You are currently viewing a new version of our website. To view the old version click .
Microorganisms
  • Article
  • Open Access

3 November 2022

MALDI-TOF MS Identification of Dromedary Camel Ticks and Detection of Associated Microorganisms, Southern Algeria

,
,
,
,
,
,
,
and
1
IHU Méditerranée Infection, 19-21 Boulevard Jean Moulin, 13005 Marseille, France
2
Aix Marseille Univ, IRD, AP-HM, SSA, VITROME, 13005 Marseille, France
3
Laboratoire des Biotechnologies Liées à la Reproduction Animale, Institut des Sciences Vétérinaires, Université de Blida 1, Blida 09000, Algeria
4
Laboratoire Mixte International REMEDIER, VITROME, IRD, 13005 Marseille, France
This article belongs to the Special Issue Advanced Research on Ticks and Tick-Borne Diseases

Abstract

This study used MALDI-TOF MS and molecular tools to identify tick species infesting camels from Tamanrasset in southern Algeria and to investigate their associated microorganisms. Ninety-one adult ticks were collected from nine camels and were morphologically identified as Hyalomma spp., Hyalomma dromedarii, Hyalomma excavatum, Hyalomma impeltatum and Hyalomma anatolicum. Next, the legs of all ticks were subjected to MALDI-TOF MS, and 88/91 specimens provided good-quality MS spectra. Our homemade MALDI-TOF MS arthropod spectra database was then updated with the new MS spectra of 14 specimens of molecularly confirmed species in this study. The spectra of the remaining tick specimens not included in the MS database were queried against the upgraded database. All 74 specimens were correctly identified by MALDI-TOF MS, with logarithmic score values ranging from 1.701 to 2.507, with median and mean values of 2.199 and 2.172 ± 0.169, respectively. One H. impeltatum and one H. dromedarii (2/91; 2.20%) tested positive by qPCR for Coxiella burnetii, the agent of Q fever. We also report the first detection of an Anaplasma sp. close to A. platys in H. dromedarii in Algeria and a potentially new Ehrlichia sp. in H. impeltatum.

1. Introduction

Ticks are obligate hematophagous ectoparasites that infest most vertebrates worldwide, from the warmest regions of the globe to the coldest ones [1]. To date, over 900 tick species have been described around the world [2]. Ticks are significant vectors of a wide range of microorganisms, including bacteria, helminths, viruses and protozoa [1,3,4,5]. They are considered a major global human and veterinary public health problem by being reservoirs and/or vectors of infectious disease agents to susceptible hosts [6].
Dromedary camel (Camelus dromedarius) populations are widespread in the Middle East and North Africa, including Algeria [7,8,9,10]. They play an important role in the culture and economy of some countries. In fact, they represent their main source of milk and meat production because of their very unique adaptative physiological characteristics to arid and semi-arid ecosystems [11,12]. Camel production is negatively impacted by zoonotic diseases [7,13]. Ticks are one of the most predominant ectoparasites that negatively affect their productivity as well as their performance by either transmitting infectious pathogenic agents or causing traumatic lesions and severe anemia due to blood loss [9,14,15].
Camels can be infested with different tick species, such as Hyalomma dromedarii, H. impeltatum, H. excavatum, H. marginatum, H. anatolicum, H. impressum, H. truncatum, Rhipicephalus sanguineus, R. pulchellus, Amblyomma variegatum and A gemma. Camel ticks have been associated with several tick-borne pathogens, including Babesia spp., Rickettsia spp., Anaplasma spp., Coxiella burnetii, Ehrlichia spp. and Theileria spp. [7,16,17,18,19]. Anaplasma phagocytophilum and A. marginale have been implicated in anaplasmosis in camels in India, Iran, Saudi Arabia and Tunisia [20,21,22,23,24]. In Algeria, a molecular investigation of Anaplasma species in dromedaries and their ticks is lacking. Nevertheless, C. burnetii, the agent of Q fever, and Rickettsia africae, the agent of African tick bite fever, were detected in camel Hyalomma spp. ticks from Algeria [17,25].
Tick identification is essential for the epidemiological mapping of vectors and tick-borne diseases. Accurate identification is important for effective control strategies [1,6]. Tick characterization is mainly based either on their morphology or on the use of DNA-based methods [26]. Nevertheless, the morphological identification of ticks still requires tremendous entomological expertise. In some cases, the identification criteria can be ambiguous in immature stages (larvae and nymphs), damaged or engorged specimens, and cryptic species. The method is also limited by the availability of relevant taxonomic keys. As for molecular methods, they are laborious, expensive and usually conditioned by the choice of the relevant target gene and by the availability of good-quality sequences in GenBank [27,28].
Recently, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has been used in medical entomology for the identification of many arthropods of medical and veterinary importance [27,29,30,31]. This proteomic tool has been successfully used in identifying tick species by analyzing the proteins extracted from their legs [27,32,33].
Our study aimed to test the ability of MALDI-TOF MS to identify tick species infesting dromedary camels in Algeria and to detect associated microorganisms using molecular tools.

2. Materials and Methods

2.1. Ethics Statement

Risk assessment was submitted to and approved by the ethics committee and decision board of the Inspection Vétérinaire (Direction des Services Agricoles) of Tamanrasset province of Algeria. This institution is affiliated with the Directions des Services Veterinaires (Algerian Ministry of Agriculture and Rural Development). To facilitate fieldwork, collaboration was established with the veterinary inspector of Tamanrasset province. The dromedary camels were handled by local veterinarians. Importation authorization was obtained from the relevant entity (DDPP/Prefecture of Bouches-du-Rhône, Marseille, France) in August 2018 under the number ER 11/18.

2.2. Study Area and Tick Sampling

In August 2018, nine camels were examined for tick collection at the livestock market in the commune of Tamanrasset, which is located in the province of Tamanrasset, in southernmost Algeria, at the border with Mali and Niger (22°47′25.069′′ N, 5°31′9.577′′ E) (Figure 1). Ticks were carefully removed using forceps and placed in individually labeled tubes for each camel. The tubes contained 70% ethanol and were stored at room temperature. Three months later, samples were transported to Marseille, France, for subsequent analysis. Tick morphological identification was performed by using standard keys and descriptions with a Leica EZ4 binocular microscope [34,35]. Specimens were codified according to the genus, species and sex.
Figure 1. Map of Algeria showing the location of tick collection (Tamanrasset) and the examined dromedary camels. ArcGIS 10.3 software (http://www.esri.com, accessed on 25 October 2021).
ArcGIS 10.3 software (http://www.esri.com, accessed on 25 October 2021) was used to map the spatial localization of tick sampling in our study region.
All specimens were then subjected to MALDI-TOF MS analyses after being morphologically identified. For some specimens, molecular identification was also carried out as described below.

2.3. Sample Preparation for MALDI-TOF MS

Ethanol-preserved ticks were rinsed with distilled water and then dried with filter paper. Four legs from only one side were dissected using a sterile surgical blade used for MALDI-TOF MS analysis. The leg sample preparation was performed using a previously described protocol [27]. One microliter of the supernatant of the protein extract of each sample was spotted in quadruplicate onto a MALDI-TOF plate (Bruker Daltonics, Wissembourg, France). All spots were left to dry and then covered with 1 μL of HCCA matrix composed of saturated α-cyano-4-hydroxycynnamic acid (Sigma, Lyon, France), 50% acetonitrile, 2.5% trifluoroacetic acid (Aldrich, Dorset, UK) and HPLC grade water [27]. The target plate was left to dry at room temperature and then introduced into a Microflex LT MALDI-TOF Mass Spectrometer device (Bruker Daltonics, Bremen, Germany) for analysis.
The tick’s remaining body was longitudinally cut into two halves, one half being used for molecular identification and the detection of microorganisms and the other half being preserved at −20 °C [27].

2.4. Molecular Identification of Ticks

Molecular identification was performed in order to validate the morphological identification of specimens whose MS spectra were added to our in-house arthropod spectra MS database. It was also carried out to confirm the identification assigned by MALDI-TOF MS of randomly selected specimens morphologically identified as Hyalomma spp.
We followed the same DNA extraction protocol described elsewhere [27]. DNA obtained from each tick specimen was subjected to standard PCR in an automated DNA thermal cycler (Applied Biosystems, 2720, Foster City, CA, USA) to amplify a 455 base-pair fragment of the 16S rRNA gene using tick 16S primers (F-CCGGTCTGAACTCAGATCAAGT and 16S-R CTGCTCAATGATTTTTTAAATTGCTGTGG) [36]. The amplified products were purified and sequenced as described previously [32]. The obtained sequences were assembled and corrected by Chromas Pro1.77 (Technelysium Pty. Ltd., Tewantin, Australia) and a BLAST query was performed against the NCBI GenBank database (http://www.ncbi.nlm.nih.gov/blast/ accessed on 13 May 2021).

2.5. Microorganism Detection

All tick specimens were screened for the presence of Rickettsia spp., Bartonella spp., Anaplasmataceae spp., Borrelia spp., Coxiella burnetii and Piroplasmida using previously described primers and probes [37,38,39,40,41,42]. qPCR was performed using the CFX96 Real-Time System (Bio-Rad, Marnes-La-Coquette, France). We used positive controls from our laboratory cultures (DNA from Rickettsia montanensis, Bartonella elizabethae, Anaplasma phagocytophilum, Coxiella burnetii, Borrelia crocidurae and Babesia vogeli) and negative controls (qPCR mix without any DNA) for each qPCR plate. For C. burnetii qPCR, two intergenic regions were targeted IS30A and IS1111. Only samples that tested positive for both genes were considered positive. The tick specimens were considered positive when the cycle threshold (Ct) value was <36 [43]. Anaplasmataceae-positive samples were then subjected to standard PCR using 3 different primers for species determination: 16S rRNA (Ehr-16S-D GGTACCYACAGAAGAAGTCC and Ehr-16S-R TAGCACTCATCGTTTACAGC) [44], 23S rRNA (Ana23S-212f ATAAGCTGCGGGGAGTTGTC and Ana23S-753r TGCAAAAGGTACGCTGTCAC) [37] and groEL (Ehr-groEL-F GTTGAAAARACTGATGGTATGCA and Ehr-groEL-R ACACGRTCTTTACGYTCYTTAAC) [45]. The obtained sequences were assembled, corrected by Chromas Pro (Technelysium Pty. Ltd., Tewantin, Australia) and then compared with the sequences available in GenBank. The phylogenetic tree reconstruction was performed using MEGA 7 using the maximum likelihood and the model selected by MEGA 7 [46]. Bootstrap analyses were conducted using 500 replicates.

2.6. Spectral Analysis and Database Creation

The reproducibility of the MS profiles of tick species was assessed using both Flex analysis V 3.3 and ClinProTools v.2.2 software packages (Bruker Daltonics, Germany) [32]. Intra-species reproducibility and inter-species specificity were validated by comparing and analyzing the spectral profiles obtained from the four spots of each individual specimen. Poor-quality spectra were excluded from the analysis (<3000 arbitrary units (a.u.) and background noise). Cluster analysis (MS dendrogram) was performed with MS spectra of specimens of each species using MALDI-Biotyper 3.0 software. The database was then created by adding high-quality MS spectra of each species to our homemade arthropod spectra MS database after molecular confirmation.

2.7. Blind Test

All MS spectra obtained from tick leg specimens were subjected to blind test analysis, except for those used to create the MS database (MS reference spectra). The log-score values (LSVs), ranging from 0 to 3, were computed by the MALDI-Biotyper v.3.0 (Bruker Daltonic, Germany). The LSVs refer to the degree of homology between MS reference spectra and MS spectra used for the blind test [47].

3. Results

3.1. Morphological Identification of Ticks

Overall, 91 adult ticks were collected from 9 examined camels. These included 41 (45.05%) males and 50 (54.95%) females, all belonging to the Hyalomma genus. Engorged females (n = 41; 45.05% of all ticks) were only identified at the genus level. For those identified at the species level, the most abundant tick species were H. dromedarii (n = 42; 46.15%), followed by H. excavatum (n = 4; 4.4%) and H. impeltatum (n = 3; 3.3%). One H. anatolicum (1.1%) was also identified (Table 1).
Table 1. Ticks used for the creation of MALDI-TOF MS reference database and blind tests.

3.2. MS Identification of Dromedary Camel Ticks

A total of 91 tick leg samples were subjected to MALDI-TOF MS. The visualization of all MS spectra using Flex analysis v3.4 software showed that 96.70% (88/91) of MS spectra were of excellent quality. Representative MS profiles of the three tick species are presented in Figure 2A. Cluster analysis (Figure 2B) revealed inter-species specificity, as all specimens of the same species were clustered on the same branch.
Figure 2. MALDI-TOF MS spectra obtained from tick species added to the database: H. dromedarii, H. impeltatum and H. excavatum. (A) Spectral alignment of the three species using Flex Analysis software and (B) MS dendrogram created using MS spectra from the three species using Biotyper software v.3.0.
This was confirmed by a principal component analysis (PCA) diagram generated by ClinProTools software, which revealed a visible distinction between the three species (Figure 3A).
Figure 3. MALDI-TOF MS spectra obtained from tick species. (A) Comparison of MALDI-TOF MS spectra of three species by principal component analysis using ClinProTools 2.2. (B) Graphical representation showing the log-score value classification according to the present species: H. dromedarii, H. impeltatum and H. excavatum.
Our homemade MALDI-TOF arthropod spectra database (MALDI-Biotyper 3.0) was upgraded with the MS reference spectra of 14 specimens, 12 H. dromedarii, 1 H. excavatum and 1 H. impeltatum, all of which were molecularly identified. The remaining 74 good-quality spectra from tick legs were subjected to a blind test against our upgraded database (Figure 4). The results showed that of the 36 specimens of ticks morphologically identified as Hyalomma spp., 34 were identified by MALDI-TOF MS as H. dromedarii, with LSVs ranging from 1.890 to 2.507, and two were identified as H. excavatum, with LSVs ranging from 1.801 to 1.880 (Table 1). For those morphologically identified as H. dromedarii, all were identified by MALDI-TOF MS as H. dromedarii as well, with LSVs ranging from 1.701 to 2.431. Those morphologically identified as H. impeltatum were identified by MS as H. impeltatum, with LSVs ranging from 2.081 to 2.083. The three ticks morphologically identified as H. excavatum were identified by MS as H. excavatum, with LSVs of 2.046–2.204 (Table 1) (Figure 4).
Figure 4. Study design showing two sections: tick identification and microorganism identification. The first section is summarized by a flowchart including morphological identification results (1.1), molecular identification results (1.2) and MALDI-TOF MS analysis results (1.3). The second section includes qPCR and sequencing results using different genes.
The tick whose morphological identification was corrected by sequencing was identified by MS as H. dromedarii [LSV: 2.342], in agreement with the molecular identification (Table 1). The median of all log-score values was 2.199, and the mean LSV was 2.172 ± 0.169. All of the obtained score values of each species, H. dromedarii, H. impeltatum and H. excavatum, are presented in Figure 3B. Our camel tick MALDI-TOF MS database is publicly accessible and can be downloaded with the following DOI number: https://doi.org/10.35081/srfb-n029, accessed on 25 October 2021.

3.3. Molecular Identification of Ticks

In total, 17 specimens morphologically identified as H. dromedarii (n = 8), Hyalomma spp. (n = 4), H. excavatum (n = 3), H. impeltatum (n = 1) and H. anatolicum (n = 1) were submitted to sequencing for the MS database creation (Figure 4). BLAST analyses of ticks morphologically identified as H. dromedarii, H. impeltatum and H. excavatum were 99.52–100% (MN960589), 99.75% (MN960583) and 100% (KU130429/MK601704), respectively, identical to their homologous sequences available in GenBank. The sequence of the tick morphologically identified as H. anatolicum was in fact 100% identical to the sequence of H. dromedarii (MN960589).
The sequences of four randomly chosen specimens morphologically identified as Hyalomma spp. were 99.76–100% identical to H. dromedarii sequences (LC654693/MN960589) (Table 1). Finally, only the MS spectra of 14 molecularly confirmed ticks (H. dromedarii (n = 12), H. excavatum (n = 1) and H. impeltatum (n = 1)) were added to our homemade MS database.
Ten tick specimens morphologically identified as Hyalomma spp., of which eight were identified by MALDI-TOF MS as H. dromedarii and two were identified as H. excavatum, were also submitted to molecular analysis to verify the MS identifications (Figure 4). The sequencing results revealed that eight specimens were 99.73–100% identical to H. dromedarii (MN960589), and two specimens were 100% identical to H. excavatum (MK601704). Molecular tools confirmed the identification of ticks that were unable to be morphologically identified to the species level. The 16S sequences of the ticks obtained in this study have been deposited in the GenBank database under the following accession numbers: OL672219, OL672220, OL672221, OL672222, OL672223 and OL672224 for H. dromedarii, OL672225 for H. impeltatum and OL672226 for H. excavatum.

3.4. Microorganism Screening

A total of 10/91 (10.98%) ticks tested positive by qPCR for microorganisms, including C. burnetii (2/91; 2.20%) and Anaplasmataceae spp. (8/91; 8.80%). The two ticks positive for C. burnetii using both the IS30A and IS1111 sequences were one H. impeltatum and one H. dromedarii. Anaplasmataceae spp. were detected in two H. impeltatum and six H. dromedarii (Figure 4). No Borrelia spp., Piroplasma spp., Rickettsia spp. or Bartonella spp. were detected.
The sequencing of a fragment of the Anaplasmataceae 16rRNA gene was only successful for three out of eight specimens. BLAST analysis revealed that the two sequences obtained from two positive H. dromedarii ticks showed 100% similarity to Candidatus Anaplasma camelii (MT510533) and A. platys (MN630836), respectively. One sequence detected in the H. impeltatum tick revealed 99.63% similarity to Candidatus Midichloria mitochondrii (endosymbiotic bacterium), which was previously detected in an H. dromedarii tick from Tunisia (MK416236) (Table 2). The maximum likelihood (ML) phylogenetic tree based on the 16S rRNA gene (Figure 5) showed that Anaplasma detected in H. dromedarii belonged to the cluster of Ca. A. camelii and A. platys.
Table 2. Molecular characterization of Anaplasmataceae identified in ticks.
Figure 5. Representative maximum likelihood tree based on 16S rRNA sequences using Tamura 3-parameter model. Statistical support for internal branches of the trees was evaluated by bootstrapping with 500 iterations. The sequences obtained are highlighted in bold, and the cluster of Ca. A Camelii and A. platys is colored in rose. Rickettsia conorii was used as an outgroup.
BLAST of the 23S rRNA gene sequences obtained from these three Anaplasmataceae-positive samples showed that two sequences from H. dromedarii ticks were 99.78–100% identical to an uncultured Anaplasma sp. (MN626401), and the sequence obtained from H. impeltatum was 97.28% identical to Candidatus Ehrlichia rustica (KT364330) (Table 2). The 23S sequence of Ca. A. camelii was not available in GenBank. The ML phylogenetic tree based on the 23S rRNA gene (Figure 6) revealed that the two sequences from the Anaplasma-positive samples (H. dromedarii) belonged to the main cluster of A. platys. More specifically, the obtained sequences formed a separate and well-supported subcluster with the uncultured Anaplasma (referred to as A. platys-like) isolated from the blood of camels from Egypt (MN626401) but closely related to the subcluster of A. platys. One sequence of Ehrlichia sp. (n = 1; 1.10%) obtained from H. impeltatum formed an independent subcluster. However, it was close to the subcluster of E. canis.
Figure 6. Phylogenetic tree of the 23S rRNA gene using the maximum likelihood method. The values on the branches are bootstrap support values based on 500 replications. The position of the obtained sequence is indicated in bold. The subcluster of A. platys is colored in green, and the subcluster of the sequences obtained is colored in rose. The subcluster of the obtained sequence of Ehrlichia is colored in purple. Borrelia hermsii was used as an outgroup.
The H. impeltatum specimen positive for Anaplasmataceae, whose sequence was close to “Candidatus Ehrlichia rustica” for the 23S rRNA gene, was then subjected to sequencing with the groEL gene for confirmation. BLAST analysis showed that the obtained groEL sequence was 94.59% identical to E. canis (Table 2). The groEL ML phylogenetic analysis (Figure 7) revealed that the sequence of Ehrlichia sp. (H. impeltatum) formed an independent and well-supported (bootstrap support ≈ 100%) branch separated from the other Ehrlichia spp., showing that it may potentially be a novel species of Ehrlichia.
Figure 7. Phylogenetic tree based on groEL sequences aligned with MEGA 7 using Tamura 3-parameter model. Statistical support for internal branches of the trees was evaluated by bootstrapping with 500 iterations. Rickettsia typhi was added as an outgroup.
In summary, two ticks, one H. impeltatum and one H. dromedarii, were positive for C. burnetii using both IS30A and IS1111 primers, confirming the presence of C. burnetii DNA. In two other H. dromedarii (2.20%), we identified an Anaplasma sp. closely related to A. platys using the 16S and 23S genes and a potentially new Ehrlichia sp. using 23S and groEL in H. impeltatum. The sequences of the ticks and microorganisms have been deposited in GenBank, and the accession numbers of these sequences are OL672236, OL672237 and OL672238 for the 16SrRNA gene, OL672216, OL672217 and OL672218 for the 23S rRNA gene and OL757650 for the groEL gene.

4. Discussion

In recent years, MALDI-TOF MS has been used to accurately and rapidly diagnose bacterial species and identify fungi [48,49]. This method is now incorporated into diagnostic routines in many clinical laboratories [50]. MALDI-TOF MS has also been used in medical entomology to identify several species of arthropods, such as ticks, mosquitoes, bed bugs, fleas, sandflies and others, using protein extracts from different body parts [28,31,33,51,52]. More recently, MALDI-TOF MS has also been used in malacology [53]. Once the device has been purchased for a technological platform, there is no additional cost for its use because this technique is inexpensive, simple and fast in comparison to conventional methods [26]. As previously mentioned, the robustness of MALDI-TOF MS for arthropod identification has been evaluated for several years using laboratory-reared and field-collected samples. MALDI-TOF MS profiling uses a highly standardized protein extraction method coupled with a spectrum acquisition approach to generate reference spectra that will be specific and reproducible enough to identify specimens of the same species [54]. MALDI-TOF MS has especially shown its reliability and usefulness in field studies by significantly decreasing the costs and time of identification but also allowing the detection of low-occurrence species [55]
Camels can be infested with different tick species of various genera [9,10,14,15]. In our study, the ticks belonged to the genus Hyalomma. The morphological identification of engorged females was only possible at the genus level because some morphological criteria were distorted and not visible, making their identification challenging. In our study, three species, namely, H. dromedarii, H. impeltatum and H. excavatum, were identified using molecular, morphological and proteomic tools. Similar observations have been reported by other researchers on these tick species infesting camels in Algeria, Tunisia and other parts of the world [10,18,56,57,58]. The camel tick H. dromedarii was the most frequent tick species found on camels. This species is known to have a host preference for dromedary camels but can also infest sheep, goats and horses, and it adapts well to extreme dryness and desert climates [34]. However, another study in Tunisia showed that H. impeltatum was the most abundant in Camelus dromedarius, followed by H. dromedarii, as described in [59].
In order to upgrade our database with MS spectra, as well as to randomly verify MS identifications, we used the 16S rRNA tick gene for the sequencing and definitive identification of ticks. We obtained a discrepancy between morphological and molecular/MALDI-TOF MS identifications for one tick specimen, with the MS identification in agreement with molecular identification. As previously stated, the taxonomy of the genus Hyalomma includes several species with important within-species morphological variability, which makes their morphological identification challenging, even for tick experts [60,61]. The morphological error may also be due to the invisible characters of this specimen. We therefore relied on molecular tools as well as MALDI-TOF MS to overcome morphological errors and ambiguous identification.
The MALDI-TOF MS results were shown to be in agreement with all molecular identifications. As for the ten specimens morphologically designated as Hyalomma spp., MALDI-TOF MS enabled the correct identification of those ticks at the species level. All ticks were identified by MALDI-TOF MS with high LSVs. This study highlights the ability of MALDI-TOF MS to overcome the limitations related to ticks’ taxonomical identification, such as the identification of damaged or engorged specimens and the lack of taxonomy keys, suitable documentation and entomological expertise [26,32]. Walker et al. (2003) reported that the accurate identification of H. dromedarii and H. impeltatum is confusing, especially those in the engorged state [34]. Here, the MS dendrogram and PCA results show that MALDI-TOF MS can discriminate between these two species, regardless of the engorged state.
Molecular tools, including polymerase chain reaction and sequencing, have enabled a major advance in the study of zoonotic pathogens and their reservoirs. In this work, we were able to detect C. burnetii in ticks. This intracellular Gram-negative bacterium is the causative zoonotic agent of Q fever. However, certain ruminants are considered the principal reservoirs for the transmission of C. burnetii to humans. Coxiella burnetii transmission to humans can be through aerosol inhalation or the ingestion of infected animal products, such as unpasteurized or insufficiently pasteurized milk products or derivatives [7]. Transmission can occur through birth products, including the placenta and amniotic liquid. These represent a major risk to veterinarians and livestock or dairy farmers [62]. This bacterium has been detected in more than 40 hard and at least 14 soft tick species, but they are considered to play only a secondary role in the transmission to humans [63]. In Algeria, C. burnetii has been detected in ticks (Rhipicephalus and Hyalomma) and in the blood of small ruminants [10,64] and camels [10], but only one human case was reported in 2012 in the northwest of the country [65]. Coxiella burnetii has also been found in camels and their ticks in several countries [7,66,67]. The long-term persistence of C. burnetii is possible in camels, and this may pose a threat to public health as well as breeding farms. However, the role of camels in the transmission of C. burnetii should be further evaluated [7]. In our survey, C. burnetii was amplified in H. impeltatum and H. dromedarii. However, a recent study on C. burnetii isolated it from H. impeltatum, H. dromedarii and H. excavatum in Algeria [10]. In Tunisia, C. burnetii was reported in H. impeltatum and H. dromedarii, and in Egypt, H. dromedarii was positive for C. burnetii [68,69].
In our study, we report the first detection in Algeria of an Anaplasma sp. in H. dromedarii, and the species is closely related to canine A. platys. A potential new Ehrlichia sp. was also detected in H. impeltatum. Bastos et al. [70] reported a novel species genetically close to A. platys in camels and named it “Candidatus Anaplasma camelii”. Other studies have recorded Ca. A. camelii in dromedary camels from Saudi Arabia [70], Tunisia, Morocco [20], Nigeria [18], Kenya [71] and Iran [72]. Recently, the occurrence of “Candidatus Anaplasma camelii”was reported in cattle and deer in Malaysia [73] and camel keds (Hippobosca camelina) [71]. The prevalent variations are likely to be the result of differences in the distribution of vectors in camel-sampling localities, reservoir hosts or tick control programs [56]. In Xinjiang, China, Li et al. (2015) reported the presence of canine A. platys in Camelus bactrianus (two-humped camels) and their ticks [74]. However, this strain was genetically divergent from the Anaplasma strain infecting dromedaries.
In order to characterize the obtained Anaplasmataceae species, we amplified fragments of three genes, one of which (groEL) is specific to Ehrlichia. The phylogenetic tree analysis based on the 16S rRNA gene revealed that the Anaplasma strain from H. dromedarii in our study clustered with “Candidatus Anaplasma camelii” from the dromedary camel of Kenya and A. platys from dog blood. To see whether the obtained sequences were identical to “Candidatus Anaplasma camelii”or A. platys and to differentiate the two Anaplasma strains, we targeted the 23S rRNA gene because of its ability to identify a large panel of Anaplasmataceae. As reported, this marker is ideal for discriminating between two closely related Anaplasma species and potentially detecting new species [37]. The phylogenetic analysis revealed that the obtained sequences formed an independent subcluster belonging to A. platys. In addition, the partial 23S rRNA sequence of “Candidatus Anaplasma camelii”does not exist in GenBank. Indeed, the 23S rRNA gene was able to separate Anaplasma sequences isolated from H. dromedarii and A. platys sequences. Consequently, we followed the proposition of Bastos et al. on the status of “Candidatus Anaplasma camelii”.
Furthermore, phylogenetic analysis based on 23S rRNA revealed that the sequence of Ehrlichia sp. detected in H. impeltatum formed an independent branch close to the subcluster of E. canis. The phylogenetical analysis based on groEL and a gene specific for Ehrlichia showed that the sequence of Ehrlichia formed an independent branch and was separate from other species of Ehrlichia. Previously, Bastos et al. confirmed the presence of a novel Ehrlichia species that is genetically close to E. canis, and another study revealed E. canis infections in camels in Saudi Arabia [16,70]. Just recently, a study reported the presence of an Ehrlichia sp. genetically related to E. canis, E. regneryi and E. ruminantium isolated from the blood of sick camels and ticks (Amblyomma spp. and Rhipicephalus spp.) in Kenya [75]. The occurrence of canine pathogens in camels may be due to the close association and cohabitation of camels and livestock in the desert area, which amplifies the chances of spreading vector-borne diseases [16,71]. This may also be due to the fact that some dog ticks and camel ticks have relatively low host specificity and/or are quite aggressive ticks. In addition, high temperatures make ticks particularly aggressive and further decrease host specificity. Nevertheless, further investigations are required to clarify the veterinary and medical importance of the novel species.

5. Conclusions

Our study showed that MALDI-TOF MS is a useful tool for the rapid identification of tick species stored in ethanol and that it could be used to overcome morphological limitations. We report the first detection of an Anaplasma sp. close to A. platys in H. dromedarii in Algeria and a new Ehrlichia sp. in H. impeltatum. Ehrlichia sp. and Anaplasma sp., genetically related to A. platys detected in camels, have not been characterized yet. However, further studies are necessary to clarify their potential zoonotic and veterinary risks. Additionally, we detected C. burnetii in camel ticks (H. dromedarii and H. impeltatum), as previously reported in Algerian camel ticks. In Algeria, camels and ticks could be a significant reservoir or source for the transmission of Q fever to animals and humans.

Author Contributions

Conceptualization: P.P., I.L., I.B., B.G., B.B. and F.Z.H.; data curation: F.Z.H., M.L. and A.Z.D.; formal analysis: F.Z.H. and M.L.; funding acquisition: P.P.; investigation: I.L., I.B., B.G., B.B. and B.D.; methodology: F.Z.H., M.L., A.Z.D. and P.P.; project administration: P.P.; resources: I.B. and P.P.; software: F.Z.H., A.Z.D., I.L. and M.L.; supervision: P.P. and M.L.; validation: P.P., M.L. and A.Z.D.; writing—original draft: F.Z.H.; writing—review and editing: F.Z.H., M.L., I.L., A.Z.D. and P.P. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Institut Hospitalo-Universitaire (IHU) Méditerranée Infection, the National Research Agency under the program “Investissements d’avenir”, reference ANR-10-IAHU-03, and the Région Provence Alpes Côte d’Azur and European funding FEDER PRIMI.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The camel tick MALDI-TOF database is publicly accessible and can be downloaded with the following DOI number: https://doi.org/10.35081/srfb-n029, access on 1 December 2021. Tick 16S rRNA sequences: H. dromedarii: OL672219, OL672220, OL672221, OL672222, OL672223 and OL672224; H. impeltatum: OL672225; H. excavatum: OL672226. Anaplasmataceae 16SrRNA sequences: Uncultured Anaplasma sp.: OL672236 and OL672237; Candidatus Midichloria mitochondrii: OL672238. Anaplasmataceae 23S rRNA sequences: Uncultured Anaplasma sp.: OL672216 and OL672217; uncultured Ehrlichia sp.: OL672218; groEL sequences: OL757650.

Acknowledgments

We thank all of the people who participated in the tick collection.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Parola, P.; Raoult, D. Ticks and Tickborne Bacterial Diseases in Humans: An Emerging Infectious Threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef] [PubMed]
  2. Barker, S.C.; Murrell, A. Systematics and evolution of ticks with a list of valid genus and species names. Parasitology 2004, 129, S15–S36. [Google Scholar] [CrossRef] [PubMed]
  3. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.-E.; et al. Update on Tick-Borne Rickettsioses around the World: A Geographic Approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [PubMed]
  4. De la Fuente, J.; Antunes, S.; Bonnet, S.; Cabezas-Cruz, A.; Domingos, A.G.; Estrada-Peña, A.; Johnson, N.; Kocan, K.M.; Mansfield, K.L.; Nijhof, A.M.; et al. Tick-Pathogen Interactions and Vector Competence: Identification of Molecular Drivers for Tick-Borne Diseases. Front. Cell. Infect. Microbiol. 2017, 7, 114. [Google Scholar] [CrossRef]
  5. Magnarelli, L.A. Global Importance of Ticks and Associated Infectious Disease Agents. Clin. Microbiol. Newsl. 2009, 31, 33–37. [Google Scholar] [CrossRef]
  6. Dantas-Torres, F.; Chomel, B.B.; Otranto, D. Ticks and tick-borne diseases: A One Health perspective. Trends Parasitol. 2012, 28, 437–446. [Google Scholar] [CrossRef] [PubMed]
  7. Devaux, C.A.; Osman, I.O.; Million, M.; Raoult, D. Coxiella burnetii in Dromedary Camels (Camelus dromedarius): A Possible Threat for Humans and Livestock in North Africa and the Near and Middle East? Front. Vet. Sci. 2020, 7, 558481. [Google Scholar]
  8. Zhu, S.; Zimmerman, D.; Deem, S.L. A Review of Zoonotic Pathogens of Dromedary Camels. EcoHealth 2019, 16, 356–377. [Google Scholar] [CrossRef]
  9. Bouhous, A.; Aissi, M.; Harhoura, K. Study of Ixodidae on camels in southwest Algeria, Adrar region. Ann. Méd Vét. 2008, 152, 52–58. [Google Scholar]
  10. Bellabidi, M.; Benaissa, M.H.; Bissati-Bouafia, S.; Harrat, Z.; Brahmi, K.; Kernif, T. Coxiella burnetii in camels (Camelus dromedarius) from Algeria: Seroprevalence, molecular characterization, and ticks (Acari: Ixodidae) vectors. Acta Trop. 2020, 206, 105443. [Google Scholar] [CrossRef]
  11. Faye, B. Role, distribution and perspective of camel breeding in the third millennium economies. Emir. J. Food Agric. 2015, 27, 318–327. [Google Scholar] [CrossRef]
  12. Faye, B. The camel today: Assets and potentials. Anthropozoologica 2014, 49, 167–176. [Google Scholar] [CrossRef]
  13. Megersa, B. An Epidemiological Study of Major Camel Diseases in the Borana Lowland, Southern Ethiopia. Oslo Drylands Coord Gr. 2010. Available online: https://d1wqtxts1xzle7.cloudfront.net/83305906/1042-dcg_report_no._58-with-cover-page-v2.pdf?Expires=1666803736&Signature=BLsYKqstq9LjjQM9UzIjoDmuoGRElJpH1MRGRvkh-eDxC0a2hxp-0PI--Gn~d9L3oPnAUcQOfG4ir3k3XZrcVPrn3MF9y6oF2CMEcR6ZdXLYhLDfRpx4nvccOVLTkMAWUdPgmqbazZYyj0-dA57MbPDrtZLqT-jcCt8q3KmKW5CbuEu0cSLDBNt2tlnh8-Ft0Dl4kHXSxBCV7FqBRPicmxa8wR2JaOtCepW99Sy-eKngDZyXqa3jdQooJHvl6H13rsWgH6Iz65t9dgLWbna7gz8PEGRy6MsfuZOKWdBexjarid95AcqgvDn1C1kXwwlRbp3KbuPFZoqNYpD7lURCJg__&Key-Pair-Id=APKAJLOHF5GGSLRBV4ZA (accessed on 10 April 2021).
  14. Fard, S.R.N.; Fathi, S.; Asl, E.N.; Nazhad, H.A.; Kazeroni, S.S. Hard ticks on one-humped camel (Camelus dromedarius) and their seasonal population dynamics in southeast, Iran. Trop. Anim. Health Prod. 2011, 44, 197–200. [Google Scholar] [CrossRef] [PubMed]
  15. Semere, K.; Nesibu, A.; Yisehak, T.; Birhanu, H. Hard Ticks of Camel in Southern Zone of Tigray, Northern Ethiopia. J. Parasitol. Vector Biol. Acad. J. 2014, 6, 151–155. [Google Scholar] [CrossRef]
  16. Alanazi, A.D.; Nguyen, V.L.; Alyousif, M.S.; Manoj, R.R.S.; Alouffi, A.S.; Donato, R.; Sazmand, A.; Mendoza-Roldan, J.A.; Dantas-Torres, F.; Otranto, D. Ticks and associated pathogens in camels (Camelus dromedarius) from Riyadh Province, Saudi Arabia. Parasites Vectors 2020, 13, 110. [Google Scholar] [CrossRef]
  17. Djerbouh, A.; Kernif, T.; Beneldjouzi, A.; Socolovschi, C.; Kechemir, N.; Parola, P. Ticks and Tick-borne Diseases The first molecular detection of Rickettsia aeschlimannii in the ticks of camels from southern Algeria. Ticks Tick Borne Dis. 2012, 3, 373–375. [Google Scholar] [CrossRef]
  18. Onyiche, T.E.; Răileanu, C.; Tauchmann, O.; Fischer, S.; Vasić, A.; Schäfer, M.; Biu, A.A.; Ogo, N.I.; Thekisoe, O.; Silaghi, C. Prevalence and molecular characterization of ticks and tick-borne pathogens of one-humped camels (Camelus dromedarius) in Nigeria. Parasites Vectors 2020, 13, 428. [Google Scholar] [CrossRef]
  19. Hamed, M.I.; Zaitoun, A.M.A.; El-Allawy, T.A.A.; Mourad, M.I. Investigation of Theileria camelensis in camels infested by Hyalomma dromedarii ticks in Upper Egypt. J. Adv. Vet. Res. 2011, 1, 4–7. [Google Scholar]
  20. Lbacha, H.A.; Zouagui, Z.; Alali, S.; Rhalem, A.; Petit, E.; Ducrotoy, M.J.; Boulouis, H.J.; Maillard, R. Candidatus anaplasma camelii in one- humped camels (Camelus dromedarius) in Morocco: A novel and emerging anaplasma species? Infect. Dis. Poverty 2017, 6, 1–8. [Google Scholar] [CrossRef]
  21. Bahrami, S.; Hamidinejat, H.; Tafreshi, A.R.G. First Molecular Detection of Anaplasma phagocytophilum in Dromedaries (Camelus Dromedarius). J. Zoo Wildl. Med. 2018, 49, 844–848. [Google Scholar] [CrossRef]
  22. Sudan, V.; Sharma, R.L.; Borah, M.K. Subclinical anaplasmosis in camel (Camelus dromedarius) and its successful therapeutic management. J. Parasit. Dis. 2012, 38, 163–165. [Google Scholar] [CrossRef]
  23. Ben Said, M.; Belkahia, H.; Sayahi, L.; Aloui, M.; Jemli, M.H.; Hadj Mohamed, B.; Sassi, L.; Darghouth, M.A.; Djaïem, A.A.; Bayoudh, M.; et al. Première étude sérologique de la prévalence d’Anaplasma phagocytophilum chez le dromadaire (Camelus dromedarius) en Tunisie. Bull. La Soc. Pathol. Exot. 2014, 107, 1–6. [Google Scholar] [CrossRef]
  24. Alsaad, K.M. Clinical, Hematological and Biochemical Studies of Anaplasmosis in Arabian One-Humped Camels (Camelus dromedaries). J. Anim. Vet. Adv. 2009, 8, 1794–1797. [Google Scholar]
  25. Kernif, T.; Djerbouh, A.; Mediannikov, O.; Ayach, B.; Rolain, J.M. Rickettsia africae in Hyalomma dromedarii ticks from sub-Saharan Algeria. Ticks Tick Borne Dis. 2012, 3, 376–378. [Google Scholar] [CrossRef] [PubMed]
  26. Laroche, M.; Bérenger, J.-M.; Delaunay, P.; Charrel, R.; Pradines, B.; Berger, F.; Ranque, S.; Bitam, I.; Davoust, B.; Raoult, D.; et al. Medical Entomology: A Reemerging Field of Research to Better Understand Vector-Borne Infectious Diseases. Clin. Infect. Dis. 2017, 65, S30–S38. [Google Scholar] [CrossRef]
  27. Diarra, A.Z.; Almeras, L.; Laroche, M.; Berenger, J.-M.; Koné, A.K.; Bocoum, Z.; Dabo, A.; Doumbo, O.; Raoult, D.; Parola, P. Molecular and MALDI-TOF identification of ticks and tick-associated bacteria in Mali. PLoS Negl. Trop. Dis. 2017, 11, e0005762. [Google Scholar] [CrossRef]
  28. Benkacimi, L.; Gazelle, G.; El Hamzaoui, B.; Bérenger, J.-M.; Parola, P.; Laroche, M. MALDI-TOF MS identification of Cimex lectularius and Cimex hemipterus bedbugs. Infect. Genet. Evol. 2020, 85, 104536. [Google Scholar] [CrossRef]
  29. Yssouf, A.; Almeras, L.; Raoult, D.; Parola, P. Emerging tools for identification of arthropod vectors. Future Microbiol. 2016, 11, 549–566. [Google Scholar] [CrossRef] [PubMed]
  30. Yssouf, A.; Almeras, L.; Berenger, J.-M.; Laroche, M.; Raoult, D.; Parola, P. Identification of tick species and disseminate pathogen using hemolymph by MALDI-TOF MS. Ticks Tick Borne Dis. 2015, 6, 579–586. [Google Scholar] [CrossRef] [PubMed]
  31. Hamlili, F.Z.; Bérenger, J.-M.; Diarra, A.Z.; Parola, P. Molecular and MALDI-TOF MS identification of swallow bugs Cimex hirundinis (Heteroptera: Cimicidae) and endosymbionts in France. Parasites Vectors 2021, 14, 587. [Google Scholar] [CrossRef] [PubMed]
  32. Kumsa, B.; Laroche, M.; Almeras, L.; Mediannikov, O.; Raoult, D.; Parola, P. Morphological, molecular and MALDI-TOF mass spectrometry identification of ixodid tick species collected in Oromia, Ethiopia. Parasitol. Res. 2016, 115, 4199–4210. [Google Scholar] [CrossRef] [PubMed]
  33. Boucheikhchoukh, M.; Laroche, M.; Aouadi, A.; Dib, L.; Benakhla, A.; Raoult, D.; Parola, P. MALDI-TOF MS identification of ticks of domestic and wild animals in Algeria and molecular detection of associated microorganisms. Comp. Immunol. Microbiol. Infect. Dis. 2018, 57, 39–49. [Google Scholar] [CrossRef] [PubMed]
  34. Walker, A.R. Ticks of Domestic Animals in Africa: A Guide to Identification of Species; Bioscience Reports: Edinburgh, UK, 2003. [Google Scholar]
  35. Estrada-Peña, A.; Mihalca, A.D.; Petney, T. Ticks of Europe and North Africa: A Guide to Species Identification; Springer: Cham, Switzerland, 2018. [Google Scholar]
  36. Lv, J.; Wu, S.; Zhang, Y.; Zhang, T.; Feng, C.; Jia, G.; Lin, X. Development of a DNA barcoding system for the Ixodida (Acari: Ixodida). Mitochondrial DNA 2013, 25, 142–149. [Google Scholar] [CrossRef]
  37. Dahmani, M.; Davoust, B.; Benterki, M.S.; Fenollar, F.; Raoult, D.; Mediannikov, O. Development of a new PCR-based assay to detect Anaplasmataceae and the first report of Anaplasma phagocytophilum and Anaplasma platys in cattle from Algeria. Comp. Immunol. Microbiol. Infect. Dis. 2015, 39, 39–45. [Google Scholar] [CrossRef]
  38. Mediannikov, O.; Fenollar, F.; Socolovschi, C.; Diatta, G.; Bassene, H.; Molez, J.-F.; Sokhna, C.; Trape, J.-F.; Raoult, D. Coxiella burnetii in Humans and Ticks in Rural Senegal. PLoS Negl. Trop. Dis. 2010, 4, e654. [Google Scholar] [CrossRef]
  39. Rolain, J.M.; Raoult, D.; Marmion, B.P.; Harris, R.J.; Storm, P.; Ayres, J.G. Molecular detection of Coxiella burnetii in blood and sera during Q fever (multiple letters). QJM Mon. J. Assoc. Physicians 2005, 98, 615–620. [Google Scholar] [CrossRef]
  40. Rolain, J.-M.; Stuhl, L.; Maurin, M.; Raoult, D. Evaluation of Antibiotic Susceptibilities of Three Rickettsial Species Including Rickettsia felis by a Quantitative PCR DNA Assay. Antimicrob. Agents Chemother. 2002, 46, 2747–2751. [Google Scholar] [CrossRef]
  41. Rolain, J.M.; Franc, M.; Davoust, B.; Raoult, D. Molecular detection of Bartonella quintana, B. koehlerae, B. henselae, B. clarridgeiae, Rickettsia felis, and Wolbachia pipientis in cat fleas, France. Emerg. Infect. Dis. 2003, 9, 338–342. [Google Scholar] [CrossRef]
  42. Dahmana, H.; Amanzougaghene, N.; Davoust, B.; Normand, T.; Carette, O.; Demoncheaux, J.-P.; Mulot, B.; Fabrizy, B.; Scandola, P.; Chik, M.; et al. Great diversity of Piroplasmida in Equidae in Africa and Europe, including potential new species. Veter. Parasitol. Reg. Stud. Rep. 2019, 18, 100332. [Google Scholar] [CrossRef]
  43. Parola, P.; Paddock, C.D.; Raoult, D. Tick-Borne Rickettsioses around the World: Emerging Diseases Challenging Old Concepts. Clin. Microbiol. Rev. 2005, 18, 719–756. [Google Scholar] [CrossRef]
  44. Parola, P.; Roux, V.; Camicas, J.-L.; Baradji, I.; Brouqui, P.; Raoult, D.; Rabarijaona, L.; Rakotomanana, F.; Ranaivo, L.; Raharimalala, L.; et al. Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans. R. Soc. Trop. Med. Hyg. 2000, 94, 707–708. [Google Scholar] [CrossRef]
  45. Dahmani, M.; Davoust, B.; Rousseau, F.; Raoult, D.; Fenollar, F.; Mediannikov, O. Natural Anaplasmataceae infection in Rhipicephalus bursa ticks collected from sheep in the French Basque Country. Ticks Tick Borne Dis. 2017, 8, 18–24. [Google Scholar] [CrossRef] [PubMed]
  46. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  47. Yssouf, A.; Socolovschi, C.; Flaudrops, C.; Ndiath, M.O.; Sougoufara, S.; Dehecq, J.-S.; Lacour, G.; Berenger, J.-M.; Sokhna, C.S.; Raoult, D.; et al. Matrix-Assisted Laser Desorption Ionization—Time of Flight Mass Spectrometry: An Emerging Tool for the Rapid Identification of Mosquito Vectors. PLoS ONE 2013, 8, e72380. [Google Scholar] [CrossRef]
  48. Seng, P.; Rolain, J.-M.; Fournier, P.E.; La Scola, B.; Drancourt, M.; Raoult, D. MALDI-TOF-mass spectrometry applications in clinical microbiology. Future Microbiol. 2010, 5, 1733–1754. [Google Scholar] [CrossRef]
  49. Welham, K.J.; Domin, M.A.; Johnson, K.; Jones, L.; Ashton, D.S. Characterization of fungal spores by laser desorption/ionization time-of-flight mass spectrometry. Rapid Commun. Mass Spectrom. 2000, 14, 307–310. [Google Scholar] [CrossRef]
  50. Fuh, M.M.; Heikaus, L.; Schlüter, H. MALDI mass spectrometry in medical research and diagnostic routine laboratories. Int. J. Mass Spectrom. 2017, 416, 96–109. [Google Scholar] [CrossRef]
  51. Lafri, I.; Almeras, L.; Bitam, I.; Caputo, A.; Yssouf, A.; Forestier, C.-L.; Izri, A.; Raoult, D.; Parola, P. Identification of Algerian Field-Caught Phlebotomine Sand Fly Vectors by MALDI-TOF MS. PLoS Negl. Trop. Dis. 2016, 10, e0004351. [Google Scholar] [CrossRef]
  52. Yssouf, A.; Socolovschi, C.; Leulmi, H.; Kernif, T.; Bitam, I.; Audoly, G.; Almeras, L.; Raoult, D.; Parola, P. Identification of flea species using MALDI-TOF/MS. Comp. Immunol. Microbiol. Infect. Dis. 2014, 37, 153–157. [Google Scholar] [CrossRef]
  53. Hamlili, F.Z.; Thiam, F.; Laroche, M.; Diarra, A.Z.; Doucouré, S.; Gaye, P.M.; Fall, C.B.; Faye, B.; Sokhna, C.; Sow, D.; et al. MALDI-TOF mass spectrometry for the identification of freshwater snails from Senegal, including intermediate hosts of schistosomes. PLoS Negl. Trop. Dis. 2021, 15, e0009725. [Google Scholar] [CrossRef]
  54. Sevestre, J.; Diarra, A.Z.; Laroche, M.; Almeras, L.; Parola, P. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry: An emerging tool for studying the vectors of human infectious diseases. Future Microbiol. 2021, 16, 323–340. [Google Scholar] [CrossRef] [PubMed]
  55. Diarra, A.Z.; Laroche, M.; Berger, F.; Parola, P. Use of MALDI-TOF MS for the Identification of Chad Mosquitoes and the Origin of Their Blood Meal. Am. J. Trop. Med. Hyg. 2019, 100, 47–53. [Google Scholar] [CrossRef] [PubMed]
  56. Belkahia, H.; Ben Said, M.; Sayahi, L.; Alberti, A.; Messadi, L. Detection of novel strains genetically related to Anaplasma platys in Tunisian one-humped camels (Camelus dromedarius). J. Infect. Dev. Ctries. 2015, 9, 1117–1125. [Google Scholar] [CrossRef] [PubMed]
  57. Khelifi-Ouchene, N.A.; Ouchene, N.; Dahmani, A.; Kaaboub, E.A.; Ouchetati, I.; Haif, A. Investigation of internal and external parasites of the camels (Camelus dromedarius) in Algeria. Ann. Parasitol. 2020, 66, 331–337. [Google Scholar]
  58. Moshaverinia, A.; Moghaddas, E. Prevalence of tick infestation in dromedary camels (Camelus dromedarius) brought for slaughter in Mashhad abattoir, Iran. J. Parasit. Dis. 2013, 39, 452–455. [Google Scholar] [CrossRef]
  59. Gharbi, M.; Moussi, N.; Jedidi, M.; Mhadhbi, M.; Sassi, L.; Darghouth, M.A. Population dynamics of ticks infesting the one-humped camel (Camelus dromedarius) in central Tunisia. Ticks Tick Borne Dis. 2013, 4, 488–491. [Google Scholar] [CrossRef]
  60. Bakheit, M.A.; Latif, A.A.; Vatansever, Z.; Seitzer, U.; Ahmed, J. The Huge Risks Due to Hyalomma Ticks. In Arthropods as Vectors of Emerging Diseases; Springer: Berlin/Heidelberg, Germany, 2012; pp. 167–194. [Google Scholar] [CrossRef]
  61. Hosseini-Chegeni, A.; Hosseini, R.; Tavakoli, M.; Telmadarraiy, Z.; Abdigoudarzi, M. The Iranian Hyalomma (Acari: Ixodidae) with a key to the identification of male species. Persian J. Acarol. 2013, 2, 503–529. [Google Scholar] [CrossRef]
  62. CDC. Q Fever. Transmission. Available online: https://www.cdc.gov/qfever/transmission/index.html (accessed on 10 April 2021).
  63. Eldin, C.; Mélenotte, C.; Mediannikov, O.; Ghigo, E.; Million, M.; Edouard, S.; Mege, J.-L.; Maurin, M.; Raoult, D. From Q Fever to Coxiella burnetii Infection: A Paradigm Change. Clin. Microbiol. Rev. 2017, 30, 115–190. [Google Scholar] [CrossRef]
  64. Aouadi, A.; Leulmi, H.; Boucheikhchoukh, M.; Benakhla, A.; Raoult, D.; Parola, P. Molecular evidence of tick-borne hemoprotozoan-parasites (Theileria ovis and Babesia ovis) and bacteria in ticks and blood from small ruminants in Northern Algeria. Comp. Immunol. Microbiol. Infect. Dis. 2017, 50, 34–39. [Google Scholar] [CrossRef]
  65. Angelakis, E.; Mediannikov, O.; Socolovschi, C.; Mouffok, N.; Bassene, H.; Tall, A.; Niangaly, H.; Doumbo, O.; Znazen, A.; Sarih, M.; et al. Coxiella burnetii-positive PCR in febrile patients in rural and urban Africa. Int. J. Infect. Dis. 2014, 28, 107–110. [Google Scholar] [CrossRef]
  66. Mohammed, O.B.; Jarelnabi, A.A.; Aljumaah, R.S.; Alshaikh, M.A.; Bakhiet, A.O.; Omer, S.A.; Alagaili, A.N.; Hussein, M.F. Coxiella burnetii, the causative agent of Q fever in Saudi Arabia: Molecular detection from camel and other domestic livestock. Asian Pac. J. Trop. Med. 2014, 7, 715–719. [Google Scholar] [CrossRef]
  67. Duron, O.; Noël, V.; McCoy, K.D.; Bonazzi, M.; Sidi-Boumedine, K.; Morel, O.; Vavre, F.; Zenner, L.; Jourdain, E.; Durand, P.; et al. The Recent Evolution of a Maternally-Inherited Endosymbiont of Ticks Led to the Emergence of the Q Fever Pathogen, Coxiella burnetii. PLoS Pathog. 2015, 11, e1004892. [Google Scholar] [CrossRef] [PubMed]
  68. Selmi, R.; Ben Said, M.; Mamlouk, A.; Ben Yahia, H.; Messadi, L. Molecular detection and genetic characterization of the potentially pathogenic Coxiella burnetii and the endosymbiotic Candidatus Midichloria mitochondrii in ticks infesting camels (Camelus dromedarius) from Tunisia. Microb. Pathog. 2019, 136, 103655. [Google Scholar] [CrossRef] [PubMed]
  69. Abdullah, H.H.A.M.; El-Shanawany, E.E.; Abdel-Shafy, S.; Abou-Zeina, H.A.A.; Abdel-Rahman, E.H. Molecular and immunological characterization of Hyalomma dromedarii and Hyalomma excavatum (Acari: Ixodidae) vectors of Q fever in camels. Veter. World 2018, 11, 1109–1119. [Google Scholar] [CrossRef]
  70. Bastos, A.D.; Mohammed, O.B.; Bennett, N.C.; Petevinos, C.; Alagaili, A.N. Molecular detection of novel Anaplasmataceae closely related to Anaplasma platys and Ehrlichia canis in the dromedary camel (Camelus dromedarius). Veter. Microbiol. 2015, 179, 310–314. [Google Scholar] [CrossRef]
  71. Bargul, J.L.; Kidambasi, K.O.; Getahun, M.N.; Villinger, J.; Copeland, R.S.; Muema, J.M.; Carrington, M.; Masiga, D.K. Transmission of ‘Candidatus Anaplasma camelii’ to laboratory animals by camel-specific keds, Hippobosca camelina. bioRxiv 2021. [Google Scholar] [CrossRef]
  72. Sharifiyazdi, H.; Jafari, S.; Ghane, M.; Nazifi, S.; Sanati, A. Molecular investigation of Anaplasma and Ehrlichia natural infections in the dromedary camel (Camelus dromedarius) in Iran. Comp. Clin. Pathol. 2016, 26, 99–103. [Google Scholar] [CrossRef]
  73. Koh, F.X.; Panchadcharam, C.; Sitam, F.T.; Tay, S.T. Molecular investigation of Anaplasma spp. in domestic and wildlife animals in Peninsular Malaysia. Veter. Parasitol. Reg. Stud. Rep. 2018, 13, 141–147. [Google Scholar] [CrossRef]
  74. Li, Y.; Yang, J.; Chen, Z.; Qin, G.; Li, Y.; Li, Q.; Liu, J.; Liu, Z.; Guan, G.; Yin, H.; et al. Anaplasma infection of Bactrian camels (Camelus bactrianus) and ticks in Xinjiang, China. Parasites Vectors 2015, 8, 313. [Google Scholar] [CrossRef]
  75. Younan, M.; Ouso, D.O.; Bodha, B.; Keitany, E.K.; Wesonga, H.O.; Sitawa, R.; Kimutai, J.; Kuria, W.; Sake, W.S.; Svitek, N.; et al. Ehrlichia spp. close to Ehrlichia ruminantium, Ehrlichia canis, and “Candidatus Ehrlichia regneryi” linked to heartwater-like disease in Kenyan camels (Camelus dromedarius). Trop. Anim. Health Prod. 2021, 53, 147. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.