Iron Uptake Controls Trypanosoma cruzi Metabolic Shift and Cell Proliferation
Abstract
1. Introduction
2. Materials and Methods
2.1. Epimastigote Growth and Metacyclogenesis
2.2. Intracellular Fe Concentration Determination
2.3. Real-Time-PCR
2.4. Endocytosis Assay
2.5. Cell Cytometry
2.6. Transmission Electron Microscopy
2.7. Protein Kinase A (PKA) Activity
2.8. High-Resolution Respirometry in Different Respiratory States
2.9. Succinate-Cytochrome C Oxidoreductase Activity
2.10. Mitochondrial Membrane Potential
2.11. Intracellular ATP Quantification
2.12. Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) Activity
2.13. Glucokinase Activity
2.14. Western Blotting
2.15. Superoxide Dismutase (SOD) Activity
2.16. Amplex® Red Peroxidase Assay
2.17. Statistical Analysis
3. Results
3.1. Trypanosoma cruzi Epimastigotes Depend on Exogenous Fe Content for Fe Proliferation
3.2. Exogenous Fe Selectively Modulates the Endocytic Capacity of Epimastigote Cells
3.3. Free Iron Supplementation-Induced Modifications in the Heme-Regulated Eukaryotic Initiation Factor 2α Kinase-Signaling Pathway
3.4. Exogenous Fe Alters Mitochondrial Respiratory Rates in T. cruzi Epimastigotes
3.5. Upregulation of Glycolytic Enzymes in Parasites Grown in Fe-Depleted Media
3.6. Modifications in Redox Signaling Induced by Depletion of Fe in Culture Medium
3.7. Differentiation of Epimastigotes Is Lower in Fe-Depleted Medium and Is Recovered after Fe Supplementation
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
ANOVA | Analysis of variance |
BHI medium | Brain heart infusion medium |
BSA | Bovine serum albumin |
DAPI | Diamidino-2-phenylindole |
eIF2α | Eukaryotic initiation factor 2α |
ETS | Mitochondrial respiration uncoupled from phosphorylation |
FCCP | Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone |
Fe | Iron |
FITC | Fluorescein isothiocyanate |
G418 | Geneticin (polypeptide synthesis blocker) |
G6PDH | Glucose-6-phosphate dehydrogenase |
HB | Hemoglobin |
HRI | Heme-regulated inhibitor |
HRP | Horseradish peroxidase |
IAA | Iodoacetamide |
IBMX | 3-isobutyl-1-methylxanthine |
IDM | Iron-depleted medium |
IDM + Fe | Iron-depleted medium plus 8 µM Fe citrate |
JC-1 | 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide |
LEAK | Mitochondrial respiration in the presence of respiratory substrate only |
LIT | Leishmania amazonensis iron transporter family |
NBT | Nitro blue tetrazolium |
O2•− | Anion superoxide |
OH• | Hydroxyl radical |
OTO | Osmium-thiocarbohydrazide-osmium |
OXPHOS | Oxidative phosphorylation state (mitochondrial respiration in the presence of ADP) |
PBS | Phosphate buffer saline |
PKA | cyclic AMP-dependent protein kinase |
RIPA buffer | Radioimmunoprecipitation assay buffer |
RM | Regular medium containing Fe and hemin |
ROS | Reactive O2 species |
ROX | Residual mitochondrial respiration after inhibition of Complex III |
RPMI medium | Roswell Park Memorial Institute medium |
RT-PCR | Reverse transcription polymerase chain reaction |
SEM | Standard error of the mean |
TAU | Triatomine artificial urine |
TcAPX | T. cruzi ascorbate peroxidase |
TcFR | T. cruzi Fe reductase |
TcIT | T. cruzi Fe transporter |
TcSOD | T. cruzi superoxide dismutase |
Tf | Transferrin |
Tryp | Metacyclic epimastigotes |
ZIP Family | Zinc and iron transporter family |
References
- Figueiredo, R.C.; Rosa, D.S.; Soares, M.J. Differentiation of Trypanosoma cruzi epimastigotes: Metacyclogenesis and adhesion to substrate are triggered by nutritional stress. J. Parasitol. 2000, 86, 1213–1218. [Google Scholar] [CrossRef]
- Rassi, A., Jr.; Rassi, A.; Marin-Neto, J.A. Chagas disease. Lancet 2010, 375, 1388–1402. [Google Scholar] [CrossRef]
- Franco-Paredes, C.; Von, A.; Hidron, A.; Rodríguez-Morales, A.J.; Tellez, I.; Barragán, M.; Jones, D.; Náquira, C.G.; Mendez, J. Chagas disease: An impediment in achieving the Millennium Development Goals in Latin America. BMC Int. Health Hum. 2007, 7, 7. [Google Scholar] [CrossRef]
- Dlouhy, A.C.; Outten, C.E. The iron metallome in eukaryotic organisms. Metallomics 2013, 12, 241–278. [Google Scholar] [CrossRef]
- Taylor, M.C.; Kelly, J.M. Iron metabolism in trypanosomatids, and its crucial role in infection. Parasitology 2010, 137, 899–917. [Google Scholar] [CrossRef] [PubMed]
- Sunda, W.G.; Huntsman, S.A. High iron requirement for growth, photosynthesis, and low-light acclimation in the coastal cyanobacterium Synechococcus bacillaris. Front. Microbiol. 2015, 6, 561. [Google Scholar] [CrossRef] [PubMed]
- Benjamin, J.A.; Desnoyers, G.; Morissette, A.; Salvail, H.; Massé, E. Dealing with oxidative stress and iron starvation in microorganisms: An overview. Can. J. Physiol. Pharmacol. 2010, 88, 264–272. [Google Scholar] [CrossRef]
- Miethke, M.; Marahiel, M.A. Siderophore-based iron acquisition and pathogen control. Microbiol. Mol. Biol. Rev. 2007, 71, 413–451. [Google Scholar] [CrossRef]
- Dormeyer, M.; Schöneck, R.; Dittmar, G.A.; Krauth-Siegel, R.L. Cloning, sequencing and expression of ribonucleotide reductase R2 from Trypanosoma brucei. FEBS Lett. 1997, 414, 449–453. [Google Scholar] [CrossRef]
- Hofer, A.; Schmidt, P.P.; Gräslund, A.; Thelander, L. Cloning and characterization of the R1 and R2 subunits of ribonucleotide reductase from Trypanosoma brucei. Proc. Natl. Acad. Sci. USA 1997, 94, 6959–6964. [Google Scholar] [CrossRef] [PubMed]
- Fairlamb, A.H.; Bowman, I.B. Trypanosoma brucei: Suramin and other trypanocidal compounds’ effects on sn-glycerol-3-phosphate oxidase. Exp. Parasitol. 1997, 43, 353–361. [Google Scholar] [CrossRef] [PubMed]
- Le Trant, N.; Meshnick, S.R.; Kitchener, K.; Eaton, J.W.; Cerami, A. Iron-containing superoxide dismutase from Crithidia fasciculata. Purification, characterization, and similarity to leishmanial and trypanosomal enzymes. J. Biol. Chem. 1983, 258, 125–130. [Google Scholar] [CrossRef] [PubMed]
- Barasch, J.; Mori, K. Cell biology: Iron thievery. Nature 2004, 432, 811–813. [Google Scholar] [CrossRef] [PubMed]
- Schaible, U.E.; Kaufmann, S.H. Iron and microbial infection. Nat. Rev. Microbiol. 2004, 2, 946–953. [Google Scholar] [CrossRef]
- Braun, V. Bacterial iron transport related to virulence. Contrib. Microbiol. 2005, 12, 210–233. [Google Scholar] [CrossRef]
- Ratledge, C. Iron metabolism and infection. Food Nutr. Bull. 2007, 28, S515–S523. [Google Scholar] [CrossRef]
- Lalonde, R.G.; Holbein, B.E. Role of iron in Trypanosoma cruzi infection of mice. J. Clin. Investig. 1984, 73, 470–476. [Google Scholar] [CrossRef]
- Lima, M.F.; Villalta, F. Trypanosoma cruzi receptors for human transferrin and their role. Mol. Biochem. Parasitol. 1990, 38, 245–252. [Google Scholar] [CrossRef]
- Porto-Carreiro, I.; Attias, M.; Miranda, K.; De Souza, W.; Cunha-e-Silva, N. Trypanosoma cruzi epimastigote endocytic pathway: Cargo enters the cytostome and passes through an early endosomal network before storage in reservosomes. Eur. J. Cell Biol. 2000, 79, 858–869. [Google Scholar] [CrossRef]
- Lara, F.A.; Sant’anna, C.; Lemos, D.; Laranja, G.A.; Coelho, M.G.; Reis Salles, I.; Michel, A.; Oliveira, P.L.; Cunha-E-Silva, N.; Salmon, D.; et al. Heme requirement and intracellular trafficking in Trypanosoma cruzi epimastigotes. Biochem. Biophys. Res. Commun. 2007, 355, 16–22. [Google Scholar] [CrossRef]
- Cupello, M.P.; Souza, C.F.; Buchensky, C.; Soares, J.B.; Laranja, G.A.; Coelho, M.G.; Cricco, J.A.; Paes, M.C. The heme uptake process in Trypanosoma cruzi epimastigotes is inhibited by heme analogues and by inhibitors of ABC transporters. Acta Trop. 2011, 120, 211–218. [Google Scholar] [CrossRef]
- Flannery, A.R.; Huynh, C.; Mittra, B.; Mortara, R.A.; Andrews, N.W. LFR1 ferric iron reductase of Leishmania amazonensis is essential for the generation of infective parasite forms. J. Biol. Chem. 2011, 286, 23266–23279. [Google Scholar] [CrossRef]
- Huynh, C.; Andrews, N.W. Iron acquisition within host cells and the pathogenicity of Leishmania. Cell Microbiol. 2008, 10, 293–300. [Google Scholar] [CrossRef] [PubMed]
- Wilson, M.E.; Lewis, T.S.; Miller, M.A.; McCormick, M.L.; Britigan, B.E. Leishmania chagasi: Uptake of iron bound to lactoferrin or transferrin requires an iron reductase. Exp. Parasitol. 2002, 100, 196–207. [Google Scholar] [CrossRef]
- Dick, C.F.; De Moura Guimarães, L.; Carvalho-Kelly, L.F.; Cortes, A.L.; Morcillo, L.S.L.; Sampaio, L.S.; Meyer-Fernandes, J.R.; Vieyra, A. A ferric reductase of Trypanosoma cruzi (TcFR) is involved in iron metabolism in the parasite. Exp. Parasitol. 2020, 217, 107962. [Google Scholar] [CrossRef] [PubMed]
- Mach, J.; Tachezy, J.; Sutak, R. Efficient iron uptake via a reductive mechanism in procyclic Trypanosoma brucei. J. Parasitol. 2013, 99, 363–364. [Google Scholar] [CrossRef]
- Huynh, C.; Sacks, D.L.; Andrews, N.W. A Leishmania amazonensis ZIP family iron transporter is essential for parasite replication within macrophage phagolysosomes. J. Exp. Med. 2006, 203, 2363–2375. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Zhou, X.; Huang, Y.; Zhu, L.; Zhang, S.; Zhao, Y.; Guo, J.; Chen, J.; Chen, R. Identification and characterization of the zinc-regulated transporters, iron-regulated transporter-like protein (ZIP) gene family in maize. BMC Plant Biol. 2013, 13, 114. [Google Scholar] [CrossRef] [PubMed]
- Dick, C.F.; Rocco-Machado, N.; Dos-Santos, A.L.A.; Carvalho-Kelly, L.F.; Alcantara, C.L.; Cunha-E-Silva, N.L.; Meyer-Fernandes, J.R.; Vieyra, A. An Iron Transporter Is Involved in Iron Homeostasis, Energy Metabolism, Oxidative Stress, and Metacyclogenesis in Trypanosoma cruzi. Front. Cell Infect. Microbiol. 2022, 11, 789401. [Google Scholar] [CrossRef]
- Atkins, P.; de Paula, J. Physical Chemistry for the Life Sciences; Oxford University Press: Oxford, UK, 2006; pp. 200–236. [Google Scholar]
- Krumova, K.; Cosa, G. Overview of reactive oxygen species. In Singlet Oxygen: Applications in Biosciences and Nanosciences; Nonell, S., Flors, C., Eds.; Royal Society of Chemistry: London, UK, 2016; Volume 1, pp. 1–21. [Google Scholar]
- Corrêa, A.F.; Andrade, L.R.; Soares, M.J. Elemental composition of acidocalcisomes of Trypanosoma cruzi bloodstream trypomastigote forms. Parasitol. Res. 2002, 88, 875–880. [Google Scholar] [CrossRef]
- Ferella, M.; Nilsson, D.; Darban, H.; Rodrigues, C.; Bontempi, E.J.; Docampo, R.; Andersson, B. Proteomics in Trypanosoma cruzi—Localization of novel proteins to various organelles. Proteomics 2008, 8, 2735–2749. [Google Scholar] [CrossRef] [PubMed]
- Paiva, C.N.; Feijó, D.F.; Dutra, F.F.; Carneiro, V.C.; Freitas, G.B.; Alves, L.S.; Mesquita, J.; Fortes, G.B.; Figueiredo, R.T.; Souza, H.S.; et al. Oxidative Stress Fuels Trypanosoma cruzi Infection in Mice. J. Clin. Investig. 2012, 122, 2531–2542. [Google Scholar] [CrossRef]
- Koeller, C.M.; van der Wel, H.; Feasley, C.L.; Abreu, F.; da Rocha, J.D.; Montalvão, F.; Fampa, P.; Dos Reis, F.C.; Atella, G.C.; Souto-Padrón, T.; et al. Golgi UDP-GlcNAc:Polypeptide O-α-N-Acetyl-d-Glucosaminyltransferase 2 (TcOGNT2) Regulates Trypomastigote Production and Function in Trypanosoma cruzi. Eukaryot. Cell 2014, 13, 1312–1327. [Google Scholar] [CrossRef]
- Mittra, B.; Cortez, M.; Haydock, A.; Ramasamy, G.; Myler, P.J.; Andrews, N.W. Iron Uptake Controls the Generation of Leishmania Infective Forms through Regulation of ROS Levels. J. Exp. Med. 2013, 210, 401–416. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H.J. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔC(T) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Alcantara, C.L.; Vidal, J.C.; de Souza, W.; Cunha-e-Silva, N.L. The three-dimensional structure of the cytostome-cytopharynx complex of Trypanosoma cruzi epimastigotes. J. Cell Sci. 2014, 127, 2227–2237. [Google Scholar] [CrossRef]
- Nogueira, N.P.; Saraiva, F.M.S.; Oliveira, M.P.; Mendonça, A.P.M.; Inacio, J.D.F.; Almeida-Amaral, E.E.; Menna-Barreto, R.F.; Laranja, G.A.T.; Torres, E.J.L.; Oliveira, M.F.; et al. Heme Modulates Trypanosoma cruzi Bioenergetics Inducing Mitochondrial ROS Production. Free Radic. Biol. Med. 2017, 108, 183–191. [Google Scholar] [CrossRef]
- Ferguson, M.; Mockett, R.J.; Shen, Y.; Orr, W.C.; Sohal, R.S. Age-associated decline in mitochondrial respiration and electron transport in Drosophila melanogaster. Biochem. J. 2005, 390, 501–511. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Lacerda-Abreu, M.A.; Russo-Abrahão, T.; Rocco-Machado, N.; Cosentino-Gomes, D.; Dick, C.F.; Carvalho-Kelly, L.F.; Cunha Nascimento, M.T.; Rocha-Vieira, T.C.; Meyer-Fernandes, J.R. Hydrogen Peroxide Generation as an Underlying Response to High Extracellular Inorganic Phosphate (Pi) in Breast Cancer Cells. Int. J. Mol. Sci. 2021, 22, 10096. [Google Scholar] [CrossRef]
- Carvalho-Kelly, L.F.; Dick, C.F.; Rocco-Machado, N.; Gomes-Vieira, A.L.; Paes-Vieira, L.; Meyer-Fernandes, J.R. Anaerobic ATP synthesis pathways and inorganic phosphate transport and their possible roles in encystment in Acanthamoeba castellanii. Mol. Cell Biol. 2022, 46, 1288–1298. [Google Scholar] [CrossRef] [PubMed]
- Bressi, J.C.; Verlinde, C.L.; Aronov, A.M.; Shaw, M.L.; Shin, S.S.; Nguyen, L.N.; Suresh, S.; Buckner, F.S.; Van Voorhis, W.C.; Kuntz, I.D.; et al. Adenosine analogues as selective inhibitors of glyceraldehyde-3-phosphate dehydrogenase of Trypanosomatidae via structure-based drug design. J. Med. Chem. 2001, 44, 2080–2093. [Google Scholar] [CrossRef] [PubMed]
- Wiggers, H.J.; Cheleski, J.; Zottis, A.; Oliva, G.; Andricopulo, A.D.; Montanari, C.A. Effects of organic solvents on the enzyme activity of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase in calorimetric assays. Anal. Biochem. 2007, 370, 107–114. [Google Scholar] [CrossRef]
- Gomes, M.T.; Paes-Vieira, L.; Gomes-Vieira, A.L.; Cosentino-Gomes, D.; da Silva, A.P.P.; Giarola, N.L.L.; Da Silva, D.; Sola-Penna, M.; Galina, A.; Meyer-Fernandes, J.R. 3-Bromopyruvate: A new strategy for inhibition of glycolytic enzymes in Leishmania amazonensis. Exp. Parasitol. 2021, 229, 108154. [Google Scholar] [CrossRef] [PubMed]
- Dos-Santos, A.L.A.; Dick, C.F.; Lopes, L.R.; Rocco-Machado, N.; Muzi-Filho, H.; Freitas-Mesquita, A.L.; Paes-Vieira, L.; Vieyra, A.; Meyer-Fernandes, J.R. Tartrate-resistant phosphatase type 5 in Trypanosoma cruzi is important for resistance to oxidative stress promoted by hydrogen peroxide. Exp. Parasitol. 2019, 205, 107748. [Google Scholar] [CrossRef]
- Cunha-e-Silva, N.; Sant’Anna, C.; Pereira, M.G.; Porto-Carreiro, I.; Jeovanio, A.L.; de Souza, W. Reservosomes: Multipurpose organelles? Parasitol. Res. 2006, 99, 325–327. [Google Scholar] [CrossRef]
- Sant’Anna, C.; Nakayasu, E.S.; Pereira, M.G.; Lourenço, D.; de Souza, W.; Almeida, I.C.; Cunha-E-Silva, N.L. Subcellular proteomics of Trypanosoma cruzi reservosomes. Proteomics 2009, 9, 1782–1794. [Google Scholar] [CrossRef]
- Pereira, M.G.; Nakayasu, E.S.; Sant’Anna, C.; De Cicco, N.N.; Atella, G.C.; de Souza, W.; Almeida, I.C.; Cunha-e-Silva, N. Trypanosoma cruzi epimastigotes are able to store and mobilize high amounts of cholesterol in reservosome lipid inclusions. PLoS ONE 2011, 6, e22359. [Google Scholar] [CrossRef]
- Pereira, M.G.; Visbal, G.; Salgado, L.T.; Vidal, J.C.; Godinho, J.L.; De Cicco, N.N.; Atella, G.C.; de Souza, W.; Cunha-e-Silva, N. Trypanosoma cruzi Epimastigotes Are Able to Manage Internal Cholesterol Levels under Nutritional Lipid Stress Conditions. PLoS ONE 2015, 10, e0128949. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Macias-Garcia, A.; Ulirsch, J.C.; Velazquez, J.; Butty, V.L.; Levine, S.S.; Sankaran, V.G.; Chen, J.J. HRI Coordinates Translation Necessary for Protein Homeostasis and Mitochondrial Function in Erythropoiesis. eLife 2019, 8, e46976. [Google Scholar] [CrossRef] [PubMed]
- Pakos-Zebrucka, K.; Koryga, I.; Mnich, K.; Ljujic, M.; Samali, A.; Gorman, A.M. The Integrated Stress Response. EMBO Rep. 2016, 17, 1374–1395. [Google Scholar] [CrossRef] [PubMed]
- Caza, M.; Kronstad, J.W. The cAMP/Protein Kinase A Pathway Regulates Virulence and Adaptation to Host Conditions in Cryptococcus neoformans. Front. Cell Infect. Microbiol. 2019, 9, 212. [Google Scholar] [CrossRef]
- Gahura, O.; Hierro-Yap, C.; Zíková, A. Redesigned and Reversed: Architectural and Functional Oddities of the Trypanosomal ATP Synthase. Parasitology 2021, 148, 1151–1160. [Google Scholar] [CrossRef] [PubMed]
- Maugeri, D.A.; Cannata, J.J.; Cazzulo, J.J. Glucose metabolism in Trypanosoma cruzi. Essays Biochem. 2011, 51, 15–30. [Google Scholar] [CrossRef]
- Heneberg, P. Redox Regulation of Hexokinases. Antioxid. Redox Signal 2019, 30, 415–442. [Google Scholar] [CrossRef]
- Mateo-Carrasco, H.; Serrano-Castro, P.J.; Molina-Cuadrado, E.; Goodwin, M.; Nguyen, T.V.; Kotecha, P.N. Role of high-dose levetiracetam as add-on therapy for intractable epilepsy: Case report and brief review of the literature. Int. J. Clin. Pharm. 2015, 37, 559–562. [Google Scholar] [CrossRef]
- Wilkinson, S.R.; Obado, S.O.; Mauricio, I.L.; Kelly, J.M. Trypanosoma cruzi expresses a plant-like ascorbate-dependent hemoperoxidase localized to the endoplasmic reticulum. Proc. Natl. Acad. Sci. USA 2002, 99, 13453–13458. [Google Scholar] [CrossRef]
- Nogueira, F.B.; Rodrigues, J.F.; Correa, M.M.; Ruiz, J.C.; Romanha, A.J.; Murta, S.M. The level of ascorbate peroxidase is enhanced in benznidazole-resistant populations of Trypanosoma cruzi and its expression is modulated by stress generated by hydrogen peroxide. Mem. Inst. Oswaldo Cruz 2012, 107, 494–502. [Google Scholar] [CrossRef] [PubMed]
- Nogueira, N.P.; Saraiva, F.M.; Sultano, P.E.; Cunha, P.R.; Laranja, G.A.; Justo, G.A.; Sabino, K.C.; Coelho, M.G.; Rossini, A.; Atella, G.C.; et al. Proliferation and Differentiation of Trypanosoma cruzi Inside Its Vector Have a New Trigger: Redox Status. PLoS ONE 2015, 10, e0116712. [Google Scholar] [CrossRef]
- Warburg, O. On the Origin of Cancer Cells. Science 1956, 123, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Morales, J.; Mogi, T.; Mineki, S.; Takashima, E.; Mineki, R.; Hirawake, H.; Sakamoto, K.; Omura, S.; Kita, K. Novel Mitochondrial Complex II Isolated from Trypanosoma cruzi Is Composed of 12 Peptides Including a Heterodimeric Ip Subunit. J. Biol. Chem. 2009, 284, 7255–7263. [Google Scholar] [CrossRef] [PubMed]
- Racker, E. Reconstitution of Cytochrome Oxidase Vesicles and Conferral of Sensitivity to Energy Transfer Inhibitors. J. Membr. Biol. 1972, 10, 221–235. [Google Scholar] [CrossRef]
- Paes, M.C.; Saraiva, F.M.S.; Nogueira, N.P.; Vieira, C.S.D.; Dias, F.A.; Rossini, A.; Coelho, V.L.; Pane, A.; Sang, F.; Alcocer, M. Gene Expression Profiling of Trypanosoma cruzi in the Presence of Heme Points to Glycosomal Metabolic Adaptation of Epimastigotes Inside the Vector. PLoS Negl. Trop. Dis. 2020, 14, e0007945. [Google Scholar] [CrossRef]
- Bao, Y.; Weiss, L.M.; Braunstein, V.L.; Huang, H. Role of Protein Kinase A in Trypanosoma cruzi. Infect. Immun. 2008, 76, 4757–4763. [Google Scholar] [CrossRef]
- Quiñones, W.; Acosta, H.; Gonçalves, C.S.; Motta, M.C.M.; Gualdrón-López, M.; Michels, P.A.M. Structure, Properties, and Function of Glycosomes in Trypanosoma cruzi. Front. Cell Infect. Microbiol. 2020, 10, 25. [Google Scholar] [CrossRef] [PubMed]
- Acosta, H.; Dubourdieu, M.; Quiñones, W.; Cáceres, A.; Bringaud, F.; Concepción, J.L. Pyruvate phosphate dikinase and pyrophosphate metabolism in the glycosome of Trypanosoma cruzi epimastigotes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2004, 138, 347–356. [Google Scholar] [CrossRef] [PubMed]
- Rivière, L.; van Weelden, S.W.; Glass, P.; Vegh, P.; Coustou, V.; Biran, M.; van Hellemond, J.J.; Bringaud, F.; Tielens, A.G.; Boshart, M. Acetyl:succinate CoA-transferase in procyclic Trypanosoma brucei. Gene identification and role in carbohydrate metabolism. J. Biol. Chem. 2004, 279, 45337–45346. [Google Scholar] [CrossRef]
- Martínez, A.; Prolo, C.; Estrada, D.; Rios, N.; Alvarez, M.N.; Piñeyro, M.D.; Robello, C.; Radi, R.; Piacenza, L. Cytosolic Fe-superoxide dismutase safeguards Trypanosoma cruzi from macrophage-derived superoxide radical. Proc. Natl. Acad. Sci. USA 2019, 116, 8879–8888. [Google Scholar] [CrossRef]
- Paula, J.I.O.; Pinto, J.D.S.; Rossini, A.; Nogueira, N.P.; Paes, M.C. New perspectives for hydrogen peroxide in the amastigogenesis of Trypanosoma cruzi in vitro. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165951. [Google Scholar] [CrossRef]
Primers Name | Forward Primer | Reverse Primer |
---|---|---|
T. cruzi iron transporter | TCTGGTCGCTTCTCTTCTCG | TAAAGACTCCGGCACACAGT |
T. cruzi ferric reductase | GTGGTTTGTAGACCGGCTGT | GTGCCATTGCAAGAGAGACA |
T. cruzi heme-regulated inhibitor | CATTGTGGAGGCGTTGGAAA | TGGAAGAGCACCGTGAAGAT |
T. cruzi eukaryotic initiation factor 2α | CCGTTTAACGTTCCCTTTGA | GTCCCAGCTCGTTACTCCAA |
T. cruzi protein kinase A | CCGGGTGTACTTTGTGTTGG | CGCAAACCCAAAGTCAGTCA |
T. cruzi glyceraldehyde-3-phosphate dehydrogenase | GCAAGCTTGGTGTGGAGTAC | CTCACTGGGGTTGTACTCGT |
T. cruzi superoxide dismutase | GTCGGATATTGTGTTGGGCC | CCCTGTACCACGGAAACTCT |
T. cruzi ascorbate peroxidase | CACGACAAGTACGGCTTTGA | CTTCGCGATGGAACGATATT |
T. cruzi tubulin | AAGCGCACGATTCAGTTTGT | CTCCATACCCTCACCAACGT |
RM | IDM | IDM + Fe | |
---|---|---|---|
Fe content | 22.07 ± 0.78 a | 11.01 ± 2.42 b | 26.59 ± 3.31 a |
TcFR transcript | 0.96 ± 0.05 a | 1.59 ± 0.11 b | 2.14 ± 0.16 b |
TcIT transcript | 0.85 ± 0.05 a | 1.72 ± 0.24 b | 0.72 ± 0.12 a |
RM | IDM | IDM + Fe | |
---|---|---|---|
TcHRI transcript | 1.04 ± 0.02 a | 1.70 ± 0.11 b | 1.44 ± 0.25 a |
eIF2α transcript | 1.00 ± 0.07 a | 0.41 ± 0.05 b | 1.45 ± 0.05 b |
TcPKA transcript | 1.04 ± 0.04 a | 0.78 ± 0.07 a | 1.57 ± 0.16 b |
PKA activity | 0.98 ± 0.02 a | 0.29 ± 0.08 b | 2.12 ± 0.24 a |
Line | Determination | Additions | RM | IDM | IDM + Fe |
---|---|---|---|---|---|
Mitochondrial respiration state | |||||
1 | LEAK | Succinate | 0.87± 0.13 a | 0.38 ± 0.06 b | 0.66 ± 0.09 a |
2 | OSPHOS | ADP | 1.51 ± 0.16 a | 0.44 ± 0.07 b | 0.73 ± 0.09 b |
3 | ETS | FCCP | 2.16 ± 0.26 a | 0.54 ± 0.10 b | 0.92 ± 0.10 b |
4 | ROX | Antimycin A | 0.33 ± 0.02 | 0.23 ± 0.01 | 0.12 ± 0.02 |
5 | Succinate cytochrome c oxidoreductase activity | Succinate | 103.5 ± 5.7 a | 41.1 ± 7.9 b | 93.9 ± 14.4 a |
6 | ΔΨm (F/FFCCP) | Succinate + FCCP | 1.35 ± 0.03 a | 9.23 ± 0.57 b | 2.96 ± 0.59 c |
7 | ATPi | No inhibitors | 24.24 ± 0.96 a | 14.28 ± 1.52 b | 12.51 ± 2.09 b |
8 | Oligomycin | 10.63 ± 0.57 a | 7.79 ± 0.94 a | 8.98 ± 2.25 a | |
9 | Iodoacetamide | 11.74 ± 2.45 a | 6.42 ± 1.14 b | 6.28 ± 0.54 b |
RM | IDM | IDM + Fe | |
---|---|---|---|
SOD activity | 7.98 ± 2.26 a | 21.47 ± 3.08 b | 23.24 ± 3.94 b |
Production of H2O2 | 55.01 ± 0.75 a | 33.59 ± 6.33 b | 60.50 ± 5.34 a |
TcSOD transcript | 1.01 ± 0.01 a | 0.45 ± 0.09 b | 0.44 ± 0.06 b |
TcAPX | 1.17 ± 0.10 a | 0.14 ± 0.04 b | 1.29 ± 0.20 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dick, C.F.; Alcantara, C.L.; Carvalho-Kelly, L.F.; Lacerda-Abreu, M.A.; Cunha-e-Silva, N.L.; Meyer-Fernandes, J.R.; Vieyra, A. Iron Uptake Controls Trypanosoma cruzi Metabolic Shift and Cell Proliferation. Antioxidants 2023, 12, 984. https://doi.org/10.3390/antiox12050984
Dick CF, Alcantara CL, Carvalho-Kelly LF, Lacerda-Abreu MA, Cunha-e-Silva NL, Meyer-Fernandes JR, Vieyra A. Iron Uptake Controls Trypanosoma cruzi Metabolic Shift and Cell Proliferation. Antioxidants. 2023; 12(5):984. https://doi.org/10.3390/antiox12050984
Chicago/Turabian StyleDick, Claudia F., Carolina L. Alcantara, Luiz F. Carvalho-Kelly, Marco Antonio Lacerda-Abreu, Narcisa L. Cunha-e-Silva, José R. Meyer-Fernandes, and Adalberto Vieyra. 2023. "Iron Uptake Controls Trypanosoma cruzi Metabolic Shift and Cell Proliferation" Antioxidants 12, no. 5: 984. https://doi.org/10.3390/antiox12050984
APA StyleDick, C. F., Alcantara, C. L., Carvalho-Kelly, L. F., Lacerda-Abreu, M. A., Cunha-e-Silva, N. L., Meyer-Fernandes, J. R., & Vieyra, A. (2023). Iron Uptake Controls Trypanosoma cruzi Metabolic Shift and Cell Proliferation. Antioxidants, 12(5), 984. https://doi.org/10.3390/antiox12050984