Mitofilin Heterozygote Mice Display an Increase in Myocardial Injury and Inflammation after Ischemia/Reperfusion
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Protocols
2.2. Animals
2.3. Generation of IMMT Knockout Mice
2.4. Antibodies and Reagents
2.5. Langendorff Heart Perfusion
2.6. Isolated Heart Functional Measurements
2.7. Myocardial Infarct Size Measurements
2.8. Mitochondrial Isolation
2.9. DNA Extraction and Quantification
2.10. Ca2+-Induced Mitochondrial Permeability Transition Pore (mPTP) Opening
2.11. Mitochondrial ROS Measurement
2.12. Western Blot Analysis
2.13. Protein Identification/Relative Quantification by Mass Spectrometry
2.14. Transmission Electron Microscopy
2.15. mtDNA Release in the Cytosol
2.16. Statistical Analysis
3. Results
3.1. Mitofilin−/− Mice Do Not Survive
3.2. Mitofilin+/− Heart Mitochondria Exhibit Impaired Mitochondrial Dynamics in Normal Conditions
3.3. Mitofilin+/− Hearts Display Reduced Functional Cardiac Recovery and Increased Myocardial Infarct Size after I/R
3.4. Mitofilin+/− Heart Mitochondria Exhibit Damaged Cristae after I/R
3.5. Mitofilin+/− Mice Mitochondria Display a Reduced Calcium Retention Capacity Required to Induce mPTP Opening after I/R
3.6. Mitochondria from Mitofilin+/− Mice Are More Uncoupled and Produce More Reactive Oxygen Species (ROS) Following I/R
3.7. Mitofilin+/− Mice Display Increased Mitochondrial DNA Release and Inflammatory Factors after Kidney IR Injury
3.8. Mitofilin+/− Mice Display Dysregulated SLC25As Solute Carrier Function after I/R
3.9. Mitofilin Knockdown Does Not Significantly Affect the Transcription of Protein in Mitochondria
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| I/R | ischemia/reperfusion |
| mtDNA | mitochondrial DNA |
| mPTP | mitochondrial permeability transition pore |
| CRC | calcium retention capacity |
| ROS | reactive oxygen species |
| MICOS | mitochondrial contact site and cristae organizing system |
| TTC | triphenyltetrazolium chloride |
| MMP | mitochondrial membrane potential |
| MFN2 | Mitofusin-2 |
| DRP1 | Dynamin-related protein 1 |
| OPA1 | Dominant optic atrophy1 |
| ICAM | intercellular adhesion molecule |
| IL-6 | Interleukin-6 |
| TNF-α | tumors necrosis factor α |
| SLC25A | Solute carrier family 25 |
| cGAS | Cyclic GMP–AMP synthase |
| STING | Stimulator of interferon genes |
| TBK1 | TANK-binding kinase 1 |
| TDP-43 | TAR DNA-binding protein 43 |
| HET | herezygote |
| VDAC | Voltage-dependent anion channels. |
| RIP3/RIPK3 | receptor-interacting protein kinase 3 |
References
- Weiss, J.N.; Korge, P.; Honda, H.M.; Ping, P. Role of the mitochondrial permeability transition in myocardial disease. Circ. Res. 2003, 93, 292–301. [Google Scholar] [CrossRef] [PubMed]
- Bopassa, J.C.; Ferrera, R.; Gateau-Roesch, O.; Couture-Lepetit, E.; Ovize, M. PI 3-kinase regulates the mitochondrial transition pore in controlled reperfusion and postconditioning. Cardiovasc. Res. 2006, 69, 178–185. [Google Scholar] [CrossRef]
- Feng, Y.; Madungwe, N.B.; Bopassa, J.C. Mitochondrial inner membrane protein, Mic60/mitofilin in mammalian organ protection. J. Cell Physiol. 2019, 234, 3383–3393. [Google Scholar] [CrossRef] [PubMed]
- Alam, M.R.; Baetz, D.; Ovize, M. Cyclophilin D and myocardial ischemia-reperfusion injury: A fresh perspective. J. Mol. Cell. Cardiol. 2015, 78, 80–89. [Google Scholar] [CrossRef]
- Baseler, W.A.; Dabkowski, E.R.; Williamson, C.L.; Croston, T.L.; Thapa, D.; Powell, M.J.; Razunguzwa, T.T.; Hollander, J.M. Proteomic alterations of distinct mitochondrial subpopulations in the type 1 diabetic heart: Contribution of protein import dysfunction. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 300, R186–R200. [Google Scholar] [CrossRef]
- Thapa, D.; Nichols, C.E.; Lewis, S.E.; Shepherd, D.L.; Jagannathan, R.; Croston, T.L.; Tveter, K.J.; Holden, A.A.; Baseler, W.A.; Hollander, J.M. Transgenic overexpression of mitofilin attenuates diabetes mellitus-associated cardiac and mitochondria dysfunction. J. Mol. Cell Cardiol. 2015, 79, 212–223. [Google Scholar] [CrossRef] [PubMed]
- Gorr, M.W.; Wold, L.E. Mitofilin: Key factor in diabetic cardiomyopathy? J. Mol. Cell Cardiol. 2015, 85, 292–293. [Google Scholar] [CrossRef]
- Odgren, P.R.; Toukatly, G.; Bangs, P.L.; Gilmore, R.; Fey, E.G. Molecular characterization of mitofilin (HMP), a mitochondria-associated protein with predicted coiled coil and intermembrane space targeting domains. J. Cell Sci. 1996, 109 Pt 9, 2253–2264. [Google Scholar] [CrossRef]
- Icho, T.; Ikeda, T.; Matsumoto, Y.; Hanaoka, F.; Kaji, K.; Tsuchida, N. A novel human gene that is preferentially transcribed in heart muscle. Gene 1994, 144, 301–306. [Google Scholar]
- Zerbes, R.M.; Van Der Klei, I.; Veenhuis, M.; Pfanner, N.; van der Laan, M.; Bohnert, M. Mitofilin complexes: Conserved organizers of mitochondrial membrane architecture. Biol. Chem. 2012, 393, 1247–1261. [Google Scholar] [CrossRef]
- von der Malsburg, K.; Muller, J.M.; Bohnert, M.; Oeljeklaus, S.; Kwiatkowska, P.; Becker, T.; Loniewska-Lwowska, A.; Wiese, S.; Rao, S.; Milenkovic, D.; et al. Dual role of mitofilin in mitochondrial membrane organization and protein biogenesis. Dev. Cell 2011, 21, 694–707. [Google Scholar] [CrossRef] [PubMed]
- Gieffers, C.; Korioth, F.; Heimann, P.; Ungermann, C.; Frey, J. Mitofilin is a transmembrane protein of the inner mitochondrial membrane expressed as two isoforms. Exp. Cell Res. 1997, 232, 395–399. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.F.; Zhao, G.W.; Liang, S.T.; Zhang, Y.; Sun, L.H.; Chen, H.Z.; Liu, D.P. Mitofilin regulates cytochrome c release during apoptosis by controlling mitochondrial cristae remodeling. Biochem. Biophys. Res. Commun. 2012, 428, 93–98. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Xu, J.; Luo, Y.X.; An, X.Z.; Zhang, R.; Liu, G.; Li, H.; Chen, H.Z.; Liu, D.P. Overexpression of mitofilin in the mouse heart promotes cardiac hypertrophy in response to hypertrophic stimuli. Antioxid. Redox Signal. 2014, 21, 1693–1707. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.S.; He, Q.; He, J.Q.; Chao, J.; Wang, W.Y.; Zhou, Y.; Lou, J.Z.; Kong, W.; Chen, J.F. The role of mitofilin in left ventricular hypertrophy in hemodialysis patients. Ren. Fail. 2018, 40, 252–258. [Google Scholar] [CrossRef]
- Tombo, N.; Imam Aliagan, A.D.; Feng, Y.; Singh, H.; Bopassa, J.C. Cardiac ischemia/reperfusion stress reduces inner mitochondrial membrane protein (mitofilin) levels during early reperfusion. Free. Radic. Biol. Med. 2020, 158, 181–194. [Google Scholar] [CrossRef] [PubMed]
- Ruprecht, J.J.; Kunji, E.R.S. The SLC25 Mitochondrial Carrier Family: Structure and Mechanism. Trends Biochem. Sci. 2020, 45, 244–258. [Google Scholar] [CrossRef]
- Palmieri, F. Mitochondrial transporters of the SLC25 family and associated diseases: A review. J. Inherit. Metab. Dis. 2014, 37, 565–575. [Google Scholar] [CrossRef]
- Wang, Y.J.; Khan, F.I.; Xu, Q.; Wei, D.Q. Recent Studies of Mitochondrial SLC25: Integration of Experimental and Computational Approaches. Curr. Protein Pept. Sci. 2018, 19, 507–522. [Google Scholar] [CrossRef]
- Hu, Q.; Zhou, Q.; Wu, J.; Wu, X.; Ren, J. The Role of Mitochondrial DNA in the Development of Ischemia Reperfusion Injury. Shock 2019, 51, 52–59. [Google Scholar] [CrossRef]
- Lee, Y.L.; Obiako, B.; Gorodnya, O.M.; Ruchko, M.V.; Kuck, J.L.; Pastukh, V.M.; Wilson, G.L.; Simmons, J.D.; Gillespie, M.N. Mitochondrial DNA Damage Initiates Acute Lung Injury and Multi-Organ System Failure Evoked in Rats by Intra-Tracheal Pseudomonas Aeruginosa. Shock 2017, 48, 54–60. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Ren, J.; Ren, H.; Wu, J.; Wu, X.; Liu, S.; Wang, G.; Gu, G.; Guo, K.; Li, J. Urinary Mitochondrial DNA Identifies Renal Dysfunction and Mitochondrial Damage in Sepsis-Induced Acute Kidney Injury. Oxid. Med. Cell. Longev. 2018, 2018, 8074936. [Google Scholar] [CrossRef] [PubMed]
- Jennings, R.B. Historical perspective on the pathology of myocardial ischemia/reperfusion injury. Circ. Res. 2013, 113, 428–438. [Google Scholar] [CrossRef]
- Bortolotti, D.; Gentili, V.; Caselli, E.; Sicolo, M.; Soffritti, I.; D’Accolti, M.; Barao, I.; Rotola, A.; Di Luca, D.; Rizzo, R. DNA Sensors’ Signaling in NK Cells During HHV-6A, HHV-6B and HHV-7 Infection. Front. MicroBiol. 2020, 11, 226. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.K.; Park, K.Y.; Choe, J.Y. Toll-Like Receptor 9 Is Involved in NLRP3 Inflammasome Activation and IL-1beta Production Through Monosodium Urate-Induced Mitochondrial DNA. Inflammation 2020, 43, 2301–2311. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Zhu, Q.; Zeng, J.; Gu, X.; Miao, Y.; Xu, W.; Lv, T.; Song, Y. Extracellular mitochondrial DNA promote NLRP3 inflammasome activation and induce acute lung injury through TLR9 and NF-kappaB. J. Thorac. Dis. 2019, 11, 4816–4828. [Google Scholar] [CrossRef]
- Flodin, N.W. Atherosclerosis: An insulin-dependent disease? J. Am. Coll Nutr. 1986, 5, 417–427. [Google Scholar] [CrossRef]
- Barrera, M.J.; Aguilera, S.; Castro, I.; Carvajal, P.; Jara, D.; Molina, C.; Gonzalez, S.; Gonzalez, M.J. Dysfunctional mitochondria as critical players in the inflammation of autoimmune diseases: Potential role in Sjogren’s syndrome. Autoimmun. Rev. 2021, 20, 102867. [Google Scholar] [CrossRef]
- Leite, J.A.; Pessenda, G.; Guerra-Gomes, I.C.; De Santana, A.K.M.; Pereira, C.A.; Costa, F.R.C.; Ramos, S.G.; Zamboni, D.S.; Faria, A.M.C.; De Almeida, D.C.; et al. The DNA Sensor AIM2 Protects against Streptozotocin-Induced Type 1 Diabetes by Regulating Intestinal Homeostasis via the IL-18 Pathway. Cells 2020, 9, 959. [Google Scholar] [CrossRef]
- Bopassa, J.C.; Eghbali, M.; Toro, L.; Stefani, E. A novel estrogen receptor GPER inhibits mitochondria permeability transition pore opening and protects the heart against ischemia-reperfusion injury. Am. J. Physiol. Heart Circ. Physiol. 2010, 298, H16–H23. [Google Scholar] [CrossRef]
- Bopassa, J.C. Critical role of mitochondrial ROS is dependent on their site of production on the electron transport chain in ischemic heart. Am. J. Cardiovasc. Dis. 2016, 6, 93–108. [Google Scholar]
- Feng, Y.; Bopassa, J.C. Oxygen surrounding the heart during ischemic conservation determines the myocardial injury during reperfusion. Am. J. Cardiovasc. Dis. 2015, 5, 127–139. [Google Scholar]
- Kabir, M.E.; Singh, H.; Lu, R.; Olde, B.; Leeb-Lundberg, L.M.; Bopassa, J.C. G Protein-Coupled Estrogen Receptor 1 Mediates Acute Estrogen-Induced Cardioprotection via MEK/ERK/GSK-3beta Pathway after Ischemia/Reperfusion. PLoS ONE 2015, 10, e0135988. [Google Scholar] [CrossRef]
- Rosa, I.D.; Camara, Y.; Durigon, R.; Moss, C.F.; Vidoni, S.; Akman, G.; Hunt, L.; Johnson, M.A.; Grocott, S.; Wang, L.; et al. MPV17 Loss Causes Deoxynucleotide Insufficiency and Slow DNA Replication in Mitochondria. PLoS Genet. 2016, 12, e1005779. [Google Scholar]
- Ferrera, R. Post-conditioning protects from cardioplegia and cold ischemia via inhibition of mitochondrial permeability transition pore. Am. J. Physiol. Heart Circ. Physiol. 2007, 26, 604–609. [Google Scholar] [CrossRef]
- Feng, Y.; Madungwe, N.B.; Imam Aliagan, A.D.; Tombo, N.; Bopassa, J.C. Liproxstatin-1 protects the mouse myocardium against ischemia/reperfusion injury by decreasing VDAC1 levels and restoring GPX4 levels. Biochem. Biophys. Res. Commun. 2019, 520, 606–611. [Google Scholar] [CrossRef]
- Bopassa, J.C.; Michel, P.; Gateau-Roesch, O.; Ovize, M.; Ferrera, R. Low-pressure reperfusion alters mitochondrial permeability transition. Am. J. Physiol. Heart Circ. Physiol. 2005, 288, H2750–H2755. [Google Scholar] [CrossRef] [PubMed]
- Aliagan, A.I.; Madungwe, N.B.; Tombo, N.; Feng, Y.; Bopassa, J.C. Chronic GPER1 Activation Protects Against Oxidative Stress-Induced Cardiomyoblast Death via Preservation of Mitochondrial Integrity and Deactivation of Mammalian Sterile-20-Like Kinase/Yes-Associated Protein Pathway. Front. Endocrinol 2020, 11, 579161. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.; Madungwe, N.B.; da Cruz Junho, C.V.; Bopassa, J.C. Activation of G protein-coupled oestrogen receptor 1 at the onset of reperfusion protects the myocardium against ischemia/reperfusion injury by reducing mitochondrial dysfunction and mitophagy. Br. J. Pharmacol. 2017, 174, 4329–4344. [Google Scholar] [CrossRef]
- Assaly, R.; de Tassigny, A.; Paradis, S.; Jacquin, S.; Berdeaux, A.; Morin, D. Oxidative stress, mitochondrial permeability transition pore opening and cell death during hypoxia-reoxygenation in adult cardiomyocytes. Eur. J. Pharmacol. 2012, 675, 6–14. [Google Scholar] [CrossRef]
- Mishra, J.; Davani, A.J.; Natarajan, G.K.; Kwok, W.M.; Stowe, D.F.; Camara, A.K.S. Cyclosporin A Increases Mitochondrial Buffering of Calcium: An Additional Mechanism in Delaying Mitochondrial Permeability Transition Pore Opening. Cells 2019, 8, 1052. [Google Scholar] [CrossRef]
- Baines, C.P.; Molkentin, J.D. STRESS signaling pathways that modulate cardiac myocyte apoptosis. J. Mol. Cell. Cardiol. 2005, 38, 47–62. [Google Scholar] [CrossRef] [PubMed]
- Baines, C.P. The mitochondrial permeability transition pore and ischemia-reperfusion injury. Basic Res. Cardiol. 2009, 104, 181–188. [Google Scholar] [CrossRef] [PubMed]
- Das, D.K.; Maulik, N.; Sato, M.; Ray, P.S. Reactive oxygen species function as second messenger during ischemic preconditioning of heart. Mol. Cell Biochem. 1999, 196, 59–67. [Google Scholar] [CrossRef] [PubMed]
- Anderson, S.; Bankier, A.T.; Barrell, B.G.; de Bruijn, M.H.; Coulson, A.R.; Drouin, J.; Eperon, I.C.; Nierlich, D.P.; Roe, B.A.; Sanger, F.; et al. Sequence and organization of the human mitochondrial genome. Nature 1981, 290, 457–465. [Google Scholar] [CrossRef]
- Byrnes, J.; Garcia-Diaz, M. Mitochondrial transcription: How does it end? Transcription 2011, 2, 32–36. [Google Scholar] [CrossRef]
- El-Hattab, A.W.; Suleiman, J.; Almannai, M.; Scaglia, F. Mitochondrial dynamics: Biological roles, molecular machinery, and related diseases. Mol. Genet. Metab. 2018, 125, 315–321. [Google Scholar] [CrossRef]
- El-Hattab, A.W.; Scaglia, F. Mitochondrial cytopathies. Cell Calcium 2016, 60, 199–206. [Google Scholar] [CrossRef]
- Bopassa, J.C. Mitochondrial Inner Membrane Protein (Mitofilin) Knockdown Induces Cell Death by Apoptosis Via an AIF-PARP-Dependent Mechanism and Cell Cycle Arrest. Br. J. Pharmacol. 2018, 315, C28–C43. [Google Scholar]
- Feng, Y.; Imam Aliagan, A.; Tombo, N.; Draeger, D.; Bopassa, J.C. RIP3 Translocation into Mitochondria Promotes Mitofilin Degradation to Increase Inflammation and Kidney Injury after Renal Ischemia-Reperfusion. Cells 2022, 11, 1894. [Google Scholar] [CrossRef]
- Yu, C.H.; Davidson, S.; Harapas, C.R.; Hilton, J.B.; Mlodzianoski, M.J.; Laohamonthonkul, P.; Louis, C.; Low, R.R.J.; Moecking, J.; De Nardo, D.; et al. TDP-43 Triggers Mitochondrial DNA Release via mPTP to Activate cGAS/STING in ALS. Cell 2020, 183, 636–649.e18. [Google Scholar] [CrossRef]
- Qin, C.Y.; Zhang, H.W.; Gu, J.; Xu, F.; Liang, H.M.; Fan, K.J.; Shen, J.Y.; Xiao, Z.H.; Zhang, E.Y.; Hu, J. Mitochondrial DNAinduced inflammatory damage contributes to myocardial ischemia reperfusion injury in rats: Cardioprotective role of epigallocatechin. Mol. Med. Rep. 2017, 16, 7569–7576. [Google Scholar] [CrossRef]
- Boulet, A.; Vest, K.E.; Maynard, M.K.; Gammon, M.G.; Russell, A.C.; Mathews, A.T.; Cole, S.E.; Zhu, X.; Phillips, C.B.; Kwong, J.Q.; et al. The mammalian phosphate carrier SLC25A3 is a mitochondrial copper transporter required for cytochrome c oxidase biogenesis. J. Biol. Chem. 2018, 293, 1887–1896. [Google Scholar] [CrossRef] [PubMed]
- Haitina, T.; Lindblom, J.; Renstrom, T.; Fredriksson, R. Fourteen novel human members of mitochondrial solute carrier family 25 (SLC25) widely expressed in the central nervous system. Genomics 2006, 88, 779–790. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.S.; Lee, H.; Lee, S.; Kang, J.H.; Lee, S.H.; Kim, S.G.; Cho, E.S.; Kim, N.H.; Yook, J.I.; Kim, S.Y. Loss of SLC25A11 causes suppression of NSCLC and melanoma tumor formation. EBioMedicine 2019, 40, 184–197. [Google Scholar] [CrossRef] [PubMed]
- Goubert, E.; Mircheva, Y.; Lasorsa, F.M.; Melon, C.; Profilo, E.; Sutera, J.; Becq, H.; Palmieri, F.; Palmieri, L.; Aniksztejn, L.; et al. Inhibition of the Mitochondrial Glutamate Carrier SLC25A22 in Astrocytes Leads to Intracellular Glutamate Accumulation. Front. Cell. NeuroSci. 2017, 11, 149. [Google Scholar] [CrossRef]
- Huang, Z.; Chen, Y.; Zhang, Y. Mitochondrial reactive oxygen species cause major oxidative mitochondrial DNA damages and repair pathways. J. BioSci. 2020, 45, 84. [Google Scholar] [CrossRef] [PubMed]
- Nissanka, N.; Moraes, C.T. Mitochondrial DNA damage and reactive oxygen species in neurodegenerative disease. FEBS Lett. 2018, 592, 728–742. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, A.A.; Rashad, R.M.; El-Hadidy, W.F. Thymoquinone protects against cardiac mitochondrial DNA loss, oxidative stress, inflammation and apoptosis in isoproterenol-induced myocardial infarction in rats. Heliyon 2021, 7, e07561. [Google Scholar] [CrossRef]
- Riley, J.S.; Tait, S.W. Mitochondrial DNA in inflammation and immunity. EMBO Rep. 2020, 21, e49799. [Google Scholar] [CrossRef]
- Guo, Y.; Gu, R.; Gan, D.; Hu, F.; Li, G.; Xu, G. Mitochondrial DNA drives noncanonical inflammation activation via cGAS-STING signaling pathway in retinal microvascular endothelial cells. Cell Commun. Signal 2020, 18, 172. [Google Scholar] [CrossRef] [PubMed]










| Antibody Target | Supplier | Catalog | Concentration |
|---|---|---|---|
| Mitofilin/Mic60 | Proteintech Group | 10179-1-AP | 1 µg/mL |
| MIA40 | Proteintech Group | 21090-1-AP | 1 µg/mL |
| OPA1 | Proteintech Group | 27733-1-AP | 1 µg/mL |
| MFN2 | Cell Signaling Technology | 9482S | 1 µg/mL |
| CYPD | Thermo Fisher | 455900 | 1 µg/mL |
| VDAC1 | EMD | MABN504 | 1 µg/mL |
| DRP1 | Cell Signaling Technology | 5391s | 1ug/ml |
| IRDye 800CW Goat anti-Rabbit | LI-COR | 926-32211 | 0.1 µg/mL |
| IRDye 680RD Goat anti-Mouse | LI-COR | 926-68070 | 0.1 µg/mL |
| Name | Primer Target | Sequence 5′ TO 3′ | Supplier |
|---|---|---|---|
| ATP6 | ATP6 CV f | TCCCAATCGTTGTAGCCATCA | Eurofins Genomics LLC |
| ATP6 CV r | AGACGGTTGTTGATTAGGCGT | ||
| COX 1 | COX 1 f | ATCACTACCAGTGCTAGCCG | Eurofins Genomics LLC |
| COX 1 r | CCTCCAGCGGGATCAAAGAA | ||
| COX 2 | COX 2 f | ACCTGGTGAACTACGACTGCT | Eurofins Genomics LLC |
| COX 2 r | TCCTAGGGAGGGGACTGCTC | ||
| COX 3 | COX 3 f | CCAAGGCCACCACACTCCTA | Eurofins Genomics LLC |
| COX 3 r | GGTCAGCAGCCTCCTAGATCA | ||
| CYTB | CYTB f | GGCTACGTCCTTCCATGAGG | Eurofins Genomics LLC |
| CYTB r | TGGGATGGCTGATAGGAGGT | ||
| ND 1 | ND 1 f | CTAGCAGAAACAAACCGGGC | Eurofins Genomics LLC |
| ND 1 r | CCGGCTGCGTATTCTACGTT | ||
| ND 2 | ND 2 f | CCTCCTGGCCATCGTACTCA | Eurofins Genomics LLC |
| ND 2 r | GAATGGGGCGAGGCCTAGTT | ||
| ND 3 | ND 3 f | TAGTTGCATTCTGACTCCCCCA | Eurofins Genomics LLC |
| ND 3 r | GAGAATGGTAGACGTGCAGAGC | ||
| ND 4 | ND 4 f | CGCCTACTCCTCAGTTAGCCA | Eurofins Genomics LLC |
| ND 4 r | TGATGTGAGGCCATGTGCGA | ||
| ND 4L | ND 4L f | AGCTCCATACCAATCCCCATCAC | Eurofins Genomics LLC |
| ND 4L r | GGACGTAATCTGTTCCGTACGTGT | ||
| ND 5 | ND 5 f | GGCCCTACACCAGTTTCAGC | Eurofins Genomics LLC |
| ND 5 r | AGGGCTCCGAGGCAAAGTAT | ||
| ND 6 | ND 6 f | CTTGATGGTTTGGGAGATTGG | Eurofins Genomics LLC |
| ND 6 r | ACCCGCAAACAAAGATCACC | ||
| TFAM | TFAM f | GCCCGGCAGAGACGGTTAAA | Eurofins Genomics LLC |
| TFAM r | GCCGAATCATCCTTTGCCTCC | ||
| Slc25A3 | Slc25a3 f | TGACATTTGTGGCAGGTTACA | Eurofins Genomics LLC |
| Slc25a3 r | AGTCAGCAGGGTGGGAGAC | ||
| Slc25A5 | Slc25a5 f | GATGCCGCTGTGTCCTTC | Eurofins Genomics LLC |
| Slc25a5 r | TATCTGCCGTGATTTGCTTG | ||
| Slc25A11 | Slc25a11 f | CCCGTACCTCCCCTAAGTCT | Eurofins Genomics LLC |
| Slc25a11 r | AACTGCATCCGGTTCTTCAC | ||
| Slc25A13 | Slc25a13 f | TCCCACTTTTGGCAGAGATT | Eurofins Genomics LLC |
| Slc25a13 r | CGGATTTTCACAATCTCTAAAGG | ||
| Slc25A20 | Slc25a20 f | GGTGTGTTCACCACAGGAATCA | Eurofins Genomics LLC |
| Slc25a20 r | CCCCTGAAGAAGCCTGAAT | ||
| Slc25A22 | Slc25a22 f | TGCTTGAGGTCTTTGTGTGC | Eurofins Genomics LLC |
| Slc25a22 r | CTTATGGGTCCCCATCCCTA | ||
| Slc25A42 | Slc25a42 f | AGCAGGTTGCACCATGTAGA | Eurofins Genomics LLC |
| Slc25a42 r | GAAGATCAGGGACCCAGGAC | ||
| D-LOOP | D-LOOP f | CCAGTCTTAAACCGGAGA | Eurofins Genomics LLC |
| D-LOOP r | CTATCACCCTATTAACCACTC | ||
| TNF-α | TNF-α f | GAGAAAGTCAACCTCCTCTCTG | Eurofins Genomics LLC |
| TNF-α r | GAAGACTCCTCCCAGGTATATG | ||
| IL-6 | IL-6 f | TAGTCCTTCCTACCCCAATTTCC | Eurofins Genomics LLC |
| IL-6 r | TTGGTCCTTAGCCACTCCTTC | ||
| ICAM-1 | ICAM-1 f | GTGATGCTCAGGTATCCATCCA | Eurofins Genomics LLC |
| ICAM-1 r | CACAGTTCTCAAAGCACAGCG | ||
| 18S | 18S f | CGGCTACCACATCCAAGGAA | Eurofins Genomics LLC |
| 18S r | GCTGGAATTACCGCGGCT | ||
| Mic60 | Mic60 f | TAAGCAGTACCGCCATGTCTTCTGTCAAGTTATGGCC | Eurofins Genomics LLC |
| Mic60 r | TGCTTAGCGGCCGCACGCGTCTTGTGGAAGGGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, Y.; Imam Aliagan, A.; Tombo, N.; Bopassa, J.C. Mitofilin Heterozygote Mice Display an Increase in Myocardial Injury and Inflammation after Ischemia/Reperfusion. Antioxidants 2023, 12, 921. https://doi.org/10.3390/antiox12040921
Feng Y, Imam Aliagan A, Tombo N, Bopassa JC. Mitofilin Heterozygote Mice Display an Increase in Myocardial Injury and Inflammation after Ischemia/Reperfusion. Antioxidants. 2023; 12(4):921. https://doi.org/10.3390/antiox12040921
Chicago/Turabian StyleFeng, Yansheng, Abdulhafiz Imam Aliagan, Nathalie Tombo, and Jean C. Bopassa. 2023. "Mitofilin Heterozygote Mice Display an Increase in Myocardial Injury and Inflammation after Ischemia/Reperfusion" Antioxidants 12, no. 4: 921. https://doi.org/10.3390/antiox12040921
APA StyleFeng, Y., Imam Aliagan, A., Tombo, N., & Bopassa, J. C. (2023). Mitofilin Heterozygote Mice Display an Increase in Myocardial Injury and Inflammation after Ischemia/Reperfusion. Antioxidants, 12(4), 921. https://doi.org/10.3390/antiox12040921

