Antimicrobial Resistance in Chicken Meat: Comparing Salmonella, Escherichia coli, and Enterococcus from Conventional and Antibiotic-Free Productions
Abstract
1. Introduction
2. Results
2.1. Overall
2.2. Resistance Profile Obtained in Salmonella spp. Isolates
2.3. Resistance Profile Obtained in Escherichia coli Isolates
2.4. Resistance Profile Obtained from Enterococcus spp. Isolates
2.5. Multidrug Resistance Profiles
3. Discussion
4. Materials and Methods
4.1. Sampling
4.2. Salmonella spp. Detection
4.3. Escherichia coli Detection
4.4. Enterococcus spp. Detection
4.5. Molecular Confirmation of Species
4.6. Antimicrobial Resistance Profile
4.7. Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- USDA Livestock and Poultry: World Markets and Trade. Available online: https://www.fas.usda.gov/sites/default/files/2025-04/livestock_poultry_0.pdf (accessed on 17 May 2025).
- Saraiva, M.M.S.; Lim, K.; do Monte, D.F.M.; Givisiez, P.E.N.; Alves, L.B.R.; Neto, O.C.F.; Kariuki, S.; Júnior, A.B.; de Oliveira, C.J.B.; Gebreyes, W.A. Antimicrobial resistance in the globalized food chain: A One Health perspective applied to the poultry industry. Braz. J. Microbiol. 2022, 53, 465–486. [Google Scholar] [CrossRef] [Scilit]
- Stangierski, J.; Lesnierowski, G. Nutritional and Health-Promoting Aspects of Poultry Meat and Its Processed Products. World’s Poult. Sci. J. 2015, 71, 71–82. [Google Scholar] [CrossRef] [Scilit]
- Musa, L.; Proietti, P.C.; Marenzoni, M.L.; Stefanetti, V.; Kika, T.S.; Blasi, F.; Magistrali, C.F.; Toppi, V.; Ranucci, D.; Branciari, R.; et al. Susceptibility of Commensal E. coli Isolated from Conventional, Antibiotic-Free, and Organic Meat Chickens on Farms and at Slaughter toward Antimicrobials with Public Health Relevance. Antibiotics 2021, 10, 1321. [Google Scholar] [CrossRef] [Scilit]
- Park, J.-H.; Kim, H.-S.; Yim, J.-H.; Kim, Y.-J.; Kim, D.-H.; Chon, J.-W.; Kim, H.; Om, A.-S.; Seo, K.-H. Comparison of the isolation rates and characteristics of Salmonella isolated from antibiotic-free and conventional chicken meat samples. Poult. Sci. 2017, 96, 2831–2837. [Google Scholar] [CrossRef] [Scilit]
- Musa, L.; Proietti, P.C.; Branciari, R.; Menchetti, L.; Bellucci, S.; Ranucci, D.; Marenzoni, M.L.; Franciosini, M.P. Antimicrobial Susceptibility of Escherichia coli and ESBL-Producing Escherichia coli Diffusion in Conventional, Organic and Antibiotic-Free Meat Chickens at Slaughter. Animals 2020, 10, 1215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, Y.-J.; Park, J.-H.; Seo, K.-H. Comparison of the loads and antibiotic-resistance profiles of Enterococcus species from conventional and organic chicken carcasses in South Korea. Poult. Sci. 2018, 97, 271–278. [Google Scholar] [CrossRef] [Scilit]
- Khan, Y.R.; Hernandez, J.A.; Kariyawasam, S.; Butcher, G.; Czyz, D.M.; Pellissery, A.J.; Denagamage, T. Exposure Factors Associated with Antimicrobial Resistance and Identification of Management Practices for Preharvest Mitigation along the Broiler Production Systems: A Systematic Review. J. Glob. Antimicrob. Resist. 2024, 39, 212–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Boeckel, T.P.; Brower, C.; Gilbert, M.; Grenfell, B.T.; Levin, S.A.; Robinson, T.P.; Teillant, A.; Laxminarayan, R. Global trends in antimicrobial use in food animals. Proc. Natl. Acad. Sci. USA 2015, 112, 5649–5654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mokgophi, T.M.; Gcebe, N.; Fasina, F.; Adesiyun, A.A. Antimicrobial Resistance Profiles of Salmonella Isolates on Chickens Processed and Retailed at Outlets of the Informal Market in Gauteng Province, South Africa. Pathogens 2021, 10, 273. [Google Scholar] [CrossRef] [Scilit]
- Alam, M.-U.; Rahman, M.; Abdullah-Al-Masud; Islam, M.A.; Asaduzzaman, M.; Sarker, S.; Rousham, E.; Unicomb, L. Human Exposure to Antimicrobial Resistance from Poultry Production: Assessing Hygiene and Waste-Disposal Practices in Bangladesh. Int. J. Hyg. Environ. Health 2019, 222, 1068–1076. [Google Scholar] [CrossRef] [Scilit]
- Tian, M.; He, X.; Feng, Y.; Wang, W.; Chen, H.; Gong, M.; Liu, D.; Clarke, J.L.; van Eerde, A. Pollution by Antibiotics and Antimicrobial Resistance in LiveStock and Poultry Manure in China, and Countermeasures. Antibiotics 2021, 10, 539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khong, M.J.; Snyder, A.M.; Magnaterra, A.K.; Young, M.M.; Barbieri, N.L.; Weimer, S.L. Antimicrobial Resistance Profile of Escherichia coli Isolated from Poultry Litter. Poult. Sci. 2022, 102, 102305. [Google Scholar] [CrossRef] [Scilit]
- de Souza Gazal, L.E.; Medeiros, L.P.; Dibo, M.; Nishio, E.K.; Koga, V.L.; Gonçalves, B.C.; Grassotti, T.T.; de Camargo, T.C.L.; Pinheiro, J.J.; Vespero, E.C.; et al. Detection of ESBL/AmpC-Producing and Fosfomycin-Resistant Escherichia coli from Different Sources in Poultry Production in Southern Brazil. Front. Microbiol. 2021, 11, 604544. [Google Scholar] [CrossRef] [Scilit]
- Abreu, R.; Semedo-Lemsaddek, T.; Cunha, E.; Tavares, L.; Oliveira, M. Antimicrobial Drug Resistance in Poultry Production: Current Status and Innovative Strategies for Bacterial Control. Microorganisms 2023, 11, 953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Montoro-Dasi, L.; Villagra, A.; Sevilla-Navarro, S.; Pérez-Gracia, M.T.; Vega, S.; Marin, C. Commensal Escherichia coli Antimicrobial Resistance and Multidrug-Resistance Dynamics during Broiler Growing Period: Commercial vs. Improved Farm Conditions. Animals 2021, 11, 1005. [Google Scholar] [CrossRef] [Scilit]
- Khan, X.; Rymer, C.; Lim, R.; Ray, P. Factors Associated with Antimicrobial Use in Fijian Livestock Farms. Antibiotics 2022, 11, 587. [Google Scholar] [CrossRef] [Scilit]
- Mak, P.H.W.; Rehman, M.A.; Kiarie, E.G.; Topp, E.; Diarra, M.S. Production Systems and Important Antimicrobial Resistant-Pathogenic Bacteria in Poultry: A Review. J. Anim. Sci. Biotechnol. 2022, 13, 148. [Google Scholar] [CrossRef] [Scilit]
- Mohammadi, H.; Saghaian, S.; Boccia, F. Antibiotic-Free Poultry Meat Consumption and Its Determinants. Foods 2023, 12, 1776. [Google Scholar] [CrossRef] [Scilit]
- Haque, M.H.; Sarker, S.; Islam, M.S.; Islam, M.A.; Karim, M.R.; Kayesh, M.E.H.; Shiddiky, M.J.A.; Anwer, M.S. Sustainable Antibiotic-Free Broiler Meat Production: Current Trends, Challenges, and Possibilities in a Developing Country Perspective. Biology 2020, 9, 411. [Google Scholar] [CrossRef] [Scilit]
- De Cesare, A.; Oliveri, C.; Lucchi, A.; Savini, F.; Manfreda, G.; Sala, C. Pilot Study on Poultry Meat from Antibiotic Free and Conventional Farms: Can Metagenomics Detect Any Difference? Foods 2022, 11, 249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cervantes, H.M. Antibiotic-free poultry production: Is it sustainable? J. Appl. Poult. Res. 2015, 42, 91–97. [Google Scholar] [CrossRef] [Scilit]
- Vieira, T.R.; de Oliveira, E.F.C.; Cibulski, S.P.; Silva, N.M.V.; Borba, M.R.; Oliveira, C.J.B.; Cardoso, M. Comparative resistome, mobilome, and microbial composition of retail chicken originated from conventional, organic, and antibiotic-free production systems. Poult. Sci. 2023, 102, 103002. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rawat, N.; Anjali; Shreyata; Sabu, B.; Bandyopadhyay, A.; Rajagopal, R. Assessment of Antibiotic Resistance in Chicken Meat Labelled as Antibiotic-Free: A Focus on Escherichia coli and Horizontally Transmissible Antibiotic Resistance Genes. LWT 2024, 194, 115751. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.; Kim, H.; Kim, Y.; Kim, M.; Kwak, H.; Ryu, S. Antimicrobial Resistance of Escherichia coli from Retail Poultry Meats in Korea. J. Food Prot. 2020, 83, 1673–1678. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization (WHO). Critically Important Antimicrobials for Human Medicine, 6th Revision; World Health Organization: Geneva, Switzerland, 2019; Available online: https://www.who.int/publications/i/item/9789241515528 (accessed on 18 May 2025).
- Punchihewage-Don, A.J.; Schwarz, J.; Diria, A.; Bowers, J.; Parveen, S. Prevalence and Antibiotic Resistance of Salmonella in Organic and Non-Organic Chickens on the Eastern Shore of Maryland, USA. Front. Microbiol. 2023, 14, 1272892. [Google Scholar] [CrossRef] [Scilit]
- Cui, L.; Liu, Q.; Jiang, Z.; Song, Y.; Yi, S.; Qiu, J.; Hao, G.; Sun, S. Characteristics of Salmonella from Chinese Native Chicken Breeds Fed on Conventional or Antibiotic-Free Diets. Front. Vet. Sci. 2021, 8, 607491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tofani, S.; Albini, E.; Blasi, F.; Cucco, L.; Lovito, C.; Maresca, C.; Pesciaroli, M.; Orsini, S.; Scoccia, E.; Pezzotti, G.; et al. Assessing the Load, Virulence and Antibiotic-Resistant Traits of ESBL/Ampc E. coli from Broilers Raised on Conventional, Antibiotic-Free, and Organic Farms. Antibiotics 2022, 11, 1484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pesciaroli, M.; Magistrali, C.F.; Filippini, G.; Epifanio, E.M.; Lovito, C.; Marchi, L.; Maresca, C.; Massacci, F.R.; Orsini, S.; Scoccia, E.; et al. Antibiotic-resistant commensal Escherichia coli are less frequently isolated from poultry raised using non-conventional management systems than from conventional broiler. Int. J. Food Microbiol. 2020, 314, 108391. [Google Scholar] [CrossRef] [Scilit]
- Sanchez, H.M.; Whitener, V.A.; Thulsiraj, V.; Amundson, A.; Collins, C.; Duran-Gonzalez, M.; Giragossian, E.; Hornstra, A.; Kamel, S.; Maben, A.; et al. Antibiotic Resistance of Escherichia coli Isolated from Conventional, No Antibiotics, and Humane Family Owned Retail Broiler Chicken Meat. Animals 2020, 10, 2217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davis, G.S.; Waits, K.; Nordstrom, L.; Grande, H.; Weaver, B.; Papp, K.; Horwinski, J.; Koch, B.; Hungate, B.A.; Liu, C.M.; et al. Antibiotic-Resistant Escherichia coli from Retail Poultry Meat with Different Antibiotic Use Claims. BMC Microbiol. 2018, 18, 174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zarzecka, U.; Zakrzewski, A.J.; Chajęcka-Wierzchowska, W.; Zadernowska, A. Linezolid-Resistant Enterococcus spp. Isolates from Foods of Animal Origin—The Genetic Basis of Acquired Resistance. Foods 2022, 11, 975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yahia, H.B.; Trabelsi, I.; Arous, F.; García-Vela, S.; Torres, C.; Slama, K.B. Detection of Linezolid and Vancomycin Resistant Enterococcus Isolates Collected from Healthy Chicken Caecum. J. Appl. Microbiol. 2024, 135, lxae027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, W.; Cai, C.; Dong, N.; Chen, J.; Zhang, R.; Cai, J. Mapping the Widespread Distribution and Transmission Dynamics of Linezolid Resistance in Humans, Animals, and the Environment. Microbiome 2024, 12, 52. [Google Scholar] [CrossRef] [Scilit]
- Brenciani, A.; Morroni, G.; Schwarz, S.; Giovanetti, E. Oxazolidinones: Mechanisms of Resistance and Mobile Genetic Elements Involved. J. Antimicrob. Chemother. 2022, 77, 2596–2621. [Google Scholar] [CrossRef] [Scilit]
- Kilonzo-Nthenge, A.; Brown, A.; Nahashon, S.N.; Long, D. Occurrence and antimicrobial resistance of Enterococci isolated from organic and conventional retail chicken. J. Food Prot. 2015, 78, 760–766. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Massow, A.; Stanley, M.; Papariella, M.; Chen, X.; Kraft, B.; Ebner, P. Contamination Rates and Antimicrobial Resistance in Enterococcus spp., Escherichia coli, and Salmonella Isolated from “No Antibiotics Added”–Labeled Chicken Products. Foodborne Pathog. Dis. 2011, 8, 1147–1152. [Google Scholar] [CrossRef] [Scilit]
- Adesoji, A.T.; Ogunjobi, A.A.; Olatoye, I.O.; Douglas, D.R. Prevalence of tetracycline resistance genes among multi-drug-resistant bacteria from selected water distribution systems in Southwestern Nigeria. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 35. [Google Scholar] [CrossRef] [Scilit]
- Lees, P.; Pelligand, L.; Giraud, E.; Toutain, P.L. A History of Antimicrobial drugs in animals: Evolution and revolution. J. Vet. Pharmacol. Ther. 2021, 44, 137–171. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization (WHO). WHO List of Medically Important Antimicrobials a Risk Management Tool for Mitigating Antimicrobial Resistance Due to Non-Human Use; WHO: Geneva, Switzerland, 2024; Available online: https://cdn.who.int/media/docs/default-source/gcp/who-mia-list-2024-lv.pdf?sfvrsn=3320dd3d_2 (accessed on 10 September 2025).
- Khalid, T.; Hdaifeh, A.; Federighi, M.; Cummins, E.; Boué, G.; Guillou, S.; Tesson, V. Review of Quantitative Microbial Risk Assessment in Poultry Meat: The Central Position of Consumer Behavior. Foods 2020, 9, 1661. [Google Scholar] [CrossRef] [Scilit]
- Plaza-Rodríguez, C.; Mesa-Varona, O.; Alt, K.; Grobbel, M.; Tenhagen, B.-A.; Kaesbohrer, A. Comparative Analysis of Consumer Exposure to Resistant Bacteria through Chicken Meat Consumption in Germany. Microorganisms 2021, 9, 1045. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krumperman, P.H. Multiple antibiotic resistance indexing of E. coli to identify high-risk sources of fecal contamination of foods. Appl. Environ. Microbiol. 1983, 46, 165–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmed, H.A.; El-Tahlawy, A.S.; El Bayomi, R.M.; Ahmed, M.A.; Abd Elazeem, M.A.; Alahmad, W.; Hafez, A.E.S.E. Prevalence, Antimicrobial Resistance, and Genetic Profile of Escherichia Coli in Retail Chicken Parts in Zagazig City, Egypt. Int. J. Food Microbiol. 2025, 436, 111211. [Google Scholar] [CrossRef] [Scilit]
- Ranasinghe, R.A.S.S.; Satharasinghe, D.A.; Anwarama, P.S.; Parakatawella, P.M.S.D.K.; Jayasooriya, L.J.P.A.P.; Ranasinghe, R.M.S.B.K.; Rajapakse, R.P.V.J.; Huat, J.T.Y.; Rukayadi, Y.; Nakaguchi, Y.; et al. Prevalence and Antimicrobial Resistance of Escherichia coli in Chicken Meat and Edible Poultry Organs Collected from Retail Shops and Supermarkets of North Western Province in Sri Lanka. J. Food Qual. 2022, 2022, 8962698. [Google Scholar] [CrossRef] [Scilit]
- Khanom, H.; Nath, C.; Mshelbwala, P.P.; Pasha, M.R.; Magalhaes, R.S.; Alawneh, J.I.; Hassan, M.M. Epidemiology and Molecular Characterisation of Multidrug-Resistant Escherichia Coli Isolated from Chicken Meat. PLoS ONE 2025, 20, e0323909. [Google Scholar] [CrossRef] [Scilit]
- Tanzin, A.Z.; Nath, C.; Nayem, M.R.K.; Sayeed, M.A.; Khan, S.A.; Magalhaes, R.S.; Alawneh, J.I.; Hassan, M.M. Detection and Characterisation of Colistin-Resistant Escherichia coli in Broiler Meats. Microorganisms 2024, 12, 2535. [Google Scholar] [CrossRef] [Scilit]
- Rawat, N.; Anjali; Shreyata; Sabu, B.; Devi, P.P.; Jamwal, R.; Yadav, K.; Kumar, N.; Rajagopal, R. Recovery of Multi-Drug Resistant, Multiple Antibiotic Resistance Genes-Carrying Non-Typhoidal Salmonella from Antibiotic-Free and Conventional Chicken Meat: A Comparative Study in Delhi, India. Microbe 2025, 6, 100270. [Google Scholar] [CrossRef] [Scilit]
- Karim, M.R.; Zakaria, Z.; Hassan, L.; Mohd Faiz, N.; Ahmad, N.I. Antimicrobial Resistance Profiles and Co-Existence of Multiple Antimicrobial Resistance Genes in mcr-Harbouring Colistin-Resistant Enterobacteriaceae Isolates Recovered from Poultry and Poultry Meats in Malaysia. Antibiotics 2023, 12, 1060. [Google Scholar] [CrossRef] [Scilit]
- Ferri, G.; Buonavoglia, A.; Farooq, M.; Festino, A.R.; Ruffini, F.; Paludi, D.; Di Francesco, C.E.; Vergara, A.; Smoglica, C. Antibiotic resistance in Italian poultry meat production chain: A one-health perspective comparing antibiotic free and conventional systems from the farming to the slaughterhouse. Front. Food. Sci. Technol. 2023, 3, 1168896. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Dyall-Smith, M.; Marenda, M.; Hu, H.-W.; Browning, G.; Billman-Jacobe, H. Antibiotic Resistance Genes in Antibiotic-Free Chicken Farms. Antibiotics 2020, 9, 120. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Ed-Dra, A.; Tang, B.; Kang, X.; Müller, A.; Kehrenberg, C.; Jia, C.; Pan, H.; Yang, H.; Yue, M. Higher Tolerance of Predominant Salmonella Serovars Circulating in the Antibiotic-Free Feed Farms to Environmental Stresses. J. Hazard. Mater. 2022, 438, 129476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Ashworth, A.J.; Willett, C.; Cook, K.; Upadhyay, A.; Owens, P.R.; Ricke, S.C.; DeBruyn, J.M.; Moore, P.A. Review of Antibiotic Resistance, Ecology, Dissemination, and Mitigation in U.S. Broiler Poultry Systems. Front. Microbiol. 2019, 10, 2639. [Google Scholar] [CrossRef] [Scilit]
- The European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 14.0; The European Committee on Antimicrobial Susceptibility Testing: Växjö, Sweden, 2024. [Google Scholar]
- Smoglica, C.; Farooq, M.; Ruffini, F.; Marsilio, F.; Di Francesco, C.E. Microbial Community and Abundance of Selected Antimicrobial Resistance Genes in Poultry Litter from Conventional and Antibiotic-Free Farms. Antibiotics 2023, 12, 1461. [Google Scholar] [CrossRef] [Scilit]
- Bailey, M.; Taylor, R.; Brar, J.; Corkran, S.; Velásquez, C.; Novoa-Rama, E.; Oliver, H.F.; Singh, M. Prevalence and Antimicrobial Resistance of Salmonella from Antibiotic-Free Broilers during Organic and Conventional Processing. J. Food Prot. 2020, 83, 491–496. [Google Scholar] [CrossRef] [Scilit]
- Lopes, H.; Alves, L.; Costa, G.; Dias, T.; Machado, L.; Cunha, N.; Pereira, V.; Abreu, D. Detection and Antimicrobial Resistance Profile of Enteropathogenic (EPEC) and Shigatoxigenic Escherichia Coli (STEC) in Conventional and Organic Broiler Chickens. Braz. J. Poult. Sci. 2023, 25, eRBCA-2022. [Google Scholar] [CrossRef] [Scilit]
- Vieira, T.R.; de Oliveira, E.C.; Cibulski, S.P.; Borba, M.R.; Cardoso, M. Antimicrobial Resistance Profiles in Escherichia Coli Isolated from Whole-Chicken Carcasses from Conventional, Antibiotic-Free, and Organic Rearing Systems. Semin. Ciências Agrárias 2022, 43, 2093–2108. [Google Scholar] [CrossRef] [Scilit]
- ISO 6579-1:2017; Microbiology of the Food Chain—Horizontal Method for the Detection, Enumeration and Serotyping of Salmonella—Part 1: Detection of Salmonella spp. ISO: Geneva, Switzerland, 2017.
- Klein, G.; Pack, A.; Reuter, G. Antibiotic resistance patterns of enterococci and occurrence of vancomycin-resistant enterococci in raw minced beef and pork in Germany. Appl. Environ. Microbiol. 1998, 64, 1825–1830. [Google Scholar] [CrossRef] [Scilit]
- Peres, N.D.; Lange, C.C.; Brito, M.A.V.P.; Brito, J.R.F.; Arcuri, E.F.; Cerqueira, M.M.O.P. Detection of Listeria Monocytogenes by PCR in artificially contaminated milk samples. Arq. Bras. Med. Vet. Zootec. 2010, 62, 973–979. [Google Scholar] [CrossRef] [Scilit]
- Pui, C.F.; Wong, W.C.; Chai, L.C.; Nillian, E.; Ghazali, F.M.; Cheah, Y.K.; Nakaguchi, Y.; Nishibuchi, M.; Radu, S. Simultaneous detection of Salmonella spp., Salmonella Typhi and Salmonella Typhimurium in sliced fruits using multiplex PCR. Food Control 2011, 22, 337–342. [Google Scholar] [CrossRef] [Scilit]
- Dias, R.C.B.; dos Santos, B.C.; dos Santos, L.F.; Vieira, M.A.; Yamatogi, R.S.; Mondelli, A.L.; Sadatsune, T.; Sforcin, J.M.; Gomes, T.A.T.; Hernandes, R.T. Diarrheagenic Escherichia coli Pathotypes investigation revealed atypical Enteropathogenic E. coli as putative emerging diarrheal agents in children living in Botucatu, São Paulo State, Brazil. Apmis 2016, 124, 299–308. [Google Scholar] [CrossRef] [Scilit]
- Swamy, S.C.; Barnhart, H.M.; Lee, M.D.; Dreesen, D.W. Virulence determinants InvA and SpvC in Salmonellae isolated from poultry products, wastewater, and human sources. Appl. Environ. Microbiol. 1996, 62, 3768–3771. [Google Scholar] [CrossRef] [Scilit]
- Pereira, J.G.; Soares, V.M.; Tadielo, L.E.; dos Santos, E.A.R.; Lopes, G.V.; da Cruz Payão Pellegrini, D.; Duval, E.H.; da Silva, W.P. Foods Introduced into Brazil through the border with Argentina and Uruguay: Pathogen detection and evaluation of hygienic-sanitary quality. Int. J. Food Microbiol. 2018, 283, 22–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ke, D.; Picard, F.J.; Martineau, F.; Ménard, C.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Development of a PCR Assay for rapid detection of Enterococci. J. Clin. Microbiol. 1999, 37, 3497–3503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CLSI M100; Performance Standards for Antimicrobial Susceptibility Testing, 30th Edition. Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2020.
- Magiorakos, A.; Srinivasan, R.B.; Carey, Y.; Carmeli, M.E.; Falagas, C.G.; Giske, S.; Harbarth, J.F.; Hindler, G.; Kahlmeter, B.; Olsson-Liljequist, D.L.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Chain | Salmonella spp. | E. coli | Enterococcus spp. | ||||||
|---|---|---|---|---|---|---|---|---|---|
| N (%) | p Value | Isolates | N (%) | p Value | Isolates | N (%) | p Value | Isolates | |
| Conventional | 26/143 (18.2%) | 0.0001 | 177 | 29/143 (20.3%) | 0.4767 | 47 | 76/83 (91.6%) | 0.3287 | 146 |
| ABF | 5/141 (3.5%) | 18 | 34/141 (24.1%) | 51 | 78/81 (96.3%) | 153 | |||
| Total | 31/284 (10.9%) | 195 | 63/284 (22.2%) | 98 | 154/164 (93.9%) | 299 | |||
| Chain | Resistant Isolates (n/N, % Within Chain) | Positive Samples (n/N, % Within Chain) |
|---|---|---|
| Conventional | 316/370 (85.4%) | 104/143 (72.7%) |
| ABF | 156/222 (72.7%) | 82/141 (58.1%) |
| Total | 472/592 (79.7%) | 186/284 (65.5%) |
| Antibiotic | Salmonella spp. | E coli | Enterococcus spp. | ||||
|---|---|---|---|---|---|---|---|
| CON. | ABF | CON. | ABF | CON. | ABF | ||
| Aminoglycosides | GEN | 0.0 | 0.0 | 4.3 | 8.0 | 2.1 | 5.2 |
| EST | 9.0 | 0.0 | 6.4 | 6.0 | 11.0 | 2.6 a* | |
| Folate pathway antagonist | SUT | 91.0 | 100.0 | 57.4 | 50.0 | - | - |
| Beta-lactams | AMC | 75.7 | 100.0 a | 0.0 | 6.0 | - | - |
| Carbapenems | IPM | 2.3 | 0.0 | 0.0 | 0.0 | - | - |
| MER | 0.0 | 0.0 | 0.0 | 0.0 | - | - | |
| Cephalosporins | CFO | 22.6 | 27.8 | 0.0 | 8.0 | - | - |
| CTF | 84.8 | 100.0 | 8.5 | 16.0 | - | - | |
| Phenicoles | CLO | 7.3 | 0.0 | 6.4 | 8.0 | 1.4 | 0.7 |
| Fluoroquinolones and Quinolones | CIP | 84.2 | 83.3 | 2.1 | 4.0 | 25.3 | 23.5 |
| NOR | 0.0 | 0.0 | 0.0 | 0.0 | - | - | |
| Glycopeptides | VAN | - | - | - | - | 20.5 | 23.5 |
| TEI | - | - | - | - | 2.1 | 0.7 | |
| Macrolides | AZI | 1.7 | 0.0 | 0.0 | 2.0 | - | - |
| Monobactams | ATM | 5.1 | 0.0 | 0.0 | 4.0 | - | - |
| Nitrofurans | NIT | 7.9 | 27.8 a | 4.3 | 0.0 | - | - |
| Oxazolidinones | LNZ | - | - | - | - | 7.5 | 7.2 |
| Penicillins | AMP | 90.4 | 100.0 | 63.8 | 62.0 | 2.7 | 0.0 |
| PEN | - | - | - | - | 3.4 | 0.0 a | |
| Tetracyclines | TET | 85.3 | 100.0 | 44.6 | 42.0 | 52.7 | 34.6 a |
| Bacteria | Total MDR | Conventional | ABF |
|---|---|---|---|
| Salmonella spp. | 182/195 (93.3%) | 164/177 (92.7%) | 18/18 (100.0%) |
| Escherichia coli | 42/98 (42.9%) | 18/47 (38.2%) | 24/51 (47.0%) |
| Enterococcus spp. | 32/299 (10.7%) | 22/147 (15.0%) | 10/153 (6.5%) |
| Total | 256/592 (43.2%) | 204/371 (55.0%) a | 52/222 (23.4%) b |
| Pathogens | MDR Profiles from ABF | Frequency ABF | MDR Profiles from Conventional | Frequency Conventional |
|---|---|---|---|---|
| Salmonella spp. | AMC-CTF-CIP-SUT-AMP-TET | 8 (44.4%) | AMC-CTF-CIP-SUT-AMP-TET | 76 (42.9%) |
| AMC-CFO-CTF-CIP-SUT-AMP-TET | 4 (22.0%) | AMC-CFO-CTF-CIP-SUT-AMP-TET | 19 (10.7%) | |
| E coli | SUT-AMP-TET | 5 (9.8%) | SUT-AMP-TET | 7 (14.9%) |
| SUT-AMP-CLO-TET | 3 (5.9%) | SUT-AMP-CLO-TET | 1 (2.1%) | |
| Enterococcus spp. | TET-LNZ-CIP-VAN | 2 (1.3%) | TET-LNZ-CIP-VAN | 1 (0.6%) |
| LNZ-CIP-VAN | 2 (1.3%) | LNZ-CIP-VAN | 1 (0.6%) |
| Pathogen | Target Genes | Sequence (5′-3′) | Bp | Reference |
|---|---|---|---|---|
| Salmonella spp. | invA | F: TTGTTACGGCTATTTTGACCA R: CTGACTGCTACCTTGCTGATG | 521 | [65] |
| Escherichia coli | uspA | F: CCGATACGCTGCCAATCAGT R: ACGCAGACCGTAGGCCAGAT | 884 | [66] |
| Enterococcus spp. | tuf | F: TACTGACAAACCATTCATGATG R: AACTTCGTCACCAACGCGAAC | 112 | [67] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cerqueira-Cézar, C.K.; Sampaio, A.N.d.C.E.; Caron, E.F.F.; Dellaqua, T.T.; Ribeiro, L.F.M.; Tadielo, L.E.; Pantoja, J.C.d.F.; Viana, G.G.F.; Rossi, G.A.M.; Spanu, C.; et al. Antimicrobial Resistance in Chicken Meat: Comparing Salmonella, Escherichia coli, and Enterococcus from Conventional and Antibiotic-Free Productions. Microorganisms 2025, 13, 2227. https://doi.org/10.3390/microorganisms13102227
Cerqueira-Cézar CK, Sampaio ANdCE, Caron EFF, Dellaqua TT, Ribeiro LFM, Tadielo LE, Pantoja JCdF, Viana GGF, Rossi GAM, Spanu C, et al. Antimicrobial Resistance in Chicken Meat: Comparing Salmonella, Escherichia coli, and Enterococcus from Conventional and Antibiotic-Free Productions. Microorganisms. 2025; 13(10):2227. https://doi.org/10.3390/microorganisms13102227
Chicago/Turabian StyleCerqueira-Cézar, Camila Koutsodontis, Aryele Nunes da Cruz Encide Sampaio, Evelyn Fernanda Flores Caron, Thaisy Tino Dellaqua, Lucas Franco Miranda Ribeiro, Leonardo Ereno Tadielo, José Carlos de Figueiredo Pantoja, Gustavo Guimarães Fernandes Viana, Gabriel Augusto Marques Rossi, Carlo Spanu, and et al. 2025. "Antimicrobial Resistance in Chicken Meat: Comparing Salmonella, Escherichia coli, and Enterococcus from Conventional and Antibiotic-Free Productions" Microorganisms 13, no. 10: 2227. https://doi.org/10.3390/microorganisms13102227
APA StyleCerqueira-Cézar, C. K., Sampaio, A. N. d. C. E., Caron, E. F. F., Dellaqua, T. T., Ribeiro, L. F. M., Tadielo, L. E., Pantoja, J. C. d. F., Viana, G. G. F., Rossi, G. A. M., Spanu, C., Possebon, F. S., & Pereira, J. G. (2025). Antimicrobial Resistance in Chicken Meat: Comparing Salmonella, Escherichia coli, and Enterococcus from Conventional and Antibiotic-Free Productions. Microorganisms, 13(10), 2227. https://doi.org/10.3390/microorganisms13102227

