A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon
Abstract
1. Introduction
2. Materials and Methods
2.1. Mesocosm Sampling Site
2.2. Water Sampling
2.3. Assay Design
2.4. Primer and Probes Validation on Positive Tissue Samples
2.5. qPCR Assay Set Up
2.6. eDNA-Based Detection in Environmental Samples
3. Results
3.1. Initial qPCR Assays Testing
3.2. eDNA Detection in Environmental Samples
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Kottelat, M.; Freyhof, J. Handbook of European Freshwater Fishes; Publications Kottelat: Cornol, Switzerland, 2007; Volume 13. [Google Scholar]
- Wolter, C.; Buijse, A.D.; Parasiewicz, P. Temporal and Spatial Patterns of Fish Response to Hydromorphological Processes. River Res. Appl. 2016, 32, 190–201. [Google Scholar] [CrossRef] [Scilit]
- Friedrich, T.; Reinartz, R.; Gessner, J. Sturgeon re-introduction in the Upper and Middle Danube River Basin. J. Appl. Ichthyol. 2019, 35, 1059–1068. [Google Scholar] [CrossRef] [Scilit]
- Freyhof, J.; Bergner, L.; Ford, M. Threatened Freshwater Fishes of the Mediterranean Basin Biodiversity Hotspot: Distribution, Extinction Risk and the Impact of Hydropower; Museum für Naturkunde Berlin (MfN): Berlin, Germany, 2020. [Google Scholar]
- Jourdan, J.; Plath, M.; Tonkin, J.D.; Ceylan, M.; Dumeier, A.C.; Gellert, G.; Graf, W.; Hawkins, C.P.; Kiel, E.; Lorenz, A.W.; et al. Reintroduction of freshwater macroinvertebrates: Challenges and opportunities. Biol. Rev. 2019, 94, 368–387. [Google Scholar] [CrossRef] [Scilit]
- Antognazza, C.; Vanetti, I.; De Santis, V.; Bellani, A.; Di Francesco, M.; Puzzi, C.M.; Casoni, A.G.; Zaccara, S. Genetic Investigation of Four Beluga Sturgeon (Huso huso, L.) Broodstocks for its Reintroduction in the Po River Basin. Environments 2021, 8, 25. [Google Scholar] [CrossRef] [Scilit]
- Laramie, M.B.; Pilliod, D.S.; Goldberg, C.S. Characterizing the distribution of an endangered salmonid using environmental DNA analysis. Biol. Conserv. 2015, 183, 29–37. [Google Scholar] [CrossRef] [Scilit]
- Deiner, K.; Bik, H.M.; Mächler, E.; Seymour, M.; Lacoursière-Roussel, A.; Altermatt, F.; Creer, S.; Bista, I.; Lodge, D.M.; de Vere, N.; et al. Environmental DNA metabarcoding: Transforming how we survey animal and plant communities. Mol. Ecol. 2017, 26, 5872–5895. [Google Scholar] [CrossRef] [Scilit]
- Ruppert, K.M.; Kline, R.J.; Rahman, S. Past, present, and future perspectives of environmental DNA (eDNA) metabarcoding: A systematic review in methods, monitoring, and applications of global eDNA. Glob. Ecol. Conserv. 2019, 17, e00547. [Google Scholar] [CrossRef] [Scilit]
- Antognazza, C.M.; Britton, J.R.; Potter, C.; Franklin, E.; Hardouin, E.A.; Roberts, C.G.; Aprahamian, M.; Andreou, D. Environmental DNA as a non-invasive sampling tool to detect the spawning distribution of European anadromous shads (Alosa spp.). Aquat. Conserv. Mar. Freshw. Ecosyst. 2019, 29, 148–152. [Google Scholar] [CrossRef] [Scilit]
- Carim, K.J.; Dysthe, J.C.S.; Young, M.K.; McKelvey, K.S.; Schwartz, M.K. An environmental DNA assay for detecting Arctic grayling in the upper Missouri River basin, North America. Conserv. Genet. Resour. 2016, 8, 197–199. [Google Scholar] [CrossRef] [Scilit]
- Jensen, M.R.; Knudsen, S.W.; Munk, P.; Thomsen, P.F.; Møller, P.R. Tracing European eel in the diet of mesopelagic fishes from the Sargasso Sea using DNA from fish stomachs. Mar. Biol. 2018, 165, 130. [Google Scholar] [CrossRef] [Scilit]
- Levi, T.; Allen, J.M.; Bell, D.; Joyce, J.; Russell, J.R.; Tallmon, D.A.; Vulstek, S.C.; Yang, C.; Yu, D.W. Environmental DNA for the enumeration and management of Pacific salmon. Mol. Ecol. Resour. 2019, 19, 597–608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bergman, P.S.; Schumer, G.; Blankenship, S.; Campbell, E. Detection of adult green sturgeon using environmental DNA analysis. PLoS ONE 2016, 11, e0153500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farrington, H.L.; Lance, R.F. Development of Genetic Markers for Environmental DNA (eDNA) Monitoring of Sturgeon; Engineer Research and Development Center (U.S.): Vicksburg, MS, USA, 2014. [Google Scholar]
- Janosik, A.M.; Whitaker, J.M.; VanTassel, N.M.; Rider, S.J. Improved environmental DNA sampling scheme for Alabama sturgeon provides new insight into a species once presumed extinct. J. Appl. Ichthyol. 2021, 37, 178–185. [Google Scholar] [CrossRef] [Scilit]
- Pfleger, M.O.; Rider, S.J.; Johnston, C.E.; Janosik, A.M. Saving the doomed: Using eDNA to aid in detection of rare sturgeon for conservation (Acipenseridae). Glob. Ecol. Conserv. 2016, 8, 99–107. [Google Scholar] [CrossRef] [Scilit]
- Yusishen, M.E.; Eichorn, F.-C.; Anderson, W.G.; Docker, M.F. Development of quantitative PCR assays for the detection and quantification of lake sturgeon (Acipenser fulvescens) environmental DNA. Conserv. Genet. Resour. 2018, 12, 17–19. [Google Scholar] [CrossRef] [Scilit]
- Rees, H.C.; Maddison, B.C.; Middleditch, D.J.; Patmore, J.R.; Gough, K.C. REVIEW: The detection of aquatic animal species using environmental DNA—A review of eDNA as a survey tool in ecology. J. Appl. Ecol. 2014, 51, 1450–1459. [Google Scholar] [CrossRef] [Scilit]
- QGIS.org. QGIS Geographic Information System. QGIS Association. 2024. Available online: http://www.qgis.org (accessed on 5 April 2024).
- Thomas, A.C.; Tank, S.; Nguyen, P.L.; Ponce, J.; Sinnesael, M.; Goldberg, C.S. A system for rapid eDNA detection of aquatic invasive species. Environ. DNA 2020, 2, 261–270. [Google Scholar] [CrossRef] [Scilit]
- Thomas, A.C.; Nguyen, P.L.; Howard, J.; Goldberg, C.S. A self-preserving, partially biodegradable eDNA filter. Methods Ecol. Evol. 2019, 10, 1136–1141. [Google Scholar] [CrossRef] [Scilit]
- Kibbe, W.A. OligoCalc: An online oligonucleotide properties calculator. Nucleic Acids Res. 2007, 35, W43–W46. [Google Scholar] [CrossRef] [Scilit]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Scilit]
- Madden, T. The BLAST sequence analysis tool. In The NCBI Handbook; National Center for Biotechnology Information: Bethesda, MD, USA, 2013; Volume 2, pp. 425–436. [Google Scholar]
- Bustin, S.A. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments; Series The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments; Oxford University Press: Oxford, UK, 2009. [Google Scholar]
- Klymus, K.E.; Merkes, C.M.; Allison, M.J.; Goldberg, C.S.; Helbing, C.C.; Hunter, M.E.; Jackson, C.A.; Lance, R.F.; Mangan, A.M.; Monroe, E.M.; et al. Reporting the limits of detection and quantification for environmental DNA assays. Environ. DNA 2020, 2, 271–282. [Google Scholar] [CrossRef] [Scilit]
- Zerunian, S. Problematiche di conservazione dei Pesci d’acqua dolce italiani. Biol. Ambient. 2007, 21, 49–55. [Google Scholar]
- Springer, K.B. Biology, conservation and sustainable development of sturgeons. In Fish & Fisheries Series (FIFI); Springer: Dordrecht, The Netherlands, 2010; Volume 29. [Google Scholar]
- Plough, L.V.; Bunch, A.J.; Lee, B.B.; Fitzgerald, C.L.; Stence, C.P.; Richardson, B. Development and testing of an environmental DNA (eDNA) assay for endangered Atlantic sturgeon to assess its potential as a monitoring and management tool. Environ. DNA 2021, 3, 800–814. [Google Scholar] [CrossRef] [Scilit]
- Pilliod, D.S.; Goldberg, C.S.; Arkle, R.S.; Waits, L.P. Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples. Can. J. Fish. Aquat. Sci. 2013, 70, 1123–1130. [Google Scholar] [CrossRef] [Scilit]
- Takahara, T.; Minamoto, T.; Yamanaka, H.; Doi, H.; Kawabata, Z. Estimation of fish biomass using environmental DNA. PLoS ONE 2012, 7, e35868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilcox, T.M.; McKelvey, K.S.; Young, M.K.; Sepulveda, A.J.; Shepard, B.B.; Jane, S.F.; Whiteley, A.R.; Lowe, W.H.; Schwartz, M.K. Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis. Biol. Conserv. 2016, 194, 209–216. [Google Scholar] [CrossRef] [Scilit]
- Pont, D.; Rocle, M.; Valentini, A.; Civade, R.; Jean, P.; Maire, A.; Roset, N.; Schabuss, M.; Zornig, H.; Dejean, T. Environmental DNA reveals quantitative patterns of fish biodiversity in large rivers despite its downstream transportation. Sci. Rep. 2018, 8, 10361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jane, S.F.; Wilcox, T.M.; McKelvey, K.S.; Young, M.K.; Schwartz, M.K.; Lowe, W.H.; Letcher, B.H.; Whiteley, A.R. Distance, flow and PCR inhibition: eDNA dynamics in two headwater streams. Mol. Ecol. Resour. 2015, 15, 216–227. [Google Scholar] [CrossRef] [Scilit]
- Jerde, C.L.; Olds, B.P.; Shogren, A.J.; Andruszkiewicz, E.A.; Mahon, A.R.; Bolster, D.; Tank, J.L. Influence of stream bottom substrate on retention and transport of vertebrate environmental DNA. Environ. Sci. Technol. 2016, 50, 8770–8779. [Google Scholar] [CrossRef] [Scilit]
- Roussel, J.-M.; Paillisson, J.; Tréguier, A.; Petit, E. The downside of eDNA as a survey tool in water bodies. J. Appl. Ecol. 2015, 52, 823–826. [Google Scholar] [CrossRef] [Scilit]
- Mettee, M.F.; O’Neil, P.E.; Rider, S.J. Paddlefish Movements in the Lower Mobile River Basin, Alabama. Am. Fish. Soc. Symp. 2009, 66, 63–81. [Google Scholar]
- McGarvey, D.J.; Ward, G.M. Scale dependence in the species-discharge relationship for fishes of the southeastern USA. Freshw. Biol. 2008, 53, 2206–2219. [Google Scholar] [CrossRef] [Scilit]
- Turner, C.R.; Uy, K.L.; Everhart, R.C. Fish environmental DNA is more concentrated in aquatic sediments than surface water. Biol. Conserv. 2015, 183, 93–102. [Google Scholar] [CrossRef] [Scilit]
- Shaw, J.L.A.; Clarke, L.J.; Wedderburn, S.D.; Barnes, T.C.; Weyrich, L.S.; Cooper, A. Comparison of environmental DNA metabarcoding and conventional fish survey methods in a river system. Biol. Conserv. 2016, 197, 131–138. [Google Scholar] [CrossRef] [Scilit]
- Bunch, A.J.; Carlson, K.B.; Hoogakker, F.J.; Plough, L.V.; Evans, H.K. Atlantic sturgeon (Acipenser oxyrinchus oxyrinchus Mitchill, 1815) early life stage consumption evidenced by high-throughput DNA sequencing. J. Appl. Ichthyol. 2021, 37, 12–19. [Google Scholar] [CrossRef] [Scilit]
- Congiu, L.; Boscari, E.; Pagani, S.; Gazzola, M.; Bronzi, P. Resumption of natural reproduction of the Adriatic sturgeon in the River Po. Oryx 2021, 55, 816. [Google Scholar] [CrossRef] [Scilit]
- Puzzi, C.M.; Trasforini, S.; Sartorelli, M.; Tamborini, D. Ticino River ecological corridor restoring and monitoring. Ital. J. Freshw. Ichthyol. 2017, 4, 9–24. [Google Scholar]
- Antognazza, C.M.; Britton, J.R.; De Santis, V.; Kolia, K.; Turunen, O.A.; Davies, P.; Allen, L.; Hardouin, E.A.; Crundwell, C.; Andreou, D. Environmental DNA reveals the temporal and spatial extent of spawning migrations of European shad in a highly fragmented river basin. Aquat. Conserv. Mar. Freshw. Ecosyst. 2021, 31, 2029–2040. [Google Scholar] [CrossRef] [Scilit]
- Ogburn, M.B.; Plough, L.V.; Bangley, C.W.; Fitzgerald, C.L.; Hannam, M.P.; Lee, B.; Marafino, G.; Richie, K.D.; Williams, M.R.; Weller, D.E. Environmental DNA reveals anadromous river herring habitat use and recolonization after restoration of aquatic connectivity. Environ. DNA 2023, 5, 25–37. [Google Scholar] [CrossRef] [Scilit]
- Bracken, F.S.; Hoelzel, A.R.; Hume, J.B.; Lucas, M.C. Contrasting population genetic structure among freshwater-resident and anadromous lampreys: The role of demographic history, differential dispersal and anthropogenic barriers to movement. Mol. Ecol. 2015, 24, 1188–1204. [Google Scholar] [CrossRef] [Scilit]
- Plough, L.V.; Ogburn, M.B.; Fitzgerald, C.L.; Geranio, R.; Marafino, G.A.; Richie, K.D. Environmental DNA analysis of river herring in Chesapeake Bay: A powerful tool for monitoring threatened keystone species. PLoS ONE 2018, 13, e0205578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ratcliffe, F.C.; Webster, T.M.U.; de Leaniz, C.G.; Consuegra, S. A drop in the ocean: Monitoring fish communities in spawning areas using environmental DNA. Environ. DNA 2021, 3, 43–54. [Google Scholar] [CrossRef] [Scilit]
- Duda, J.J.; Hoy, M.S.; Chase, D.M.; Pess, G.R.; Brenkman, S.J.; McHenry, M.M.; Ostberg, C.O. Environmental DNA is an effective tool to track recolonizing migratory fish following large-scale dam removal. Environ. DNA 2021, 3, 121–141. [Google Scholar] [CrossRef] [Scilit]
- Tillotson, M.D.; Kelly, R.P.; Duda, J.J.; Hoy, M.; Kralj, J.; Quinn, T.P. Concentrations of environmental DNA (eDNA) reflect spawning salmon abundance at fine spatial and temporal scales. Biol. Conserv. 2018, 220, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Thalinger, B.; Wolf, E.; Traugott, M.; Wanzenböck, J. Monitoring spawning migrations of potamodromous fish species via eDNA. Sci. Rep. 2019, 9, 15388. [Google Scholar] [CrossRef] [Scilit]




| Primer Name | Sequence (5′-3′) | Amplicon | qPCR Conditions |
|---|---|---|---|
| NacFw | GTCACACAAATCCTAACAGGACT | ||
| NacProbe | [FAM]TTCAACAGCCTTCTCCTCTGTTGC[MGBEQ] | 156 bp | 60 °C 45 s. 45 cycles |
| NacRev | TATATACTATGGTTCATACCTCC | ||
| HusFw | AGTAACATTCCACCCATAC | ||
| HusProbe | [FAM]ATTCATCCTAATGTTAGTTGGGC[MGBEQ] | 120 bp | 58 °C 60 s. 45 cycles |
| HusRev | CCAGACAACTTCACACC |
| Acipenser naccarii | Huso huso | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| ID | Type | Distnacc (m) | Ct | [eDNA] | DNA Copies | Disthuso (m) | Ct | [eDNA] | DNA Copies |
| S1 | Column | - | 32 (3/6) | 0.1027 | 3.79 × 1031 | - | 30 (3/6) | 0.0809 | 9.28 × 1034 |
| Benthic | 31 (6/6) | 0.1787 | 4.12 × 1033 | 30 (6/6) | 0.0885 | 1.82 × 1035 | |||
| S2 | Column | - | 31 (4/6) | 0.1267 | 2.25 × 1032 | 0 | 32 (4/6) | 0.0214 | 4.43 × 1030 |
| Benthic | 30 (6/6) | 0.2623 | 1.06 × 1035 | 31 (6/6) | 0.0384 | 5.80 × 1032 | |||
| 15c | Column | 0 | 31 (6/6) | 0.1298 | 2.76 × 1032 | 450 | 31 (6/6) | 0.0427 | 7.81 × 1032 |
| 15b | Benthic | 31 (6/6) | 0.1740 | 3.29 × 1033 | 32 (6/6) | 0.0267 | 2.32 × 1031 | ||
| 16c | Column | 50 | 44 (0/6) | - | - | 500 | 33 (6/6) | 0.0182 | 1.33 × 1030 |
| 16b | Benthic | 44 (0/6) | - | - | 40 (0/6) | - | - | ||
| 17c | Column | 100 | 35 (6/6) | 0.0192 | 2.55 × 1025 | 550 | 33 (6/6) | 0.0193 | 2.08 × 1030 |
| 17b | Benthic | 36 (6/6) | 0.0114 | 3.19 × 1023 | 34 (6/6) | 0.0064 | 5.27 × 1026 | ||
| 1c | Column | 150 | 35 (6/6) | 0.0211 | 5.74 × 1025 | 600 | 39 (5/6) | 0.0004 | 2.29 × 1017 |
| 1b | Benthic | 35 (6/6) | 0.0158 | 4.99 × 1024 | 40 (0/6) | - | - | ||
| 2c | Column | 250 | 36 (4/6) | 0.0107 | 1.84 × 1023 | 700 | 35 (6/6) | 0.0044 | 3.30 × 1025 |
| 2b | Benthic | 36 (6/6) | 0.0091 | 4.67 × 1022 | 35 (6/6) | 0.0037 | 8.25 × 1024 | ||
| 3c | Column | 400 | 36 (6/6) | 0.0112 | 2.77 × 1023 | 850 | 38 (3/6) | 0.0007 | 2.08 × 1019 |
| 3b | Benthic | 36 (3/6) | 0.0099 | 9.87 × 1022 | 40 (0/6) | - | - | ||
| 4c | Column | 600 | 34 (6/6) | 0.0260 | 3.44 × 1026 | 1050 | 36 (5/6) | 0.0025 | 4.90 × 1023 |
| 4b | Benthic | 34 (6/6) | 0.0318 | 1.85 × 1027 | 35 (6/6) | 0.0038 | 1.11 × 1025 | ||
| 5c | Column | 800 | 37 (6/6) | 0.0083 | 2.23 × 1022 | 1250 | 36 (6/6) | 0.0028 | 1.03 × 1024 |
| 5b | Benthic | 34 (6/6) | 0.0314 | 1.67 × 1027 | 35 (6/6) | 0.0047 | 5.61 × 1025 | ||
| 6c | Column | 1000 | 35 (6/6) | 0.0212 | 6.06 × 1025 | 1450 | 35 (5/6) | 0.0044 | 3.05 × 1025 |
| 6b | Benthic | 34 (6/6) | 0.0365 | 5.94 × 1027 | 35 (6/6) | 0.0047 | 5.62 × 1023 | ||
| 7c | Column | 1250 | 36 (6/6) | 0.0115 | 3.50 × 1023 | 1650 | 36 (5/6) | 0.0026 | 6.41 × 1023 |
| 7b | Benthic | 34 (6/6) | 0.0266 | 4.06 × 1026 | 39 (4/6) | 0.0005 | 4.48 × 1018 | ||
| 8c | Column | 1500 | 32 (6/6) | 0.1061 | 5.00 × 1031 | 1950 | 34 (1/6) | 0.0067 | 7.78 × 1026 |
| 8b | Benthic | 36 (6/6) | 0.0134 | 1.27 × 1024 | 36 (2/6) | 0.0019 | 5.41 × 1022 | ||
| 9c | Column | 2000 | 33 (6/6) | 0.0453 | 3.73 × 1028 | 2450 | 40 (0/6) | - | - |
| 9b | Benthic | 34 (6/6) | 0.0347 | 3.87 × 1027 | 40 (0/6) | - | - | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Antognazza, C.M.; Ramazzotti, F.; Bruno, A.; Galimberti, A.; Di Francesco, M.; Zaccara, S. A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon. Environments 2024, 11, 160. https://doi.org/10.3390/environments11080160
Antognazza CM, Ramazzotti F, Bruno A, Galimberti A, Di Francesco M, Zaccara S. A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon. Environments. 2024; 11(8):160. https://doi.org/10.3390/environments11080160
Chicago/Turabian StyleAntognazza, Caterina Maria, Fausto Ramazzotti, Antonia Bruno, Andrea Galimberti, Monica Di Francesco, and Serena Zaccara. 2024. "A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon" Environments 11, no. 8: 160. https://doi.org/10.3390/environments11080160
APA StyleAntognazza, C. M., Ramazzotti, F., Bruno, A., Galimberti, A., Di Francesco, M., & Zaccara, S. (2024). A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon. Environments, 11(8), 160. https://doi.org/10.3390/environments11080160

