Next Article in Journal
Honeybees and the One Health Approach
Previous Article in Journal
A Review of Grease Trap Waste Management in the US and the Upcycle as Feedstocks for Alternative Diesel Fuels
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon

by
Caterina Maria Antognazza
1,*,
Fausto Ramazzotti
2,3,
Antonia Bruno
2,
Andrea Galimberti
2,3,
Monica Di Francesco
4 and
Serena Zaccara
1
1
Department of Theoretical and Applied Sciences, University of Insubria, Via H. Dunant 3, 21100 Varese, Italy
2
Department of Biotechnology and Biosciences, University of Milano-Bicocca, P.za Della Scienza 2, 20126 Milan, Italy
3
National Biodiversity Future Centre, 90133 Palermo, Italy
4
Settore Fauna—Parco Lombardo della Valle del Ticino, Via Isonzo 1, 20013 Pontevecchio di Magenta, Italy
*
Author to whom correspondence should be addressed.
Environments 2024, 11(8), 160; https://doi.org/10.3390/environments11080160
Submission received: 7 May 2024 / Revised: 4 July 2024 / Accepted: 19 July 2024 / Published: 23 July 2024

Abstract

Beluga sturgeon (Huso huso Linnaeus, 1758, acipenseridae) and Adriatic sturgeon (Acipenser naccarii, Bonaparte, 1836, acipenseridae) within the Po River basin have been recently assessed for the IUCN Red List of Threatened Species and were found to be Extinct in the Wild and Critically Endangered, respectively. Significant declines in both species’ abundance have spurred major research efforts and management actions in recent decades. Recently, specific actions have been conducted to recover habitat connectivity through projects of river defragmentation and reintroduction plans have been implemented for both sturgeon species. To manage effective conservation efforts, knowledge of a species’ distribution and abundance is critical, especially for adult sturgeon that are able to move hundreds of kilometers away from release sites. Here, two new quantitative PCR (qPCR) assays to detect beluga sturgeon and Adriatic sturgeon environmental DNA (eDNA) in water samples have been developed with the goal of providing an alternative method to monitor their presence. Two Taqman-based assays targeting the mitochondrial cytochrome b region were developed and showed no amplification of other related and co-occurring fishes. A mesocosm within the Ticino Park on the Ticino River (a main tributary of the Po River), where both species are bred, was used to develop and validate the assays. The LOQ for H. huso assay corresponded to Ct = 41 (7.33 × 107 DNA counts/µL of reaction) and for A. naccarrii it was Ct = 37 (2.23 × 1016 DNA counts/µL of reaction). Additionally, water samples were taken from the discard drainage, which flows directly into the Ticino River, testing positive detection of eDNA within a distance of up to 2 km. Overall, the results suggested that the two assays developed in this study could represent a promising new tool for monitoring both beluga and Adriatic sturgeon.

1. Introduction

Sturgeon (order Acipenseriformes, Berg 1940) represent one of the most important aquatic natural resources, both scientifically and commercially. With over 85% of species listed as endangered or threatened, sturgeon are considered the world’s most imperiled vertebrate group (IUCN 2022). All species are migratory, either anadromous or potamodromous. Typically, they are slow-growing animals, and they reach sexual maturity very late in life (aged up to 20 years), and some species do not spawn yearly [1]. Over the past century, sturgeon’ populations have been reduced by human-mediated alterations to riverine habitats, such as channelization, dam construction, and degradation of the water quality [2]. Specifically, to the North of Italy, Po River drainages into the Adriatic Sea have affected the beluga sturgeon (Huso huso Linnaeus, 1758) and the Adriatic sturgeon (Acipenser naccarii, Bonaparte, 1836), which have been recently assessed for the IUCN Red List of Threatened Species and were found to be Extinct in the Wild and Critically Endangered, respectively (IUCN 2022). Due to their long life cycle and anadromous behavior, they are very susceptible to overfishing, pollution, and habitat fragmentation [3]. A significant drop in catches began in the early 1920s, primarily as a result of overfishing and habitat fragmentation [4]. Recently, species reintroductions (i.e., the translocation of individuals to areas where a species has been extirpated with the aim of re-establishing a self-sustaining population) have become a widespread practice in sturgeon’ conservation biology [5], and this also contributes to the safeguarding of both beluga and Adriatic sturgeon [6].
A critical aspect for developing and managing effective conservation efforts is the knowledge of a species’ distribution and abundance through monitoring [7]. Assessing the occurrence and distribution of freshwater species using eDNA-based approaches is becoming established as a powerful conservation management tool [8,9], especially in the case of fish taxa [10,11,12,13] eDNA-based approaches have been proven to be reliable and non-invasive strategies suitable for monitoring rare, elusive, anadromous and imperiled fishes, including sturgeon [14,15,16,17,18]. Requiring only the collection of water samples, eDNA can exhibit considerable time and cost benefits over traditional sampling [19], thus allowing for greater spatial distribution of effort, which is critical for species like adult sturgeon that can move over hundreds of kilometers in the Po River basin. Unfortunately, no eDNA-based tools specific for the target detection of H. huso and A. naccarii have ever been developed, limiting the efficacy of monitoring efforts. Therefore, this study aimed (i) to develop and test two probes-based qPCR assays for detecting H. huso and A. naccarii eDNA in water samples from a mesocosm (Figure 1), targeting the variable mitochondrial region Cytochrome b (Cyt b), and (ii) to test the detection distance of the two assays by collecting the water from the drainage of the mesocosm, which directly flows into the Ticino River.

2. Materials and Methods

2.1. Mesocosm Sampling Site

The mesocosm with sturgeon is located in Ticino Park along the Ticino River, a main Alpine tributary of Po River (Figure 2; [20]). The mesocosm consisted of two semi-natural communicating tanks. Each tank is bordered by grids, with natural bottoms and banks, each about 350 m long and 15 m wide. The tanks are mainly fed by a large natural spring channel and partly by small springs along the banks and on the bottom, and directly flowing into the Ticino River (around 2 km) (Figure 1). The depth of the tanks up to the river confluence does not exceed 1.6 m. In the upstream tank (tank 1), Huso huso is bred with a few juvenile individuals of Acipenser naccarii. In total, at the moment of sampling, there were around 30 H. huso individuals for an approximate total biomass of 700 kg. The A. naccarii juveniles were around 1000 individuals with an approximate biomass of 300 kg. Downstream (tank 2), divided by a grid, which impedes fish movements, about 400 adult individuals of A. naccarii (60–120 cm) are bred, with an approximate biomass of 1900 kg. In the system, a few trout and barbels were also present.

2.2. Water Sampling

Sampling took place in June 2023 and in September 2023; water samples were collected using a portable eDNA sampler (Smith-Root) [21] through an 0.45 um eDNA Sampler self-preserving filter (Smith-Root) [22] standing from the edge of the tanks and discarded drainage. At each sampling point, 1 L of benthic water and 1 L of water column were filtered, separately, and a total of 2 L of water was filtered from each tank. Starting from the outflow of tank 2 up to the confluence with the Ticino River (around 2 km), 12 sites were sampled at regular distances between sites. At each site, 2 L of water (1 L benthic and 1 L column water) was filtered to investigate the distance detection of eDNA in natural conditions (Figure 1). Upstream of tank 1, 2 L of water was filtered as a negative control. Filters were kept cool and dark during the transport to the laboratory and stored at −80 °C until the eDNA extraction process (within a week after collection). Total eDNA was extracted from the filters using DNeasy® PowerSoil® Kit (Qiagen, Milano, Italy) according to the manufacturer’s protocol. The eDNA was eluted in 75 μL of warmed elution buffer (40 °C) to increase the final eDNA concentration.
All laboratory procedures of the pre-amplification steps were carried out in separate rooms from the post-amplification steps, with dedicated personal protective equipment.

2.3. Assay Design

In order to identify possible genomic region sequences suitable for designing specific primers and probes for A. naccarii and H. huso, a multi-species sequence alignment was created from publicly available sequence data from the National Center for Biotechnology Information’s (NCBI) Genbank repository (http://www.ncbi.nih.gov/genbank, accessed on 26 May 2023). The alignment was created by considering Cyt b nucleotide sequences, since all the species of sturgeon present in the Po River basin, and the species involved in hatchery activity for caviar production, were largely abundant for this marker. The dataset included 123 Acipenseridae sequences belonging to Acipenser baerii (Brandt, 1869), A. gueldenstaedtii (Brandt & Ratzeburg, 1833), A. naccarii (Bonaparte, 1836), A. ruthenus (Linnaeus, 1758), A. stellatus (Pallas, 1771), A. sturio (Linnaeus, 1758) (extinct in Italy), A. trasmontanus (Richardson, 1836) and Huso huso (Linnaeus, 1758) (Supplemental Table S1). Primers and probes were designed using “Primer Quest™Toll” (https://www.idtdna.com/Primerquest/Home/Index, accessed on 27 May 2023) [23], while the presence of dimers and hairpin formations was checked with OligoCalc v. 3.27 (http://www.operon.com/tools/oligo-analysis-tool.aspx, accessed on 27 May 2023). A further validation step was performed to assess the specificity of the designed assays and the possible mismatches with other non-Acipenser species by using NCBI Primer-BLAST tool [24].

2.4. Primer and Probes Validation on Positive Tissue Samples

Genomic DNA was extracted from a fin clip sample collected from A. naccarii and H. huso, using the DNeasy Blood&Tissue® Kit (Qiagen, Milano, Italy) following manufacturer’s instructions. The concentration and quality of the genomic DNA were checked with a NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). The two assays were tested on DNA from both sturgeon species. To select the optimal annealing temperature of each primer pairs, gradient PCR trials were conducted in 20 µL total volume reactions containing 4 µL of 10× Buffer solution (5× WonderTaq reaction Buffer EuroClone®, Pero (MI), Italy), 1 µL of each primer (10 µM), 0.25 µL Taq polymerase (WonderTaq EuroClone®), and 2 µL of DNA template, under the following conditions: an initial step at 94 °C for 5 min, followed by 35 cycles of 94 °C for 60 s, with annealing temperature ranging from 50 to 60 °C for 45 s, elongation at 72 °C for 60 s, and a final extension at 72 °C for 7 min. Gel electrophoresis runs of the resulting PCR products were performed on a 2% agarose gel and visualized under UV light. A subset of amplicons of the expected length were excised and sequenced bidirectionally at Eurofins GenomicsDNA. After primer trimming, the presence of an open reading frame was verified for the obtained consensus sequences by using the online tool EMBOSS Transeq (http://www.ebi.ac.uk/Tools/st/emboss_transeq/, accessed on 27 May 2023). Species identification was validated by querying the obtained nucleotide sequences with BLASTn tool [25].

2.5. qPCR Assay Set Up

Quantitative Real Time PCR (qPCR) on a Real-Time PCR StepOne® (Applied Biosystems®, Waltham, MA, USA) instrument to test the primer pairs assays. First, each primer pair was used on tissue samples to determine the amplification efficiency (E), limit of detection (LOD), and limit of quantification (LOQ), according to [26,27]. To generate the standard curve, tenfold serial dilutions of quantified positive tissue controls were used at a starting concentration of 340 ng/μL in both cases (Supplemental Table S3). The samples were run in duplicate, together with negative controls (NTC: no template control samples). The qPCR analysis was performed in 10 µL reaction mix containing 5 µL of buffer, 0.25 µL of each primer (10 µM), 0.15 µL of dual-labeled (5′-FAM, 3′-MGBEQ) Taqman Probe (10 µM) and 2 µL of eDNA template with the same thermal conditions used for eDNA samples analysis. Amplification efficiency (E) for both primer sets was calculated according to the following formula:
E = 10 ( 1 slope )

2.6. eDNA-Based Detection in Environmental Samples

Each eDNA sample was analyzed in six technical replicates (Supplemental Table S2) together with positive (PTC) and negative controls (NTC), respectively. PTC consisted of 2 µL of gDNA extracted from tissue samples, while NTC included ultrapure water. The qPCR was performed following standard thermal conditions, with the annealing step varying depending on the target: A. naccarii: 60 °C annealing temperature for 45 s, 45 cycles; H. huso: 58 °C annealing temperature for 60 s and 45 cycles. eDNA samples were considered positive when a sigmoidal signal was observed in at least two qPCR technical replicates for each run and above the LOD, whereas their status was uncertain when it was observed only in a single technical replicate, even if it was above the LOD. When the qPCR copy number output was below the LOQ but above the theoretical qPCR limit (three copies per reaction according to [26], they were considered as ‘detectable but not quantifiable’ (DBNQ). The Ct (Cycle threshold) values were converted into DNA counts (DNA copies) as follows:
DNA counts = E ^ ( C T max C T )
DNA n g μ l = 10 ^ ( C T y ) / slope
Randomly, some amplicons from eDNA samples were sent for sequencing (Eurofins, Hamburg, Germany) to confirm the detection. Moreover, to further confirm the specificity of our assays, both were tested on eDNA extracts from three water bodies where the absence of Acipenseridae is certain, all of which were located within the Po River basin (i.e., Parco Nord Milano, 45.5314° N, 9.2123° E; San Genuario, 45.1982° N, 8.1889° E). These sites are representative of the fish community inhabiting the Po River basin [28,29]).

3. Results

3.1. Initial qPCR Assays Testing

Preliminary tests of the Cyt b qPCR assays on both A. naccarii and H. huso on DNA from tissue samples demonstrated that the method was specific to the selected mitochondrial region of the target species. The species-specificity test was checked through sequence match analysis from tissue-based amplicons and did not return any high similarity value with the teleost fish or other taxa present in Italian rivers (Table 1).
The amplification efficiency of the A. naccarii primers was 84.5%. For the 10-fold serial dilution of A. naccarii DNA, the LOD was 340 × 10−6 ng/µL, with a mean cycle threshold value (Ct) of 43 (SD ± 0.17). The LOQ corresponded to a Ct = 37 (2.23 × 1016 DNA counts/µL of reaction) (Figure 3). The H. huso amplification efficiency was 91.5%. The measured LOD corresponded to 340 × 10−6 ng/µL, with a mean cycle threshold value (Ct) of 39 (SD ± 0.13) (Figure 3). The LOQ corresponded to Ct = 41 (7.33 × 107 DNA counts/µL of reaction) (Figure 3). R2 values were ≥99.8% for A. naccarii and ≥99.9% for H. huso (Supplemental Table S4).

3.2. eDNA Detection in Environmental Samples

The Cyt b qPCR assays were then tested on the environmental DNA, showing species-specific detection. No amplification was detected in the field negative controls (including the two eDNA extracts from water bodies where no Acipenseridae species occur) for both assays. In tank 1, H. huso’s Cyt b qPCR assay amplified both benthic and column water samples (sample S1) at 30 cycles, whilst A. naccarii’s Cyt b qPCR was amplified during later cycles (31–32 cycles) according to the lower abundance of this species (Figure 1; Table 2). In tank 2, A. naccarii’s Cyt b qPCR was amplified at lower cycles (sample S2, Ct = 30–31), according to the higher biomass in tank 2 (Figure 2; Table 2).
The detection of eDNA for both assays covered the 2 km range investigated in the mesocosm for both column and benthic water (sampling point 9 for A. naccarii’s Cyt b qPCR assay and sampling point 8 for H. huso’s Cyt b qPCR assay) (Table 2; Figure 4). Out of 24 samples, only 2 samples (16c and 16b), for the detection of A. naccarii eDNA provided positive signals in all replicates at higher Ct values than the dilutions, and thus their detection is considered unreliable, whilst 5 samples were unreliable for the detection of H. huso eDNA (Table 2). Specifically, for H. huso eDNA detection, sampling point 9 provided a positive but unreliable signal due to the detection at a high Ct value, probably due to the outreach of the distance range detection of the assay (approximately 2.5 km) (Table 2). Detection of A. naccarii’s eDNA was successful in all six qPCR replicates in all samples except samples 2c and 3b, where successful replicates were four and three, respectively. In comparison, the detection of H. huso’s eDNA provided less successful replicates for a higher number of samples (eight in total) (Table 2). However, only at sampling point 8 was the number of successful qPCR replicates low (less than 50%), probably approaching the range of the detection limit (Table 2). For both assays, the eDNA detection did not show a linear trend from the outflow of the tanks to the confluence of the Ticino River (Figure 4). A higher eDNA concentration was retrieved in benthic water in five out of eleven sampling points for A. naccarii’s Cyt b qPCR assay; specifically, four benthic samples collected between 600 m and 1250 m from the outflow of tank 2 (Figure 4; Table 2). For H. huso’s Cyt b qPCR assay, a higher eDNA concentration was retrieved in benthic water in only three samples (17b, 5b and 6b) (Figure 4; Table 2).

4. Discussion

This study was the first one devoted to the tracking of eDNA from the rare and endangered sturgeon H. huso and A. naccarii, in freshwater ecosystems, based on qPCR Cyt b assays. The two qPCR assays for detecting H. huso and A. naccarii eDNA in field sampling were robust, highly efficient, and species-specific. The trials conditions from the mesocosm allowed us to simulate the sympatry conditions found in the Po River basin of the two sturgeon species, where the abundance of the rare H. huso in the tanks was 1:3 compared to the presence of A. naccarii.
The results showed promise for applying the assays for monitoring H. huso and A. naccarii in their natural freshwater habitat. The maximum detection distance of H. huso in this study was at around 2 km, with a signal that dropped at around 2.5 km, whilst the maximum detection distance for A. naccarii could be greater than 2 km, but a further sampling site was not accessible during this study. A greater detection distance of A. naccarii might be related to the higher abundance in the tanks; indeed, quantitative comparison of eDNA detection versus acoustic detections revealed significant relationships between eDNA and Atlantic sturgeon in two river systems [30]. However, when Atlantic sturgeon were in lower abundances, in deeper areas, and were not actively migrating, eDNA detection in surface water failed [31]. Whilst also other studies have found the quantity of eDNA to be correlated with species density (i.e., [31,32,33], there is still limited knowledge of how conditions such as DNA shedding rates (fish behavior), water chemistry, flow, and temperature affect eDNA concentrations. River flow could influence the detectability by moving eDNA downstream up to 100 km from where the fish are located [34,35,36]; however, there is some evidence that eDNA does not necessarily accumulate in downstream sampling sites [7,31] and the transport of eDNA is highly variable and complicated to trace [37]. Further work in natural habitats should include measuring the river flow at each sampling site, and deeper investigations are needed to examine the factors influencing variability in eDNA detection rates. Indeed, to design a satisfactory survey method, an understanding of the sensitivity of eDNA detection rates downstream in running water is critical [38]. In addition to abiotic factors, the distribution and movement of fish can also be affected by the flow [39,40]. Further complicating the interpretation of eDNA results is the historical eDNA transport between river sediments and water column [41]. Sediment eDNA may be present at a higher concentration than that in the water column [41], but it could also not be correlated with the actual aquatic eDNA [42]. However, given that sturgeon tend to live at the bottom of the river over sand and mud, and feed on bottom-living invertebrates and small fishes, eDNA-based detection is not likely to detect traces that have been retained in the environment in the long term. Although, in this study, the depth of the tanks where sturgeon were bred did not allow testing difference between surface/column water and benthic water, a previous study on sturgeon suggested that there may be a higher eDNA concentration in benthic water [16], which must be taken in account during further investigations. Moreover, increased eDNA detection was observed in Alabama sturgeon during the spawning seasons, when fish were likely migrating and producing gametes [16], which is likely to be the same for both H. huso and A. naccarii during their migration up to the Po River basin.
Overall, these results indicate that qPCR eDNA-based detection of H. huso and A. naccarii has broad potential applications. eDNA is a viable approach for monitoring this important endangered species and can inform DNA-based trophic dynamics studies [43]. Given the relatively low eDNA abundances in river samples, increasing the water volume sampled, the sampling frequency, and varying the depths sampled may improve the detection probability, especially for the rarest H. huso.
Many efforts have been put in place to promote the ecological requirements of the Po River catchment, restoring its connectivity and opening migratory routes for anadromous species like sturgeon, with evidence that the Po River remains suitable for the reproduction of the Adriatic sturgeon [44]. The removal of the main impoundment in the lower Po River, Isola Serafini Dam (EU-LIFE project ConFluPo, 2012–2017), is critical for the current reintroduction program for both sturgeon species [6], allowing them to reach the upstream-located suitable spawning sites. Furthermore, the engineered fish pass, built in Isola Serafini, is equipped with a station for observing fishes’ movements in both directions [45], which can effectively support eDNA monitoring. Indeed, eDNA sampling seems to be especially suited to monitoring the reproduction and spawning of migratory anadromous fish in particular when it is paired with other methods to confirm that reproduction is taking place, such as upstream spawning migration [13,46,47]. For migratory species, repeated sampling can determine the timing and spatial extent of spawning [48,49] recovery dynamics following dam removal [50]. Moreover, high-frequency temporal sampling of water could effectively provide a more accurate representation of spawning abundances [13,51,52] that is a critical issue for optimizing conservation and management actions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/environments11080160/s1, Table S1: List of GenBank from Cyt b sequences used to design the two assays specific to Huso huso and Acipenser naccarii. Each sequence was trimmed to match only the region targeted by the assay. Species, GenBank accession number (GenBank) and reference are indicated. The sequences were downloaded from NCBI-GenBank (Nucleotide Archive) on 26 May 2023. Table S2: Detailed results obtained for each environmental sample regarding the detection of Acipenser naccarii and Huso huso. Sample name (ID), sample type (column–benthic water), cycle thresholds (Ct) for each replicate (Rep) and the average cycle thresholds with the standard deviation (Ct ± s.d.) values are also reported. Table S3: Detailed results obtained for tissue sample of Acipenser naccarii and Huso huso used to generate the standard curve. Eight dilutions were tested, concentration of DNA ([DNA] ng/µL), cycle thresholds (Ct) for each replicate (Rep), average cycle thresholds (Ct) value are reported. Table S4: qPCR outcome summary of Acipenser naccarii and Huso huso environmental samples analysis. Sample name (ID), sample type (column–benthic water), average cycle thresholds (Ct), concentration of DNA (ng/µL), DNA counts/µL and DNA counts/L are indicated.

Author Contributions

C.M.A., S.Z., A.G., A.B. and M.D.F. conceived the study. C.M.A. and S.Z. collected samples. F.R. carried out all laboratory analyses; F.R. and A.B. analyzed raw data. C.M.A., S.Z. and A.G. conceptualized the manuscript. C.M.A. wrote the first draft of the manuscript. All authors contributed to previous versions of the manuscript and approved the final version for submission. All authors have read and agreed to the published version of the manuscript.

Funding

The study was also supported under the Project code CN_00000033, Concession Decree No. 1034 of 17 June 2022 adopted by the Italian Ministry of University and Research, CUP, H43C22000530001 Project title “National Biodiversity Future Center—NBFC, Spoke 5”.

Data Availability Statement

All raw data are provided as Supplementary Material.

Conflicts of Interest

The authors declared no conflict of interest.

References

  1. Kottelat, M.; Freyhof, J. Handbook of European Freshwater Fishes; Publications Kottelat: Cornol, Switzerland, 2007; Volume 13. [Google Scholar]
  2. Wolter, C.; Buijse, A.D.; Parasiewicz, P. Temporal and Spatial Patterns of Fish Response to Hydromorphological Processes. River Res. Appl. 2016, 32, 190–201. [Google Scholar] [CrossRef] [Scilit]
  3. Friedrich, T.; Reinartz, R.; Gessner, J. Sturgeon re-introduction in the Upper and Middle Danube River Basin. J. Appl. Ichthyol. 2019, 35, 1059–1068. [Google Scholar] [CrossRef] [Scilit]
  4. Freyhof, J.; Bergner, L.; Ford, M. Threatened Freshwater Fishes of the Mediterranean Basin Biodiversity Hotspot: Distribution, Extinction Risk and the Impact of Hydropower; Museum für Naturkunde Berlin (MfN): Berlin, Germany, 2020. [Google Scholar]
  5. Jourdan, J.; Plath, M.; Tonkin, J.D.; Ceylan, M.; Dumeier, A.C.; Gellert, G.; Graf, W.; Hawkins, C.P.; Kiel, E.; Lorenz, A.W.; et al. Reintroduction of freshwater macroinvertebrates: Challenges and opportunities. Biol. Rev. 2019, 94, 368–387. [Google Scholar] [CrossRef] [Scilit]
  6. Antognazza, C.; Vanetti, I.; De Santis, V.; Bellani, A.; Di Francesco, M.; Puzzi, C.M.; Casoni, A.G.; Zaccara, S. Genetic Investigation of Four Beluga Sturgeon (Huso huso, L.) Broodstocks for its Reintroduction in the Po River Basin. Environments 2021, 8, 25. [Google Scholar] [CrossRef] [Scilit]
  7. Laramie, M.B.; Pilliod, D.S.; Goldberg, C.S. Characterizing the distribution of an endangered salmonid using environmental DNA analysis. Biol. Conserv. 2015, 183, 29–37. [Google Scholar] [CrossRef] [Scilit]
  8. Deiner, K.; Bik, H.M.; Mächler, E.; Seymour, M.; Lacoursière-Roussel, A.; Altermatt, F.; Creer, S.; Bista, I.; Lodge, D.M.; de Vere, N.; et al. Environmental DNA metabarcoding: Transforming how we survey animal and plant communities. Mol. Ecol. 2017, 26, 5872–5895. [Google Scholar] [CrossRef] [Scilit]
  9. Ruppert, K.M.; Kline, R.J.; Rahman, S. Past, present, and future perspectives of environmental DNA (eDNA) metabarcoding: A systematic review in methods, monitoring, and applications of global eDNA. Glob. Ecol. Conserv. 2019, 17, e00547. [Google Scholar] [CrossRef] [Scilit]
  10. Antognazza, C.M.; Britton, J.R.; Potter, C.; Franklin, E.; Hardouin, E.A.; Roberts, C.G.; Aprahamian, M.; Andreou, D. Environmental DNA as a non-invasive sampling tool to detect the spawning distribution of European anadromous shads (Alosa spp.). Aquat. Conserv. Mar. Freshw. Ecosyst. 2019, 29, 148–152. [Google Scholar] [CrossRef] [Scilit]
  11. Carim, K.J.; Dysthe, J.C.S.; Young, M.K.; McKelvey, K.S.; Schwartz, M.K. An environmental DNA assay for detecting Arctic grayling in the upper Missouri River basin, North America. Conserv. Genet. Resour. 2016, 8, 197–199. [Google Scholar] [CrossRef] [Scilit]
  12. Jensen, M.R.; Knudsen, S.W.; Munk, P.; Thomsen, P.F.; Møller, P.R. Tracing European eel in the diet of mesopelagic fishes from the Sargasso Sea using DNA from fish stomachs. Mar. Biol. 2018, 165, 130. [Google Scholar] [CrossRef] [Scilit]
  13. Levi, T.; Allen, J.M.; Bell, D.; Joyce, J.; Russell, J.R.; Tallmon, D.A.; Vulstek, S.C.; Yang, C.; Yu, D.W. Environmental DNA for the enumeration and management of Pacific salmon. Mol. Ecol. Resour. 2019, 19, 597–608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Bergman, P.S.; Schumer, G.; Blankenship, S.; Campbell, E. Detection of adult green sturgeon using environmental DNA analysis. PLoS ONE 2016, 11, e0153500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Farrington, H.L.; Lance, R.F. Development of Genetic Markers for Environmental DNA (eDNA) Monitoring of Sturgeon; Engineer Research and Development Center (U.S.): Vicksburg, MS, USA, 2014. [Google Scholar]
  16. Janosik, A.M.; Whitaker, J.M.; VanTassel, N.M.; Rider, S.J. Improved environmental DNA sampling scheme for Alabama sturgeon provides new insight into a species once presumed extinct. J. Appl. Ichthyol. 2021, 37, 178–185. [Google Scholar] [CrossRef] [Scilit]
  17. Pfleger, M.O.; Rider, S.J.; Johnston, C.E.; Janosik, A.M. Saving the doomed: Using eDNA to aid in detection of rare sturgeon for conservation (Acipenseridae). Glob. Ecol. Conserv. 2016, 8, 99–107. [Google Scholar] [CrossRef] [Scilit]
  18. Yusishen, M.E.; Eichorn, F.-C.; Anderson, W.G.; Docker, M.F. Development of quantitative PCR assays for the detection and quantification of lake sturgeon (Acipenser fulvescens) environmental DNA. Conserv. Genet. Resour. 2018, 12, 17–19. [Google Scholar] [CrossRef] [Scilit]
  19. Rees, H.C.; Maddison, B.C.; Middleditch, D.J.; Patmore, J.R.; Gough, K.C. REVIEW: The detection of aquatic animal species using environmental DNA—A review of eDNA as a survey tool in ecology. J. Appl. Ecol. 2014, 51, 1450–1459. [Google Scholar] [CrossRef] [Scilit]
  20. QGIS.org. QGIS Geographic Information System. QGIS Association. 2024. Available online: http://www.qgis.org (accessed on 5 April 2024).
  21. Thomas, A.C.; Tank, S.; Nguyen, P.L.; Ponce, J.; Sinnesael, M.; Goldberg, C.S. A system for rapid eDNA detection of aquatic invasive species. Environ. DNA 2020, 2, 261–270. [Google Scholar] [CrossRef] [Scilit]
  22. Thomas, A.C.; Nguyen, P.L.; Howard, J.; Goldberg, C.S. A self-preserving, partially biodegradable eDNA filter. Methods Ecol. Evol. 2019, 10, 1136–1141. [Google Scholar] [CrossRef] [Scilit]
  23. Kibbe, W.A. OligoCalc: An online oligonucleotide properties calculator. Nucleic Acids Res. 2007, 35, W43–W46. [Google Scholar] [CrossRef] [Scilit]
  24. Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Scilit]
  25. Madden, T. The BLAST sequence analysis tool. In The NCBI Handbook; National Center for Biotechnology Information: Bethesda, MD, USA, 2013; Volume 2, pp. 425–436. [Google Scholar]
  26. Bustin, S.A. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments; Series The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments; Oxford University Press: Oxford, UK, 2009. [Google Scholar]
  27. Klymus, K.E.; Merkes, C.M.; Allison, M.J.; Goldberg, C.S.; Helbing, C.C.; Hunter, M.E.; Jackson, C.A.; Lance, R.F.; Mangan, A.M.; Monroe, E.M.; et al. Reporting the limits of detection and quantification for environmental DNA assays. Environ. DNA 2020, 2, 271–282. [Google Scholar] [CrossRef] [Scilit]
  28. Zerunian, S. Problematiche di conservazione dei Pesci d’acqua dolce italiani. Biol. Ambient. 2007, 21, 49–55. [Google Scholar]
  29. Springer, K.B. Biology, conservation and sustainable development of sturgeons. In Fish & Fisheries Series (FIFI); Springer: Dordrecht, The Netherlands, 2010; Volume 29. [Google Scholar]
  30. Plough, L.V.; Bunch, A.J.; Lee, B.B.; Fitzgerald, C.L.; Stence, C.P.; Richardson, B. Development and testing of an environmental DNA (eDNA) assay for endangered Atlantic sturgeon to assess its potential as a monitoring and management tool. Environ. DNA 2021, 3, 800–814. [Google Scholar] [CrossRef] [Scilit]
  31. Pilliod, D.S.; Goldberg, C.S.; Arkle, R.S.; Waits, L.P. Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples. Can. J. Fish. Aquat. Sci. 2013, 70, 1123–1130. [Google Scholar] [CrossRef] [Scilit]
  32. Takahara, T.; Minamoto, T.; Yamanaka, H.; Doi, H.; Kawabata, Z. Estimation of fish biomass using environmental DNA. PLoS ONE 2012, 7, e35868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Wilcox, T.M.; McKelvey, K.S.; Young, M.K.; Sepulveda, A.J.; Shepard, B.B.; Jane, S.F.; Whiteley, A.R.; Lowe, W.H.; Schwartz, M.K. Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis. Biol. Conserv. 2016, 194, 209–216. [Google Scholar] [CrossRef] [Scilit]
  34. Pont, D.; Rocle, M.; Valentini, A.; Civade, R.; Jean, P.; Maire, A.; Roset, N.; Schabuss, M.; Zornig, H.; Dejean, T. Environmental DNA reveals quantitative patterns of fish biodiversity in large rivers despite its downstream transportation. Sci. Rep. 2018, 8, 10361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Jane, S.F.; Wilcox, T.M.; McKelvey, K.S.; Young, M.K.; Schwartz, M.K.; Lowe, W.H.; Letcher, B.H.; Whiteley, A.R. Distance, flow and PCR inhibition: eDNA dynamics in two headwater streams. Mol. Ecol. Resour. 2015, 15, 216–227. [Google Scholar] [CrossRef] [Scilit]
  36. Jerde, C.L.; Olds, B.P.; Shogren, A.J.; Andruszkiewicz, E.A.; Mahon, A.R.; Bolster, D.; Tank, J.L. Influence of stream bottom substrate on retention and transport of vertebrate environmental DNA. Environ. Sci. Technol. 2016, 50, 8770–8779. [Google Scholar] [CrossRef] [Scilit]
  37. Roussel, J.-M.; Paillisson, J.; Tréguier, A.; Petit, E. The downside of eDNA as a survey tool in water bodies. J. Appl. Ecol. 2015, 52, 823–826. [Google Scholar] [CrossRef] [Scilit]
  38. Mettee, M.F.; O’Neil, P.E.; Rider, S.J. Paddlefish Movements in the Lower Mobile River Basin, Alabama. Am. Fish. Soc. Symp. 2009, 66, 63–81. [Google Scholar]
  39. McGarvey, D.J.; Ward, G.M. Scale dependence in the species-discharge relationship for fishes of the southeastern USA. Freshw. Biol. 2008, 53, 2206–2219. [Google Scholar] [CrossRef] [Scilit]
  40. Turner, C.R.; Uy, K.L.; Everhart, R.C. Fish environmental DNA is more concentrated in aquatic sediments than surface water. Biol. Conserv. 2015, 183, 93–102. [Google Scholar] [CrossRef] [Scilit]
  41. Shaw, J.L.A.; Clarke, L.J.; Wedderburn, S.D.; Barnes, T.C.; Weyrich, L.S.; Cooper, A. Comparison of environmental DNA metabarcoding and conventional fish survey methods in a river system. Biol. Conserv. 2016, 197, 131–138. [Google Scholar] [CrossRef] [Scilit]
  42. Bunch, A.J.; Carlson, K.B.; Hoogakker, F.J.; Plough, L.V.; Evans, H.K. Atlantic sturgeon (Acipenser oxyrinchus oxyrinchus Mitchill, 1815) early life stage consumption evidenced by high-throughput DNA sequencing. J. Appl. Ichthyol. 2021, 37, 12–19. [Google Scholar] [CrossRef] [Scilit]
  43. Congiu, L.; Boscari, E.; Pagani, S.; Gazzola, M.; Bronzi, P. Resumption of natural reproduction of the Adriatic sturgeon in the River Po. Oryx 2021, 55, 816. [Google Scholar] [CrossRef] [Scilit]
  44. Puzzi, C.M.; Trasforini, S.; Sartorelli, M.; Tamborini, D. Ticino River ecological corridor restoring and monitoring. Ital. J. Freshw. Ichthyol. 2017, 4, 9–24. [Google Scholar]
  45. Antognazza, C.M.; Britton, J.R.; De Santis, V.; Kolia, K.; Turunen, O.A.; Davies, P.; Allen, L.; Hardouin, E.A.; Crundwell, C.; Andreou, D. Environmental DNA reveals the temporal and spatial extent of spawning migrations of European shad in a highly fragmented river basin. Aquat. Conserv. Mar. Freshw. Ecosyst. 2021, 31, 2029–2040. [Google Scholar] [CrossRef] [Scilit]
  46. Ogburn, M.B.; Plough, L.V.; Bangley, C.W.; Fitzgerald, C.L.; Hannam, M.P.; Lee, B.; Marafino, G.; Richie, K.D.; Williams, M.R.; Weller, D.E. Environmental DNA reveals anadromous river herring habitat use and recolonization after restoration of aquatic connectivity. Environ. DNA 2023, 5, 25–37. [Google Scholar] [CrossRef] [Scilit]
  47. Bracken, F.S.; Hoelzel, A.R.; Hume, J.B.; Lucas, M.C. Contrasting population genetic structure among freshwater-resident and anadromous lampreys: The role of demographic history, differential dispersal and anthropogenic barriers to movement. Mol. Ecol. 2015, 24, 1188–1204. [Google Scholar] [CrossRef] [Scilit]
  48. Plough, L.V.; Ogburn, M.B.; Fitzgerald, C.L.; Geranio, R.; Marafino, G.A.; Richie, K.D. Environmental DNA analysis of river herring in Chesapeake Bay: A powerful tool for monitoring threatened keystone species. PLoS ONE 2018, 13, e0205578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Ratcliffe, F.C.; Webster, T.M.U.; de Leaniz, C.G.; Consuegra, S. A drop in the ocean: Monitoring fish communities in spawning areas using environmental DNA. Environ. DNA 2021, 3, 43–54. [Google Scholar] [CrossRef] [Scilit]
  50. Duda, J.J.; Hoy, M.S.; Chase, D.M.; Pess, G.R.; Brenkman, S.J.; McHenry, M.M.; Ostberg, C.O. Environmental DNA is an effective tool to track recolonizing migratory fish following large-scale dam removal. Environ. DNA 2021, 3, 121–141. [Google Scholar] [CrossRef] [Scilit]
  51. Tillotson, M.D.; Kelly, R.P.; Duda, J.J.; Hoy, M.; Kralj, J.; Quinn, T.P. Concentrations of environmental DNA (eDNA) reflect spawning salmon abundance at fine spatial and temporal scales. Biol. Conserv. 2018, 220, 1–11. [Google Scholar] [CrossRef] [Scilit]
  52. Thalinger, B.; Wolf, E.; Traugott, M.; Wanzenböck, J. Monitoring spawning migrations of potamodromous fish species via eDNA. Sci. Rep. 2019, 9, 15388. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Individual (a) Huso huso and (b) Acipenser naccarii, swimming in the mesocosm where water was collected for testing the two probes-based qPCR assay or detecting H. huso and A. naccarii eDNA.
Figure 1. Individual (a) Huso huso and (b) Acipenser naccarii, swimming in the mesocosm where water was collected for testing the two probes-based qPCR assay or detecting H. huso and A. naccarii eDNA.
Environments 11 00160 g001
Figure 2. (a) Map of mesocosm with sturgeon (45.386836° N, 8.838726° E) located in Ticino Park along Ticino River, Alpine tributary of Po River (North Italy); (b) zoom on the mesocosm structure (tanks with stocked sturgeon) and discard drainage. Two water samples were taken from the spring channel (negative controls) and twenty-eight water samples were taken up to the confluence with the Ticino River.
Figure 2. (a) Map of mesocosm with sturgeon (45.386836° N, 8.838726° E) located in Ticino Park along Ticino River, Alpine tributary of Po River (North Italy); (b) zoom on the mesocosm structure (tanks with stocked sturgeon) and discard drainage. Two water samples were taken from the spring channel (negative controls) and twenty-eight water samples were taken up to the confluence with the Ticino River.
Environments 11 00160 g002
Figure 3. Standard regression line of the qPCR positive control samples. Y-axis gives the quantitative cycles (Cq), and x-axis the log of the starting gDNA concentration of each dilution (ranges 340–0.00034 ng/µL). gDNA from A. naccarii is reported in orange circles, and gDNA from H. huso in blue ones (cf Table S3).
Figure 3. Standard regression line of the qPCR positive control samples. Y-axis gives the quantitative cycles (Cq), and x-axis the log of the starting gDNA concentration of each dilution (ranges 340–0.00034 ng/µL). gDNA from A. naccarii is reported in orange circles, and gDNA from H. huso in blue ones (cf Table S3).
Environments 11 00160 g003
Figure 4. qPCR amplifications result for Acipenser naccarii eDNA assay (orange) and Huso huso (blue) across the range of DNA samples (cf Figure 2; Table 2). The average of the eDNA concentrations (six replicates each sample) for benthic water (circle) and column water (triangle) is plotted. On the x-axis, the distance (m) from the outflow of tank 2 (Dissnacc) and tank 1 (Disshuso) is indicated, alongside the ID of the sampling point (cf Table 2).
Figure 4. qPCR amplifications result for Acipenser naccarii eDNA assay (orange) and Huso huso (blue) across the range of DNA samples (cf Figure 2; Table 2). The average of the eDNA concentrations (six replicates each sample) for benthic water (circle) and column water (triangle) is plotted. On the x-axis, the distance (m) from the outflow of tank 2 (Dissnacc) and tank 1 (Disshuso) is indicated, alongside the ID of the sampling point (cf Table 2).
Environments 11 00160 g004
Table 1. Primer, probe, and qPCR information for the Cyt b assays developed.
Table 1. Primer, probe, and qPCR information for the Cyt b assays developed.
Primer NameSequence (5′-3′)AmpliconqPCR Conditions
NacFwGTCACACAAATCCTAACAGGACT
NacProbe[FAM]TTCAACAGCCTTCTCCTCTGTTGC[MGBEQ]156 bp60 °C 45 s. 45 cycles
NacRevTATATACTATGGTTCATACCTCC
HusFwAGTAACATTCCACCCATAC
HusProbe[FAM]ATTCATCCTAATGTTAGTTGGGC[MGBEQ]120 bp58 °C 60 s. 45 cycles
HusRevCCAGACAACTTCACACC
Table 2. Samples’ details and results based on the two Cyt b assays. Sample ID, type of sample (column water, benthic water), distance from the outflow of tank 2 (distnacc), distance from the outflow of tank 1 (disthuso), average Ct values based on six replicates (successful replicates indicated), average eDNA concentration in (ng/µL) ([eDNA]), and DNA counts/L (DNA copies) are indicated.
Table 2. Samples’ details and results based on the two Cyt b assays. Sample ID, type of sample (column water, benthic water), distance from the outflow of tank 2 (distnacc), distance from the outflow of tank 1 (disthuso), average Ct values based on six replicates (successful replicates indicated), average eDNA concentration in (ng/µL) ([eDNA]), and DNA counts/L (DNA copies) are indicated.
Acipenser naccariiHuso huso
IDTypeDistnacc (m)Ct[eDNA]DNA CopiesDisthuso (m)Ct[eDNA]DNA Copies
S1Column-32 (3/6)0.10273.79 × 1031-30 (3/6)0.08099.28 × 1034
Benthic 31 (6/6)0.17874.12 × 1033 30 (6/6)0.08851.82 × 1035
S2Column-31 (4/6)0.12672.25 × 1032032 (4/6)0.02144.43 × 1030
Benthic 30 (6/6)0.26231.06 × 1035 31 (6/6)0.03845.80 × 1032
15cColumn031 (6/6)0.12982.76 × 103245031 (6/6)0.04277.81 × 1032
15bBenthic 31 (6/6)0.17403.29 × 1033 32 (6/6)0.02672.32 × 1031
16cColumn5044 (0/6)--50033 (6/6)0.01821.33 × 1030
16bBenthic 44 (0/6)-- 40 (0/6)--
17cColumn10035 (6/6)0.01922.55 × 102555033 (6/6)0.01932.08 × 1030
17bBenthic 36 (6/6)0.01143.19 × 1023 34 (6/6)0.00645.27 × 1026
1cColumn15035 (6/6)0.02115.74 × 102560039 (5/6)0.00042.29 × 1017
1bBenthic 35 (6/6)0.01584.99 × 1024 40 (0/6)--
2cColumn25036 (4/6)0.01071.84 × 102370035 (6/6)0.00443.30 × 1025
2bBenthic 36 (6/6)0.00914.67 × 1022 35 (6/6)0.00378.25 × 1024
3cColumn40036 (6/6)0.01122.77 × 102385038 (3/6)0.00072.08 × 1019
3bBenthic 36 (3/6)0.00999.87 × 1022 40 (0/6)--
4cColumn60034 (6/6)0.02603.44 × 1026105036 (5/6)0.00254.90 × 1023
4bBenthic 34 (6/6)0.03181.85 × 1027 35 (6/6)0.00381.11 × 1025
5cColumn80037 (6/6)0.00832.23 × 1022125036 (6/6)0.00281.03 × 1024
5bBenthic 34 (6/6)0.03141.67 × 1027 35 (6/6)0.00475.61 × 1025
6cColumn100035 (6/6)0.02126.06 × 1025145035 (5/6)0.00443.05 × 1025
6bBenthic 34 (6/6)0.03655.94 × 1027 35 (6/6)0.00475.62 × 1023
7cColumn125036 (6/6)0.01153.50 × 1023165036 (5/6)0.00266.41 × 1023
7bBenthic 34 (6/6)0.02664.06 × 1026 39 (4/6)0.00054.48 × 1018
8cColumn150032 (6/6)0.10615.00 × 1031195034 (1/6)0.00677.78 × 1026
8bBenthic 36 (6/6)0.01341.27 × 1024 36 (2/6)0.00195.41 × 1022
9cColumn200033 (6/6)0.04533.73 × 1028245040 (0/6)--
9bBenthic 34 (6/6)0.03473.87 × 1027 40 (0/6)--
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Antognazza, C.M.; Ramazzotti, F.; Bruno, A.; Galimberti, A.; Di Francesco, M.; Zaccara, S. A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon. Environments 2024, 11, 160. https://doi.org/10.3390/environments11080160

AMA Style

Antognazza CM, Ramazzotti F, Bruno A, Galimberti A, Di Francesco M, Zaccara S. A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon. Environments. 2024; 11(8):160. https://doi.org/10.3390/environments11080160

Chicago/Turabian Style

Antognazza, Caterina Maria, Fausto Ramazzotti, Antonia Bruno, Andrea Galimberti, Monica Di Francesco, and Serena Zaccara. 2024. "A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon" Environments 11, no. 8: 160. https://doi.org/10.3390/environments11080160

APA Style

Antognazza, C. M., Ramazzotti, F., Bruno, A., Galimberti, A., Di Francesco, M., & Zaccara, S. (2024). A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon. Environments, 11(8), 160. https://doi.org/10.3390/environments11080160

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop