An HFman Probe-Based Multiplex Reverse Transcription Loop-Mediated Isothermal Amplification Assay for Simultaneous Detection of Hantaan and Seoul Viruses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of RNA Standard
2.2. Primer Design
2.3. Clinical Samples and RNA Extraction
2.4. Single-Tube Multiplex RT-LAMP Reaction
2.5. RT-qPCR Assay
2.6. Sensitivity and Specificity Test
2.7. Limit of Detection (LOD)
2.8. Colorimetric Assay
3. Results
3.1. Screening of Optimal RT-LAMP Primers
3.2. Sensitivity and Specificity of the Multiplex RT-LAMP Assay
3.3. LOD of the Multiplex RT-LAMP Assay
3.4. Clinical Evaluation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Schmaljohn, C.S.; Dalrymple, J.M. Analysis of hantaan virus RNA: Evidence for a new genus of bunyaviridae. Virology 1983, 131, 482–491. [Google Scholar] [CrossRef]
- Nichol, S.T.; Arikawa, J.; Kawaoka, Y. Emerging viral diseases. Proc. Natl. Acad. Sci. USA 2000, 97, 12411–12412. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schönrich, G.; Rang, A.; Lütteke, N.; Raftery, M.J.; Charbonnel, N.; Ulrich, R.G. Hantavirus-induced immunity in rodent reservoirs and humans. Immunol. Rev. 2008, 225, 163–189. [Google Scholar] [CrossRef] [PubMed]
- Emuyangwa, M.; Martynova, E.V.; Khaiboullina, S.F.; Morzunov, S.P.; Rizvanov, A.A. Hantaviral Proteins: Structure, Functions, and Role in Hantavirus Infection. Front. Microbiol. 2015, 6, 1326. [Google Scholar] [CrossRef]
- Avšič-Županc, T.; Saksida, A.; Korva, M. Hantavirus infections. Clin. Microbiol. Infect. 2019, 21, e6–e16. [Google Scholar] [CrossRef] [Green Version]
- Heyman, P.; Vaheri, A.; Lundkvist, A.; Avsic-Zupanc, T. Hantavirus infections in Europe: From virus carriers to a major public-health problem. Expert Rev. Anti-Infect. Ther. 2009, 7, 205–217. [Google Scholar] [CrossRef]
- Simpson, S.Q.; Spikes, L.; Patel, S.; Faruqi, I. Hantavirus Pulmonary Syndrome. Infect. Dis. Clin. N. Am. 2010, 24, 159–173. [Google Scholar] [CrossRef]
- Schmaljohn, C.; Hjelle, B. Hantaviruses: A Global Disease Problem. Emerg. Infect. Dis. 1997, 3, 95–104. [Google Scholar] [CrossRef]
- Simmons, J.H.; Riley, L.K. Hantaviruses: An overview. Comp. Med. 2002, 52, 97–110. [Google Scholar]
- Zou, Y.; Xiao, Q.-Y.; Dong, X.; Lv, W.; Zhang, S.-P.; Li, M.-H.; Plyusnin, A.; Zhang, Y.-Z. Genetic analysis of hantaviruses carried by reed voles Microtus fortis in China. Virus Res. 2008, 137, 122–128. [Google Scholar] [CrossRef]
- Zhang, Y.-Z.; Zou, Y.; Fu, Z.F.; Plyusnin, A. Hantavirus Infections in Humans and Animals, China. Emerg. Infect. Dis. 2010, 16, 1195–1203. [Google Scholar] [CrossRef] [PubMed]
- Jonsson, C.B.; Figueiredo, L.T.M.; Vapalahti, O. A Global Perspective on Hantavirus Ecology, Epidemiology, and Disease. Clin. Microbiol. Rev. 2010, 23, 412–441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.-Z.; Xiao, D.-L.; Wang, Y.; Wang, H.-X.; Sun, L.; Tao, X.-X.; Qu, Y.-G. The epidemic characteristics and preventive measures of hemorrhagic fever with syndromes in China. Zhonghua Liu Xing Bing Xue Za Zhi = Zhonghua Liuxingbingxue Zazhi 2004, 25, 466–469. [Google Scholar] [PubMed]
- Shang, C.; Sun, Y.; Yin, Q.; Huang, X.; Liu, X.; Zhang, Q.; Mao, L.; Li, C.; Li, A.; Wang, Q.; et al. Hemorrhagic Fever with Renal Syndrome—Liaoning Province, China, 1999−2018. China CDC Wkly. 2020, 2, 350–354. [Google Scholar] [CrossRef]
- Wei, J.; Huang, X.; Li, S.; Du, S.; Yu, P.; Li, J. A Total of 2657 Reported Cases and 14 Deaths Due to Hemorrhagic Fever with Renal Syndrome—Shaanxi Province, China, January 1–December 19, 2021. China CDC Wkly. 2021, 3, 1143. [Google Scholar] [CrossRef]
- Zou, L.-X.; Sun, L. Analysis of Hemorrhagic Fever with Renal Syndrome Using Wavelet Tools in Mainland China, 2004–2019. Front. Public Health 2020, 8, 571984. [Google Scholar] [CrossRef]
- Maes, P.; Clement, J.; Gavrilovskaya, I.; Van Ranst, M. Hantaviruses: Immunology, Treatment, and Prevention. Viral Immunol. 2004, 17, 481–497. [Google Scholar] [CrossRef]
- Schmaljohn, C.S.; Spik, K.W.; Hooper, J.W. DNA vaccines for HFRS: Laboratory and clinical studies. Virus Res. 2014, 187, 91–96. [Google Scholar] [CrossRef]
- Liu, R.; Ma, H.; Shu, J.; Zhang, Q.; Han, M.; Liu, Z.; Jin, X.; Zhang, F.; Wu, X. Vaccines and Therapeutics Against Hantaviruses. Front. Microbiol. 2019, 10, 2989. [Google Scholar] [CrossRef] [Green Version]
- Hedman, K.; Vaheri, A.; Brummer-Korvenkontio, M. Rapid diagnosis of hantavirus disease with an IgG-avidity assay. Lancet 1991, 338, 1353–1356. [Google Scholar] [CrossRef]
- Mir, M.A. Hantaviruses. Clin. Lab. Med. 2010, 30, 67–91. [Google Scholar] [CrossRef] [PubMed]
- Kallio-Kokko, H.; Vapalahti, O.; Lundkvist, A.; Vaheri, A. Evaluation of Puumala virus IgG and IgM enzyme immunoassays based on recombinant baculovirus-expressed nucleocapsid protein for early nephropathia epidemica diagnosis. Clin. Diagn. Virol. 1998, 10, 83–90. [Google Scholar] [CrossRef]
- Krüger, D.H.; Ulrich, R.; Lundkvist, A. Hantavirus infections and their prevention. Microbes Infect. 2001, 3, 1129–1144. [Google Scholar] [CrossRef]
- Aitichou, M.; Saleh, S.S.; McElroy, A.K.; Schmaljohn, C.; Ibrahim, M.S. Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR. J. Virol. Methods 2005, 124, 21–26. [Google Scholar] [CrossRef]
- Li, Z.; Qi, X.; Zhou, M.; Bao, C.; Hu, J.; Wu, B.; Wang, S.; Tan, Z.; Fu, J.; Shan, J.; et al. A two-tube multiplex real-time RT-PCR assay for the detection of four hemorrhagic fever viruses: Severe fever with thrombocytopenia syndrome virus, Hantaan virus, Seoul virus, and dengue virus. Arch. Virol. 2013, 158, 1857–1863. [Google Scholar] [CrossRef]
- Kramski, M.; Meisel, H.; Klempa, B.; Krüger, D.H.; Pauli, G.; Nitsche, A. Detection and Typing of Human Pathogenic Hantaviruses by Real-Time Reverse Transcription-PCR and Pyrosequencing. Clin. Chem. 2007, 53, 1899–1905. [Google Scholar] [CrossRef] [Green Version]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [Green Version]
- Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef]
- Zhou, Y.; Wan, Z.; Yang, S.; Li, Y.; Li, M.; Wang, B.; Hu, Y.; Xia, X.; Jin, X.; Yu, N.; et al. A Mismatch-Tolerant Reverse Transcription Loop-Mediated Isothermal Amplification Method and Its Application on Simultaneous Detection of All Four Serotype of Dengue Viruses. Front. Microbiol. 2019, 10, 1056. [Google Scholar] [CrossRef] [Green Version]
- Dong, Y.; Zhao, Y.; Li, S.; Wan, Z.; Lu, R.; Yang, X.; Yu, G.; Reboud, J.; Cooper, J.M.; Tian, Z.; et al. Multiplex, Real-Time, Point-of-care RT-LAMP for SARS-CoV-2 Detection Using the HFman Probe. ACS Sens. 2022, 7, 730–739. [Google Scholar] [CrossRef]
- Lu, R.; Wu, X.; Wan, Z.; Li, Y.; Jin, X.; Zhang, C.; Lu, R.; Wu, X.; Wan, Z.; Li, Y.; et al. A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2. Int. J. Mol. Sci. 2020, 21, 2826. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, D.; Hao, L.; Zhang, J.; Yao, P.; Zhang, Q.; Lv, H.; Gong, X.; Pan, X.; Cao, M.; Zhu, J.; et al. Development of reverse transcription loop-mediated isothermal amplification assays to detect Hantaan virus and Seoul virus. J. Virol. Methods 2015, 221, 68–73. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Wu, X.; Li, S.; Lu, R.; Li, Y.; Wan, Z.; Qin, J.; Yu, G.; Jin, X.; Zhang, C. Comparative evaluation of 19 reverse transcription loop-mediated isothermal amplification assays for detection of SARS-CoV-2. Sci. Rep. 2021, 11, 2936. [Google Scholar] [CrossRef]
- Mori, Y.; Nagamine, K.; Tomita, N.; Notomi, T. Detection of Loop-Mediated Isothermal Amplification Reaction by Turbidity Derived from Magnesium Pyrophosphate Formation. Biochem. Biophys. Res. Commun. 2001, 289, 150–154. [Google Scholar] [CrossRef]
- Wang, Y.; Li, H.; Wang, Y.; Zhang, L.; Xu, J.; Ye, C. Loop-Mediated Isothermal Amplification Label-Based Gold Nanoparticles Lateral Flow Biosensor for Detection of Enterococcus faecalis and Staphylococcus aureus. Front. Microbiol. 2017, 8, 192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rolando, J.C.; Jue, E.; Barlow, J.T.; Ismagilov, R.F. Real-time kinetics and high-resolution melt curves in single-molecule digital LAMP to differentiate and study specific and non-specific amplification. Nucleic Acids Res. 2020, 48, e42. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.; Park, B.G.; Lim, D.H.; Jang, W.S.; Nam, J.; Mihn, D.-C.; Lim, C.S. Development and evaluation of a multiplex loop-mediated isothermal amplification (LAMP) assay for differentiation of Mycobacterium tuberculosis and non-tuberculosis mycobacterium in clinical samples. PLoS ONE 2021, 16, e0244753. [Google Scholar] [CrossRef]
- Zhang, X.; Li, H.; Liu, Z.; Zhao, Y.; Zeng, Y.; Dong, Y.; Li, L.; Zhang, C. An HFman probe-based reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for HIV-1 detection. Mol. Cell. Probes 2022, 64, 101834. [Google Scholar] [CrossRef]
- Li, Y.; Chen, X.; Zhao, Y.; Wan, Z.; Zeng, Y.; Ma, Y.; Zhou, L.; Xu, G.; Reboud, J.; Cooper, J.M.; et al. A rapid variant-tolerant reverse transcription loop-mediated isothermal amplification assay for the point of care detection of HIV-1. Analyst 2021, 146, 5347–5356. [Google Scholar] [CrossRef]
- Sui, X.; Zhang, X.; Fei, D.; Zhang, Z.; Ma, M. Simultaneous rapid detection of Hantaan virus and Seoul virus using RT-LAMP in rats. PeerJ 2019, 6, e6068. [Google Scholar] [CrossRef]
- Zhang, F.-L.; Wu, X.-A.; Luo, W.; Bai, W.-T.; Liu, Y.; Yan, Y.; Wang, H.-T.; Xu, Z.-K. The expression and genetic immunization of chimeric fragment of Hantaan virus M and S segments. Biochem. Biophys. Res. Commun. 2007, 354, 858–863. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Pan, L.; Mou, D.; Chen, Y.; Zhang, Y.; Li, X.; Ren, J.; Wang, P.; Zhang, Y.; Jia, Z.; et al. Characterization of truncated hantavirus nucleocapsid proteins and their application for serotyping. J. Med. Virol. 2006, 78, 926–932. [Google Scholar] [CrossRef] [PubMed]



| Methods | Primer Sets | Primer Sequence (5′-3′) | Refs. |
|---|---|---|---|
| RT-LAMP for -HTNV | H1-F3 | GTTGACAACAAGGGGGAG | This study |
| H1-B3 | GGTAGAGCCCACAGACTG | ||
| H1-FIP | CGTTAACATCCTCGAAC-GAGCT-CAAGGATAATAAAGGGACCCG | ||
| H1-BIP | CCGGAAAC-CAAAACATCTTTACG-TCTACCAGGTGTAATCTCTTCT | ||
| H1-LB | TGTCCTTGCCAAATGCACAG | ||
| H1-HFman probe | BHQ1-TGTCCTTGCCAAATGCACAG-FAM | ||
| RT-LAMP forSEOV | S1-F3 | AGCCCTGTCATGAGTGTAGT | This study |
| S1-B3 | CCTGAGGGCTTGAAATTCCT | ||
| S1-FIP | GAACTT-GCAGGGTGCGCCAA-GCACTGGCAAAAGACTGGA | ||
| S1-BIP | GGAGTCTCCCATTGCCGG-GA-AGTGCACCTTGTCTCTGTCT | ||
| S1-LB | TCTGGAAGTCCTGTGAATCGTGA | ||
| S1-HFman probe | BHQ2-TCTGGAAGTCCTGTGAATCGTGA-Cy5 | ||
| RT-qPCR | HASE-F | GWGGVCARACAGCWGAYT | Modified from ref. [24] |
| HASE-R | TCCWGGTGTAADYTCHTCWGC | ||
| SEOV-P | Cy5-CCATAATTGTCTATCTGACATCA-BHQ2 | ||
| HTNV-P | FAM-AGCATCATCGTCTATCTTACATCC-BHQ1 |
| Template Input (Copies/25 μL Reaction) | HNTV (Positive/Total) | SEOV (Positive/Total) |
|---|---|---|
| 3000 | 32/32 | 32/32 |
| 600 | 32/32 | 32/32 |
| 120 | 32/32 | 32/32 |
| 24 | 24/32 | 18/32 |
| 5 | 11/32 | 12/32 |
| LOD (copies/25 μL reaction) | 41 | 73 |
| Viruses | RT-LAMP (+/−) | RT-PCR (+/−) | Concordance Rate (%) |
|---|---|---|---|
| HTNV positive | 0/46 | 0/46 | 100% |
| SEOV positive | 2/44 | 1/45 | 97.8% |
| Total | 46 | 46 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zeng, Y.; Feng, Y.; Zhao, Y.; Zhang, X.; Yang, L.; Wang, J.; Gao, Z.; Zhang, C. An HFman Probe-Based Multiplex Reverse Transcription Loop-Mediated Isothermal Amplification Assay for Simultaneous Detection of Hantaan and Seoul Viruses. Diagnostics 2022, 12, 1925. https://doi.org/10.3390/diagnostics12081925
Zeng Y, Feng Y, Zhao Y, Zhang X, Yang L, Wang J, Gao Z, Zhang C. An HFman Probe-Based Multiplex Reverse Transcription Loop-Mediated Isothermal Amplification Assay for Simultaneous Detection of Hantaan and Seoul Viruses. Diagnostics. 2022; 12(8):1925. https://doi.org/10.3390/diagnostics12081925
Chicago/Turabian StyleZeng, Yi, Yun Feng, Yongjuan Zhao, Xiaoling Zhang, Lifen Yang, Juan Wang, Zihou Gao, and Chiyu Zhang. 2022. "An HFman Probe-Based Multiplex Reverse Transcription Loop-Mediated Isothermal Amplification Assay for Simultaneous Detection of Hantaan and Seoul Viruses" Diagnostics 12, no. 8: 1925. https://doi.org/10.3390/diagnostics12081925
APA StyleZeng, Y., Feng, Y., Zhao, Y., Zhang, X., Yang, L., Wang, J., Gao, Z., & Zhang, C. (2022). An HFman Probe-Based Multiplex Reverse Transcription Loop-Mediated Isothermal Amplification Assay for Simultaneous Detection of Hantaan and Seoul Viruses. Diagnostics, 12(8), 1925. https://doi.org/10.3390/diagnostics12081925
