First Molecular Detection of Babesia gibsoni in Stray Dogs from Thailand
Abstract
1. Introduction
2. Results
2.1. Occurrence of Single and Co-Infections
2.2. Sequence Analysis
2.3. Phylogenetic Analysis of B. gibsoni Using the ITS1 Region and 18S rRNA Sequences
3. Discussion
4. Materials and Methods
4.1. Ethical Consent
4.2. Study Area and Sample Collection
4.3. DNA Extraction and Molecular Detection
4.4. Sequence and Phylogenetic Analysis
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cardoso, L.; Oliveira, A.C.; Granada, S.; Nachum-Biala, Y.; Gilad, M.; Lopes, A.P.; Sousa, S.R.; Vilhena, H.; Baneth, G. Molecular investigation of tick-borne pathogens in dogs from Luanda, Angola. Parasit. Vectors 2016, 9, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Foglia, M.V.; Cappiello, S.; Oliva, G. Tick-transmitted diseases in dogs: Clinicopathological findings. Parassitologia 2006, 48, 135. [Google Scholar]
- Inpankaew, T.; Hii, S.F.; Chimnoi, W.; Traub, R.J. Canine vector-borne pathogens in semi-domesticated dogs residing in northern Cambodia. Parasit. Vectors 2016, 9, 253. [Google Scholar] [CrossRef] [PubMed]
- Kaewmongkol, G.; Lukkana, N.; Yangtara, S.; Kaewmongkol, S.; Thengchaisri, N.; Sirinarumitr, T.; Jittapalapong, S.; Fenwick, S.G. Association of Ehrlichia canis, Hemotropic Mycoplasma spp. and Anaplasma platys and severe anemia in dogs in Thailand. Vet. Microbiol. 2017, 201, 195–200. [Google Scholar] [CrossRef] [PubMed]
- Ogbu, K.I.; Olaolu, O.S.; Ochai, S.O.; Tion, M.T. A review of some tick-borne pathogens of dogs. J. Anim. Sci. Vet. Med. 2018, 3, 140–153. [Google Scholar] [CrossRef]
- Galay, R.L.; Manalo, A.A.L.; Dolores, S.L.D.; Aguilar, I.P.M.; Sandalo, K.A.C.; Cruz, K.B.; Divina, B.P.; Andoh, M.; Masatani, T.; Tanaka, T. Molecular detection of tick-borne pathogens in canine population and Rhipicephalus sanguineus (sensu lato) ticks from southern Metro Manila and Laguna, Philippines. Parasit. Vectors 2018, 11, 643. [Google Scholar] [CrossRef]
- Little, S.E. Ehrlichiosis and anaplasmosis in dogs and cats. Vet. Clin. Small Anim. Pract. 2010, 40, 1121–1140. [Google Scholar] [CrossRef]
- Huggins, L.G.; Koehler, A.V.; Ng-Nguyen, D.; Wilcox, S.; Schunack, B.; Inpankaew, T.; Traub, R.J. Assessment of a metabarcoding approach for the characterisation of vector-borne bacteria in canines from Bangkok, Thailand. Parasit. Vectors 2019, 12, 394. [Google Scholar] [CrossRef]
- Matijatko, V.; Torti, M.; Schetters, T.P. Canine babesiosis in Europe: How many diseases? Trends Parasitol. 2012, 28, 99–105. [Google Scholar] [CrossRef] [PubMed]
- Baneth, G.A.D.; Samish, M.; Alekseev, E.; Aroch, I.; Shkap, V. Transmission of Hepatozoon canis to dogs by naturally-fed or percutaneously-injected Rhipicephalus sanguineus ticks. J. Parasitol. 2001, 87, 606–611. [Google Scholar] [CrossRef]
- Mandal, M.; Banerjee, P.S.; Kumar, S.; Garg, R.; Ram, H.; Raina, O.K. Development of recombinant BgP12 based enzyme linked immunosorbent assays for serodiagnosis of Babesia gibsoni infection in dogs. Vet. Immunol. Immunopathol. 2016, 169, 27–33. [Google Scholar] [CrossRef] [PubMed]
- Conrad, P.; Thomford, J.; Yamane, I.; Whiting, J.; Bosma, L.; Uno, T.; Holshuh, H.J.; Shelly, S. Hemolytic anemia caused by Babesia gibsoni infection in dogs. J. Am. Vet. Med. Assoc. 1991, 199, 601–605. [Google Scholar] [PubMed]
- Kjemtrup, A.M.; Kocan, A.A.; Whitworth, L.; Meinkoth, J.; Birkenheuer, A.J.; Cummings, J.; Boudreaux, M.K.; Stockham, S.L.; Irizarry-Rovira, A.; Conrad, P.A. There are at least three genetically distinct small piroplasms from dogs. Int. J. Parasitol. 2000, 30, 1501–1505. [Google Scholar] [CrossRef]
- Zahler, M.; Rinder, H.; Zweygarth, E.; Fukata, T.; Maede, Y.; Schein, E.; Gothe, R. Babesia gibsoni of dogs from North America and Asia belong to different species. Parasitology 2002, 120, 365–369. [Google Scholar]
- García, A.T.C. Piroplasma infection in dogs in northern Spain. Vet. Parasitol. 2006, 138, 97–102. [Google Scholar] [CrossRef]
- Kjemtrup, A.M.; Conrad, P.A. A review of the small canine piroplasms from California: Babesia conradae in the literature. Vet. Parasitol. 2006, 138, 112–117. [Google Scholar] [CrossRef] [PubMed]
- Zahler, M.; Schein, E.; Rinder, H.; Gothe, R. Characteristic genotypes discriminate between Babesia canis isolates of differing vector specificity and pathogenicity to dogs. Parasitol. Res. 1998, 84, 544–548. [Google Scholar] [CrossRef]
- Bostrom, B.; Wolf, C.; Greene, C.; Peterson, D.S. Sequence conservation in the rRNA first internal transcribed spacer region of Babesia gibsoni genotype Asia isolates. Vet. Parasitol. 2008, 152, 152–157. [Google Scholar] [CrossRef]
- Toukhsati, S.R.; Phillips, C.J.C.; Podberscek, A.L.; Coleman, G.J. Semi-ownership and sterilisation of cats and dogs in Thailand. Animals 2012, 2, 611–627. [Google Scholar] [CrossRef]
- Abd Rani, P.A.M.; Irwin, P.J.; Coleman, G.T.; Gatne, M.; Traub, R.J. A survey of canine tick-borne diseases in India. Parasit. Vectors 2011, 4, 141. [Google Scholar] [CrossRef] [PubMed]
- Buddhachat, K.; Meerod, T.; Pradit, W.; Siengdee, P.; Chomdej, S.; Nganvongpanit, K. Simultaneous differential detection of canine blood parasites: Multiplex high-resolution melting analysis (mHRM). Ticks Tick. Borne. Dis. 2020, 11, 101370. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Ruttayaporn, N.; Saechan, V.; Jirapattharasate, C.; Vudriko, P.; Moumouni, P.F.A.; Cao, S.; Inpankaew, T.; Ybañez, A.P.; Suzuki, H.; et al. Molecular survey of canine vector-borne diseases in stray dogs in Thailand. Parasitol. Int. 2016, 65, 357–361. [Google Scholar] [CrossRef] [PubMed]
- Prakash, B.K.; Low, V.L.; Vinnie-Siow, W.Y.; Tan, T.K.; Lim, Y.A.-L.; Morvarid, A.R.; AbuBakar, S.; Sofian-Azirun, M. Detection of Babesia spp. in dogs and their ticks from Peninsular Malaysia: Emphasis on Babesia gibsoni and Babesia vogeli infections in Rhipicephalus sanguineus sensu lato (Acari: Ixodidae). J. Med. Entomol. 2018, 55, 1337–1340. [Google Scholar] [CrossRef] [PubMed]
- Cruz-Flores, M.J.; Garcia Claveria, F.; Verdida, R.; Xuan, X.; Igarashi, I. First detection of Babesia gibsoni infection in Philippine stray dogs by immunochromatographic test (ICT). Vet. Arh. 2008, 78, 149–157. [Google Scholar]
- Zheng, W.; Liu, M.; Moumouni, P.F.A.; Liu, X.; Efstratiou, A.; Liu, Z.; Liu, Y.; Tao, H.; Guo, H.; Wang, G. First molecular detection of tick-borne pathogens in dogs from Jiangxi, China. J. Vet. Med. Sci. 2017, 79, 248–254. [Google Scholar] [CrossRef]
- Miyama, T.; Sakata, Y.; Shimada, Y.; Ogino, S.; Watanabe, M.; Itamoto, K.; Okuda, M.; Verdida, R.A.; Xuan, X.; Nagasawa, H. Epidemiological survey of Babesia gibsoni infection in dogs in eastern Japan. J. Vet. Med. Sci. 2005, 67, 467–471. [Google Scholar] [CrossRef]
- Rucksaken, R.; Maneeruttanarungroj, C.; Maswanna, T.; Sussadee, M.; Kanbutra, P. Comparison of conventional polymerase chain reaction and routine blood smear for the detection of Babesia canis, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys in Buriram Province, Thailand. Vet. World 2019, 12, 700. [Google Scholar] [CrossRef]
- Piratae, S.; Pimpjong, K.; Vaisusuk, K.; Chatan, W. Molecular detection of Ehrlichia canis, Hepatozoon canis and Babesia canis vogeli in stray dogs in Mahasarakham province, Thailand. Ann. Parasitol. 2015, 61. [Google Scholar] [CrossRef]
- Colella, V.; Nguyen, V.L.; Tan, D.Y.; Lu, N.; Fang, F.; Zhijuan, Y.; Wang, J.; Liu, X.; Chen, X.; Dong, J. Zoonotic vectorborne pathogens and ectoparasites of dogs and cats in Eastern and Southeast Asia. Emerg. Infect. Dis. 2020, 26, 1221. [Google Scholar] [CrossRef]
- Gray, J.S.; Estrada-Peña, A.; Zintl, A. Vectors of babesiosis. Annu. Rev. Entomol. 2019, 64, 149–165. [Google Scholar]
- Do, T.; Phoosangwalthong, P.; Kamyingkird, K.; Kengradomkij, C.; Chimnoi, W.; Inpankaew, T. Molecular Detection of Tick-Borne Pathogens in Stray Dogs and Rhipicephalus sanguineus sensu lato Ticks from Bangkok, Thailand. Pathogens 2021, 10, 561. [Google Scholar]
- Rajamanickam, C.; Wiesenhutter, E.; Zin, F.M.; Hamid, J. The incidence of canine haematozoa in Peninsular Malaysia. Vet. Parasitol. 1985, 17, 151–157. [Google Scholar] [CrossRef]
- Mokhtar, A.S.; Lim, S.F.; Tay, S.T. Research Note Molecular detection of Anaplasma platys and Babesia gibsoni in dogs in Malaysia. Trop Biomed 2013, 30, 345–348. [Google Scholar] [PubMed]
- Kordick, S.K.; Breitschwerdt, E.B.; Hegarty, B.C.; Southwick, K.L.; Colitz, C.M.; Hancock, S.I.; Bradley, J.M.; Rumbough, R.; Mcpherson, J.T.; MacCormack, J.N. Coinfection with multiple tick-borne pathogens in a Walker Hound kennel in North Carolina. J. Clin. Microbiol. 1999, 37, 2631–2638. [Google Scholar] [CrossRef]
- Mandal, M.; Banerjee, P.S.; Garg, R.; Ram, H.; Kundu, K.; Kumar, S.; Ravi Kumar, G.V.P.P.S. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India. Infect. Genet. Evol. 2014, 27, 325–331. [Google Scholar] [CrossRef]
- Inokuma, H.; Brouqui, P.; Drancourt, M.; Raoult, D. Citrate Synthase Gene Sequence: A New Tool for Phylogenetic Analysis and Identification ofEhrlichia. J. Clin. Microbiol. 2001, 39, 3031–3039. [Google Scholar] [CrossRef] [PubMed]
- Inokuma, H.; Okuda, M.; Ohno, K.; Shimoda, K.; Onishi, T. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet. Parasitol. 2002, 106, 265–271. [Google Scholar] [CrossRef]
- Inokuma, H.; Fujii, K.; Okuda, M.; Onishi, T.; Beaufils, J.-P.; Raoult, D.; Brouqui, P. Determination of the nucleotide sequences of heat shock operon groESL and the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin. Diagn. Lab. Immunol. 2002, 9, 1132–1136. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Pinheiro, J.; Bates, D.; DebRoy, S.; Sarkar, D.; Team, R.C. nlme: Linear and nonlinear mixed effects models. R Packag. Version 2013, 3, 111. [Google Scholar]



| Pathogen | No. Positive (N = 174) | Detection Rate (95% CI) |
|---|---|---|
| Single infection | ||
| Anaplasma platys | 10 | 5.7 (2.26–9.15) |
| Ehrlichia canis | 1 | 0.6 (0–1.75) |
| Hepatozoon canis | 23 | 13.2 (8.17–18.23) |
| Babesia gibsoni | 11 | 6.3 (2.69–9.91) |
| Babesia vogeli | 9 | 5.2 (1.9–8.49) |
| Mixed infection | ||
| Anaplasma platys + Hepatozoon canis | 14 | 8.0 (3.96–12.03) |
| Anaplasma platys + Babesia vogeli | 1 | 0.6 (0–1.75) |
| Ehrlichia canis + Hepatozoon canis | 1 | 0.6 (0–1.75) |
| Hepatozoon canis + Babesia vogeli | 4 | 2.3 (0–4.53) |
| Anaplasma platys + Ehrlichia canis+ Hepatozoon canis | 1 | 0.6 (0–1.75) |
| Total positive | 75 | 43.1 (35.74–50.46) |
| Negative samples | 99 | 56.9 (49.64–64.26) |
| No. | Species | Gene | Length (Base-Pair) | Accession no. (Submitted) | Accession no. (Reference) | Query Cover (%) | Percent Identity (%) |
|---|---|---|---|---|---|---|---|
| 1 | A. platys | groEL | 694 | MW404321–MW404324 | KU765205; KY425417 | 100 | 100 |
| 2 | E. canis | gltA | 1249 | MW404325–MW 404327 | KU765198; CP025749 | 100 | 100 |
| 3 | H. canis | 18S rRNA | 666 | MW402988–MW402992 | KU765202; MK091085 | 100 | 100 |
| 4 | B. vogeli | 18S rRNA | 208 | MW403069–MW403073 | MT386936; MT012237 | 100 | 100 |
| 5 | B. gibsoni | 18S rRNA | 208 | MW403495–MW403499 | MN134517; MG604547 | 100 | 100 |
| 6 | B. gibsoni | ITS1 | 254 | MW403987–MW403991 | MN928851; KP666153 | 100 | 100 |
| Pathogen (Target Gene) | Oligonucleotide Sequences (5′→3′) | Product Size (bp) | Annealing Temp (°C) | Reference |
|---|---|---|---|---|
| Babesia spp. (18S rRNA) | F: GCATTTAGCGATGGACCATTCAAG R: CCTGTATTGTTATTTCTTGTCACTACCTC | 208 | 60 | [34] |
| Babesia gibsoni (ITS1) | F: ACATTGAAACTTGTCGAGCTGCG R: AGATCCCGCACCCAGCCAC | 254 | 60 | [35] |
| Ehrlichia canis (gltA) | F: TTATCTGTTTATGTTATATAAGC R: CAGTACCTATGCATATCAATCC | 1372 | 53 | [36] |
| Hepatozoon spp. (18S rRNA) | F: ATACATGAGCAAAATCTCAAC R: CTTATTATTCCATGCTGCAG | 666 | 57 | [37] |
| Anaplasma platys (groEL) | F: AAGGCGAAAGAAGCAGTCTTA R: CATAGTCTGAAGTGGAGGAC | 724 | 58 | [38] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Do, T.; Ngasaman, R.; Saechan, V.; Pitaksakulrat, O.; Liu, M.; Xuan, X.; Inpankaew, T. First Molecular Detection of Babesia gibsoni in Stray Dogs from Thailand. Pathogens 2021, 10, 639. https://doi.org/10.3390/pathogens10060639
Do T, Ngasaman R, Saechan V, Pitaksakulrat O, Liu M, Xuan X, Inpankaew T. First Molecular Detection of Babesia gibsoni in Stray Dogs from Thailand. Pathogens. 2021; 10(6):639. https://doi.org/10.3390/pathogens10060639
Chicago/Turabian StyleDo, Thom, Ruttayaporn Ngasaman, Vannarat Saechan, Opal Pitaksakulrat, Mingming Liu, Xuenan Xuan, and Tawin Inpankaew. 2021. "First Molecular Detection of Babesia gibsoni in Stray Dogs from Thailand" Pathogens 10, no. 6: 639. https://doi.org/10.3390/pathogens10060639
APA StyleDo, T., Ngasaman, R., Saechan, V., Pitaksakulrat, O., Liu, M., Xuan, X., & Inpankaew, T. (2021). First Molecular Detection of Babesia gibsoni in Stray Dogs from Thailand. Pathogens, 10(6), 639. https://doi.org/10.3390/pathogens10060639

