Liver Histopathology and Inflammation in Hens Subjected to H2O2
3.6. Effects of CGA on Hepatocyte Mitochondrial Function in Hens Subjected to H2O2
3.7. Effects of CGA on Lipid Droplet Levels in Hepatocytes of Hens Subjected to H2O2
3.8. Effects of CGA on Lipid Levels and Lipase Activity in the Serum and Liver of Hens Subjected to H2O2
3.9. Effects of CGA on Lipid Metabolism-Related Gene Expression in Hens Subjected to H2O2
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Abbas, A.O.; Alaqil, A.A.; El-Beltagi, H.S.; Abd El-Atty, H.K.; Kamel, N.N. Modulating laying hens productivity and immune performance in response to oxidative stress induced by E. coli challenge using dietary propolis supplementation. Antioxidants 2020, 9, 893. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Wan, H.; Lou, W.; Khan, R.U.; You, J.; Huang, B.; Hao, S.; Li, G.; Dai, S. Deoxynivalenol and t-2 toxin cause liver damage and egg quality degradation through endoplasmic reticulum stress in summer laying hens. Int. J. Biometeorol. 2024, 68, 1387–1396. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Xiong, Y.; Gates, R.S.; Cheng, H.W. Perches as cooling devices for reducing heat stress in caged laying hens: A review. Animals 2021, 11, 3026. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Chen, Y.; Wu, M.; Chen, K.; Zhang, D.; Zhang, R.; Yang, G.; Huang, X. Di (2-ethyl) hexyl phthalate induces liver injury in chickens by regulating pten/pi3k/akt signaling pathway via reactive oxygen species. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2023, 270, 109639. [Google Scholar] [CrossRef]
- Estevez, M. Oxidative damage to poultry: From farm to fork. Poult. Sci. 2015, 94, 1368–1378. [Google Scholar] [CrossRef]
- Lykkesfeldt, J.; Svendsen, O. Oxidants and antioxidants in disease: Oxidative stress in farm animals. Vet. J. 2007, 173, 502–511. [Google Scholar] [CrossRef]
- Ding, X.; Cai, C.; Jia, R.; Bai, S.; Zeng, Q.; Mao, X.; Xu, S.; Zhang, K.; Wang, J. Dietary resveratrol improved production performance, egg quality, and intestinal health of laying hens under oxidative stress. Poult. Sci. 2022, 101, 101886. [Google Scholar] [CrossRef]
- Wang, J.; Jia, R.; Gong, H.; Celi, P.; Zhuo, Y.; Ding, X.; Bai, S.; Zeng, Q.; Yin, H.; Xu, S.; et al. The effect of oxidative stress on the chicken ovary: Involvement of microbiota and melatonin interventions. Antioxidants 2021, 10, 1422. [Google Scholar] [CrossRef]
- Li, S.; Tan, H.Y.; Wang, N.; Zhang, Z.J.; Lao, L.; Wong, C.W.; Feng, Y. The role of oxidative stress and antioxidants in liver diseases. Int. J. Mol. Sci. 2015, 16, 26087–26124. [Google Scholar] [CrossRef]
- Hassan, W.; Rongyin, G.; Daoud, A.; Ding, L.; Wang, L.; Liu, J.; Shang, J. Reduced oxidative stress contributes to the lipid lowering effects of isoquercitrin in free fatty acids induced hepatocytes. Oxid. Med. Cell Longev. 2014, 2014, 313602. [Google Scholar] [CrossRef]
- Jing, J.; Zeng, H.; Shao, Q.; Tang, J.; Wang, L.; Jia, G.; Liu, G.; Chen, X.; Tian, G.; Cai, J.; et al. Selenomethionine alleviates environmental heat stress induced hepatic lipid accumulation and glycogen infiltration of broilers via maintaining mitochondrial and endoplasmic reticulum homeostasis. Redox Biol. 2023, 67, 102912. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Bian, Y.; Ma, Y.; Ali, W.; Wang, T.; Yuan, Y.; Gu, J.; Bian, J.; Liu, Z.; Zou, H. Melatonin alleviates cadmium-induced nonalcoholic fatty liver disease in ducks by alleviating autophagic flow arrest via PPAR-α and reducing oxidative stress. Poult. Sci. 2023, 102, 102835. [Google Scholar] [CrossRef] [PubMed]
- Mato, J.M.; Alonso, C.; Noureddin, M.; Lu, S.C. Biomarkers and subtypes of deranged lipid metabolism in non-alcoholic fatty liver disease. World J. Gastroenterol. 2019, 25, 3009–3020. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Tian, R.; She, Z.; Cai, J.; Li, H. Role of oxidative stress in the pathogenesis of nonalcoholic fatty liver disease. Free Radic. Biol. Med. 2020, 152, 116–141. [Google Scholar] [CrossRef] [PubMed]
- Shen, X.; Steyrer, E.; Retzek, H.; Sanders, E.J.; Schneider, W.J. Chicken oocyte growth: Receptor-mediated yolk deposition. Cell Tissue Res. 1993, 272, 459–471. [Google Scholar] [CrossRef]
- Alves-Bezerra, M.; Cohen, D.E. Triglyceride metabolism in the liver. Compr. Physiol. 2017, 8, 1–8. [Google Scholar]
- Shini, A.; Shini, S.; Bryden, W.L. Fatty liver haemorrhagic syndrome occurrence in laying hens: Impact of production system. Avian Pathol. 2019, 48, 25–34. [Google Scholar] [CrossRef]
- Emami, N.K.; Jung, U.; Voy, B.; Dridi, S. Radical response: Effects of heat stress-induced oxidative stress on lipid metabolism in the avian liver. Antioxidants 2020, 10, 35. [Google Scholar] [CrossRef]
- Zhu, M.K.; Li, H.Y.; Bai, L.H.; Wang, L.S.; Zou, X.T. Histological changes, lipid metabolism, and oxidative and endoplasmic reticulum stress in the liver of laying hens exposed to cadmium concentrations. Poult. Sci. 2020, 99, 3215–3228. [Google Scholar] [CrossRef]
- Wan, X.M.; Chen, J.; Wang, M.; Zheng, C.; Zhou, X.L. Puerarin attenuates cadmium-induced hepatic lipid metabolism disorder by inhibiting oxidative stress and inflammation in mice. J. Inorg. Biochem. 2021, 222, 111521. [Google Scholar] [CrossRef]
- Rashidi, R.; Rezaee, R.; Shakeri, A.; Hayes, A.W.; Karimi, G. A review of the protective effects of chlorogenic acid against different chemicals. J. Food Biochem. 2022, 46, e14254. [Google Scholar] [CrossRef] [PubMed]
- Dkhil, M.A.; Abdel Moneim, A.E.; Bauomy, A.A.; Khalil, M.; Al-Shaebi, E.M.; Al-Quraishy, S. Chlorogenic acid prevents hepatotoxicity in arsenic-treated mice: Role of oxidative stress and apoptosis. Mol. Biol. Rep. 2020, 47, 1161–1171. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Pan, J.H.; Kim, S.H.; Lee, J.H.; Park, J.W. Chlorogenic acid ameliorates alcohol-induced liver injuries through scavenging reactive oxygen species. Biochimie 2018, 150, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Liu, T.; Koci, M.; Wang, Y.; Fu, Y.; Ma, M.; Ma, Q.; Zhao, L. Chlorogenic acid alleviated afb1-induced hepatotoxicity by regulating mitochondrial function, activating Nrf2/HO-1, and inhibiting noncanonical NF-κB signaling pathway. Antioxidants 2023, 12, 2027. [Google Scholar] [CrossRef] [PubMed]
- Zha, P.; Wei, L.; Liu, W.; Chen, Y.; Zhou, Y. Effects of dietary supplementation with chlorogenic acid on growth performance, antioxidant capacity, and hepatic inflammation in broiler chickens subjected to diquat-induced oxidative stress. Poult. Sci. 2023, 102, 102479. [Google Scholar] [CrossRef]
- Bi, R.; Yang, M.; Liu, X.; Guo, F.; Hu, Z.; Huang, J.; Abbas, W.; Xu, T.; Liu, W.; Wang, Z. Effects of chlorogenic acid on productive and reproductive performances, egg quality, antioxidant functions, and intestinal microenvironment in aged breeder laying hens. Poult. Sci. 2024, 103, 104060. [Google Scholar] [CrossRef]
- Shimoda, H.; Seki, E.; Aitani, M. Inhibitory effect of green coffee bean extract on fat accumulation and body weight gain in mice. BMC Complement. Altern. Med. 2006, 6, 9. [Google Scholar] [CrossRef]
- Wang, J.H.; Liu, Y.L.; Li, C.L.; Yu, J.; Li, X.H.; Wang, F.X.; Li, Y. Effect of chlorogenic acid extracted from eucommia ulmoides oliv on hyperlipemia of mice induced by high fat diet. Sci. Technol. Food Ind. 2012, 15, 360–375. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhu, M.; Yan, M.; Chen, J.; Li, H.; Zhang, Y. MicroRNA-129-1-3p attenuates autophagy-dependent cell death by targeting MCU in granulosa cells of laying hens under H2O2-induced oxidative stress. Poult. Sci. 2023, 102, 103006. [Google Scholar] [CrossRef]
- Gunawardena, D.; Raju, R.; Munch, G. Hydrogen peroxide mediates pro-inflammatory cell-to-cell signaling: A new therapeutic target for inflammation? Neural Regen. Res. 2019, 14, 1430–1437. [Google Scholar] [PubMed]
- Xing, T.; Chen, X.; Li, J.; Zhang, L.; Gao, F. Dietary taurine attenuates hydrogen peroxide-impaired growth performance and meat quality of broilers via modulating redox status and cell death signaling. J. Anim. Sci. 2021, 99, skab089. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Cao, Z.; Cao, L.; Ding, G.; Wang, Z.; Xiao, W. Antiviral activity of chlorogenic acid against influenza A (H1N1/H3N2) virus and its inhibition of neuraminidase. Sci. Rep. 2017, 7, 45723. [Google Scholar] [CrossRef] [PubMed]
- La Rosa, G.; Sozio, C.; Pipicelli, L.; Raia, M.; Palmiero, A.; Santillo, M.; Damiano, S. Antioxidant, anti-inflammatory and pro-differentiative effects of chlorogenic acid on M03-13 human oligodendrocyte-like cells. Int. J. Mol. Sci. 2023, 24, 16731. [Google Scholar] [CrossRef]
- Wen, K.; Zhang, K.; Gao, W.; Bai, S.; Wang, J.; Song, W.; Zeng, Q.; Peng, H.; Lv, L.; Xuan, Y.; et al. Effects of stevia extract on production performance, serum biochemistry, antioxidant capacity, and gut health of laying hens. Poult. Sci. 2024, 103, 103188. [Google Scholar] [CrossRef]
- Cichoz-Lach, H.; Michalak, A. Oxidative stress as a crucial factor in liver diseases. World J. Gastroenterol. 2014, 20, 8082–8091. [Google Scholar] [CrossRef]
- Nita, M.; Grzybowski, A. Smoking and eye pathologies. A systemic review. Part I. Anterior eye segment pathologies. Curr. Pharm. Des. 2017, 23, 629–638. [Google Scholar]
- Wang, Y.; Li, Z.; Guo, G.; Xia, Y. Liver injury traceability: Spatiotemporally monitoring oxidative stress processes by unit-emitting carbon dots. Anal. Chem. 2023, 95, 2765–2773. [Google Scholar] [CrossRef]
- Li, L.; Chu, X.; Yao, Y.; Cao, J.; Li, Q.; Ma, H. (−)-Hydroxycitric acid alleviates oleic acid-induced steatosis, oxidative stress, and inflammation in primary chicken hepatocytes by regulating AMP-activated protein kinase-mediated reactive oxygen species levels. J. Agric. Food Chem. 2020, 68, 11229–11241. [Google Scholar] [CrossRef]
- Forrester, S.J.; Kikuchi, D.S.; Hernandes, M.S.; Xu, Q.; Griendling, K.K. Reactive oxygen species in metabolic and inflammatory signaling. Circ. Res. 2018, 122, 877–902. [Google Scholar] [CrossRef]
- Slimen, I.B.; Najar, T.; Ghram, A.; Dabbebi, H.; Ben Mrad, M.; Abdrabbah, M. Reactive oxygen species, heat stress and oxidative-induced mitochondrial damage. A review. Int. J. Hyperthermia 2014, 30, 513–523. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Ke, W.; Zhou, Q.; Wu, Y.; Luo, H.; Zhou, H.; Yang, B.; Guo, Y.; Zheng, Q.; Zhang, Y. Tumour necrosis factor-alpha promotes liver ischaemia-reperfusion injury through the PGC-1alpha/Mfn2 pathway. J. Cell Mol. Med. 2014, 18, 1863–1873. [Google Scholar] [CrossRef] [PubMed]
- Zorzano, A.; Liesa, M.; Sebastian, D.; Segales, J.; Palacin, M. Mitochondrial fusion proteins: Dual regulators of morphology and metabolism. Semin. Cell Dev. Biol. 2010, 21, 566–574. [Google Scholar] [CrossRef] [PubMed]
- Bi, J.; Zhang, J.; Ren, Y.; Du, Z.; Li, Q.; Wang, Y.; Wei, S.; Yang, L.; Zhang, J.; Liu, C.; et al. Irisin alleviates liver ischemia-reperfusion injury by inhibiting excessive mitochondrial fission, promoting mitochondrial biogenesis and decreasing oxidative stress. Redox Biol. 2019, 20, 296–306. [Google Scholar] [CrossRef] [PubMed]
- Rosencrans, W.M.; Rajendran, M.; Bezrukov, S.M.; Rostovtseva, T.K. VDAC regulation of mitochondrial calcium flux: From channel biophysics to disease. Cell Calcium 2021, 94, 102356. [Google Scholar] [CrossRef]
- D’Angelo, D.; Rizzuto, R. The Mitochondrial Calcium Uniporter (MCU): Molecular identity and role in human diseases. Biomolecules 2023, 13, 1304. [Google Scholar] [CrossRef]
- Squires, E.J.; Leeson, S. Aetiology of fatty liver syndrome in laying hens. Br. Vet. J. 1988, 144, 602–609. [Google Scholar] [CrossRef]
- San, J.; Hu, J.; Pang, H.; Zuo, W.; Su, N.; Guo, Z.; Wu, G.; Yang, J. Taurine protects against the fatty liver hemorrhagic syndrome in laying hens through the regulation of mitochondrial homeostasis. Int. J. Mol. Sci. 2023, 24, 10360. [Google Scholar] [CrossRef]
- Linden, A.G.; Li, S.; Choi, H.Y.; Fang, F.; Fukasawa, M.; Uyeda, K.; Hammer, R.E.; Horton, J.D.; Engelking, L.J.; Liang, G. Interplay between ChREBP and SREBP-1c coordinates postprandial glycolysis and lipogenesis in livers of mice. J. Lipid Res. 2018, 59, 475–487. [Google Scholar] [CrossRef]
- Pessayre, D.; Fromenty, B. NASH: A mitochondrial disease. J. Hepatol. 2005, 42, 928–940. [Google Scholar] [CrossRef]
- Mandard, S.; Muller, M.; Kersten, S. Peroxisome proliferator-activated receptor alpha target genes. Cell Mol. Life Sci. 2004, 61, 393–416. [Google Scholar] [CrossRef] [PubMed]
- Bougarne, N.; Weyers, B.; Desmet, S.J.; Deckers, J.; Ray, D.W.; Staels, B.; De Bosscher, K. Molecular actions of PPARα in lipid metabolism and inflammation. Endocr. Rev. 2018, 39, 760–802. [Google Scholar] [CrossRef] [PubMed]







| Items | Value (%) | Nutrient Level 2 | Value |
|---|---|---|---|
| Corn | 61.85 | Metabolism energy, MJ/Kg | 11.07 |
| Soybean meal (43% CP) | 25.00 | Crude protein, % | 16.33 |
| Fish meal (67% CP) | 0.5 | Ether extract % | 3.23 |
| Soybean oil | 0.5 | Lysine, % | 0.84 |
| Limestone | 7.00 | Methionine, % | 0.36 |
| DL-Met (99.8%) | 0.10 | Methionine + Cystine, % | 0.68 |
| L-Cys (99.0%) | 0.05 | Available phosphoru, % | 0.32 |
| Premix 1 | 5.00 | Calcium, % | 3.53 |
| Total | 100.00 |
| Target Gene | Primer Sequence (5′-3′) | Accession No. | Product Size (bp) |
|---|---|---|---|
| β-actin | F (Forward): TCCCTGGAGAAGAGCTATGAA | NM_205518.1 | 113 [30] |
| R (Reverse): CAGGACTCCATACCCAAGAAAG | |||
| NF-κB | F: CTCCTCAACCTCACTTCCTTAC | NM_001396396.1 | 205 |
| R: GCTGTGTGCTTTACCTCTTTG | |||
| TNFα | F: ACCACGAGTAGGATGTCTGTA | NM_204267.2 | 97 |
| R: CCAGCCACTTTGTGAACTTTG | |||
| IL-1β | F: GTCAACATCGCCACCTACAA | NM_204524.2 | 90 |
| R: CGGTACATACGAGATGGAAACC | |||
| IP3R | F: ACGGCTGCTGAGATTGATAC | XM_046925993.1 | 274 [30] |
| R: CTCTCCAGAATAGCCACACTTC | |||
| GRP75 | F: AAGAGGCAGGCAGTAACTAATC | NM_001006147.2 | 394 [30] |
| R: CTTCAGACTTGTCCAGACCATAG | |||
| MCU | F: TTGGCAGAGTGTGAGAGTGG | XM_046920626.1 | 196 [30] |
| R: AATTCCTCGGTCCTCTGCTT | |||
| PGC1α | F: TACAGCAATGAGCCTGCCAA | XM_046916274.1 | 117 [30] |
| R: AGGCAATCCATCCTCATCCAC | |||
| MFF | F: ACTCAAAGTGGCTCCTCA | XM_040679333.2 | 80 [30] |
| R: CCTGCATAGTTACACTGG | |||
| Fis-1 | F: GAAGGGAGTGGCCATGTT | XM_040657193.2 | 106 |
| R: GTATTCCTTGAGGCGGTAGTT | |||
| ACOX1 | F: ACTGAGCTGTGTCTCTTGTATG | XM_015295164.2 | 301 |
| R: GCTTCAGGTGTTTGTGGAAAG | |||
| CPT1 | F: GAGAAGAGTGCAGTGAGAAGAG | XM_015286798.2 | 379 |
| R: CCAGCCACAGAAGTAGAGTAAG | |||
| PPARα | F: GATGCTGCGTGAAGTGAAATG | XM_046906399.1 | 328 |
| R: CTGGTGAAAGGGTGTCTGTTAT | |||
| FASN | F: CCTGGAGATGTGGAGTATGTTG | NM_205155.3 | 274 |
| R: TCAAGGAGCCATCGTGTAAAG | |||
| SREBP1 | F: GCCATCGAGTACATCCGCTT | XM_048961548.1 | 103 |
| R: GGTCCTTGAGGGACTTGCTC | |||
| ACC | F: CTCTCTCTTTGGTCGGGATTG | XM_046929960.1 | 108 |
| R: CACTGTTCCATGTGCTCAAATAC |
| Items | Control | H2O2 | 600 mg/kg CGA | 600 mg/kg CGA + H2O2 | 800 mg/kg CGA | 800 mg/kg CGA + H2O2 | p-Value |
|---|---|---|---|---|---|---|---|
| HU | 88.55 ± 1.48 ab | 83.38 ± 1.78 b,* | 94.85 ± 1.73 a,* | 91.05 ± 1.26 a | 94.96 ± 1.96 a,* | 92.49 ± 1.70 a | 0.000 |
| AH, mm | 8.28 ± 0.31 bc | 7.25 ± 0.33 c,* | 9.73 ± 0.40 a,** | 8.58 ± 0.27 abc | 9.48 ± 0.42 ab,** | 8.87 ± 0.29 ab | 0.000 |
| YC | 6.07 ± 0.07 b | 6.25 ± 0.11 ab | 6.36 ± 0.09 ab,* | 6.40 ± 0.10 ab | 6.63 ± 0.13 a,** | 6.60 ± 0.12 a | 0.003 |
| ES, kgf/m2 | 5.20 ± 0.13 | 4.87 ± 0.15 | 5.33 ± 0.12 | 5.08 ± 0.10 | 5.39 ± 0.10 | 5.20 ± 0.13 | 0.063 |
| Items | Control | H2O2 | 800 mg/kg CGA | 800 mg/kg CGA + H2O2 | p-Value |
|---|---|---|---|---|---|
| Serum | |||||
| TGs, mmol/L | 6.60 ± 0.54 a | 8.13 ± 0.30 a,* | 4.51 ± 0.56 b | 4.29 ± 0.51 b | <0.001 |
| T-CHO, mmol/L | 1.54 ± 0.09 b | 2.01 ± 0.13 a | 1.04 ± 0.07 c | 0.86 ± 0.11 c | <0.001 |
| LDL-C, mmol/L | 1.17 ± 0.19 ab | 1.71 ± 0.30 a | 0.63 ± 0.07 b | 0.49 ± 0.12 b | 0.002 |
| LPL, U/L | 1.10 ± 0.15 b | 2.33 ± 0.17 a | 2.97 ± 0.43 a | 2.50 ± 0.41 a | 0.005 |
| HL, U/L | 2.58 ± 0.06 a | 1.13 ± 0.14 b | 2.40 ± 0.29 a | 2.47 ± 0.40 a | 0.001 |
| Liver | |||||
| TGs, mmol/gprot | 0.52 ± 0.13 b | 0.95 ± 0.13 a | 0.19 ± 0.01 b | 0.38 ± 0.06 b | <0.001 |
| T-CHO, mmol/gprot | 0.127 ± 0.01 a | 0.091 ± 0.01 b | 0.098 ± 0.01 ab | 0.095 ± 0.01 ab | 0.022 |
| LDL-C, mmol/gprot | 0.040 ± 0.002 | 0.047 ± 0.001 | 0.038 ± 0.009 | 0.045 ± 0.007 | 0.641 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, H.; Li, Z.; Sun, Y.; Yan, M.; Wang, Y.; Li, Y.; Zhang, Y.; Zhu, M. Supplementation of Chlorogenic Acid Alleviates the Effects of H2O2-Induced Oxidative Stress on Laying Performance, Egg Quality, Antioxidant Capacity, Hepatic Inflammation, Mitochondrial Dysfunction, and Lipid Accumulation in Laying Hens. Antioxidants 2024, 13, 1303. https://doi.org/10.3390/antiox13111303
Zhao H, Li Z, Sun Y, Yan M, Wang Y, Li Y, Zhang Y, Zhu M. Supplementation of Chlorogenic Acid Alleviates the Effects of H2O2-Induced Oxidative Stress on Laying Performance, Egg Quality, Antioxidant Capacity, Hepatic Inflammation, Mitochondrial Dysfunction, and Lipid Accumulation in Laying Hens. Antioxidants. 2024; 13(11):1303. https://doi.org/10.3390/antiox13111303
Chicago/Turabian StyleZhao, Haitong, Zhuang Li, Yue Sun, Ming Yan, Yingjie Wang, Yurong Li, Yeshun Zhang, and Mingkun Zhu. 2024. "Supplementation of Chlorogenic Acid Alleviates the Effects of H2O2-Induced Oxidative Stress on Laying Performance, Egg Quality, Antioxidant Capacity, Hepatic Inflammation, Mitochondrial Dysfunction, and Lipid Accumulation in Laying Hens" Antioxidants 13, no. 11: 1303. https://doi.org/10.3390/antiox13111303
APA StyleZhao, H., Li, Z., Sun, Y., Yan, M., Wang, Y., Li, Y., Zhang, Y., & Zhu, M. (2024). Supplementation of Chlorogenic Acid Alleviates the Effects of H2O2-Induced Oxidative Stress on Laying Performance, Egg Quality, Antioxidant Capacity, Hepatic Inflammation, Mitochondrial Dysfunction, and Lipid Accumulation in Laying Hens. Antioxidants, 13(11), 1303. https://doi.org/10.3390/antiox13111303

