IGFBP-6 Alters Mesenchymal Stromal Cell Phenotype Driving Dasatinib Resistance in Chronic Myeloid Leukemia
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines
2.2. XTT Assay
2.3. Western Blot Analysis
2.4. Immunofluorescence
2.5. RT-PCR Analysis
2.6. Statistical Analysis
3. Results
3.1. Dasatinib Exposure Does Not Affect LAMA-84 Cell Viability in Coculture with Human Mesenchymal Stem Cells (HS-5)
3.2. Dasatinib Increases IGFBP-6 Levels in Coculture Conditions and Pre-Treatment with IGFBP-6 Leads to Increased Cell Viability in LAMA-84 Cells
3.3. Pre-Treatment with IGFBP-6 Increases SHH Expression Levels in Coculture Models and Activates TLR-4 Signalling
3.4. The IGFBP-6-Dasatinib Combination Treatment Increases HS-5 Inflammatory State
3.5. The IGFBP-6 + Dasatinib Combination Treatment Increases LAMA-84 Inflammatory State and Activates TLR-4 Signalling
3.6. IGFBP-6 Rescues LAMA-84 Cell Viability after Dasatinib Exposure
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chereda, B.; Melo, J.V. Natural course and biology of CML. Ann. Hematol. 2015, 94 (Suppl 2), S107–S121. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Shi, O.; Zeng, Q.; Lu, X.; Wang, W.; Li, Y.; Wang, Q. Leukemia incidence trends at the global, regional, and national level between 1990 and 2017. Exp. Hematol. Oncol. 2020, 9, 14. [Google Scholar] [CrossRef]
- Jabbour, E.; Kantarjian, H. Chronic myeloid leukemia: 2020 update on diagnosis, therapy and monitoring. Am. J. Hematol. 2020, 95, 691–709. [Google Scholar] [CrossRef]
- Hehlmann, R. Chronic Myeloid Leukemia in 2020. Hemasphere 2020, 4, e468. [Google Scholar] [CrossRef] [PubMed]
- Pane, F.; Intrieri, M.; Quintarelli, C.; Izzo, B.; Muccioli, G.C.; Salvatore, F. BCR/ABL genes and leukemic phenotype: From molecular mechanisms to clinical correlations. Oncogene 2002, 21, 8652–8667. [Google Scholar] [CrossRef] [PubMed]
- Melo, J.V.; Deininger, M.W. Biology of chronic myelogenous leukemia—Signaling pathways of initiation and transformation. Hematol. Oncol. Clin. N. Am. 2004, 18, 545–568. [Google Scholar] [CrossRef] [PubMed]
- Conte, E.; Gili, E.; Fruciano, M.; Korfei, M.; Fagone, E.; Iemmolo, M.; Lo Furno, D.; Giuffrida, R.; Crimi, N.; Guenther, A.; et al. PI3K p110gamma overexpression in idiopathic pulmonary fibrosis lung tissue and fibroblast cells: In vitro effects of its inhibition. Lab. Investig. 2013, 93, 566–576. [Google Scholar] [CrossRef] [Green Version]
- Bhatia, R. Novel approaches to therapy in CML. Hematol. Am. Soc. Hematol. Educ. Program 2017, 2017, 115–120. [Google Scholar] [CrossRef] [Green Version]
- Zhou, H.; Xu, R. Leukemia stem cells: The root of chronic myeloid leukemia. Protein Cell 2015, 6, 403–412. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, F.; Zhuang, X.; Lin, L.; Yu, P.; Wang, Y.; Shi, Y.; Hu, G.; Sun, Y. New horizons in tumor microenvironment biology: Challenges and opportunities. BMC Med. 2015, 13, 45. [Google Scholar] [CrossRef]
- Catalano, V.; Turdo, A.; Di Franco, S.; Dieli, F.; Todaro, M.; Stassi, G. Tumor and its microenvironment: A synergistic interplay. Semin. Cancer Biol. 2013, 23, 522–532. [Google Scholar] [CrossRef] [PubMed]
- Sormendi, S.; Wielockx, B. Hypoxia Pathway Proteins As Central Mediators of Metabolism in the Tumor Cells and Their Microenvironment. Front. Immunol. 2018, 9, 40. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.J.; Lei, K.F.; Han, F. Tumor microenvironment: Recent advances in various cancer treatments. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 3855–3864. [Google Scholar] [CrossRef] [PubMed]
- Giallongo, C.; Parrinello, N.L.; La Cava, P.; Camiolo, G.; Romano, A.; Scalia, M.; Stagno, F.; Palumbo, G.A.; Avola, R.; Li Volti, G.; et al. Monocytic myeloid-derived suppressor cells as prognostic factor in chronic myeloid leukaemia patients treated with dasatinib. J. Cell. Mol. Med. 2018, 22, 1070–1080. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, N.M.; Simon, M.C. The tumor microenvironment. Curr. Biol. 2020, 30, R921–R925. [Google Scholar] [CrossRef]
- Lucas, D. The Bone Marrow Microenvironment for Hematopoietic Stem Cells. Adv. Exp. Med. Biol. 2017, 1041, 5–18. [Google Scholar] [CrossRef]
- Mannino, G.; Russo, C.; Maugeri, G.; Musumeci, G.; Vicario, N.; Tibullo, D.; Giuffrida, R.; Parenti, R.; Lo Furno, D. Adult stem cell niches for tissue homeostasis. J. Cell. Physiol. 2022, 237, 239–257. [Google Scholar] [CrossRef]
- Mukaida, N.; Tanabe, Y.; Baba, T. Chemokines as a Conductor of Bone Marrow Microenvironment in Chronic Myeloid Leukemia. Int. J. Mol. Sci. 2017, 18, 1824. [Google Scholar] [CrossRef] [Green Version]
- Osher, E.; Macaulay, V.M. Therapeutic Targeting of the IGF Axis. Cells 2019, 8, 895. [Google Scholar] [CrossRef]
- Zhang, D.; Samani, A.A.; Brodt, P. The role of the IGF-I receptor in the regulation of matrix metalloproteinases, tumor invasion and metastasis. Horm. Metab. Res. 2003, 35, 802–808. [Google Scholar] [CrossRef] [PubMed]
- Brodt, P.; Fallavollita, L.; Khatib, A.M.; Samani, A.A.; Zhang, D. Cooperative regulation of the invasive and metastatic phenotypes by different domains of the type I insulin-like growth factor receptor beta subunit. J. Biol. Chem. 2001, 276, 33608–33615. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Werner, H. Tumor suppressors govern insulin-like growth factor signaling pathways: Implications in metabolism and cancer. Oncogene 2012, 31, 2703–2714. [Google Scholar] [CrossRef] [PubMed]
- Vasylyeva, T.L.; Ferry, R.J., Jr. Novel roles of the IGF-IGFBP axis in etiopathophysiology of diabetic nephropathy. Diabetes Res. Clin. Pract. 2007, 76, 177–186. [Google Scholar] [CrossRef] [Green Version]
- Bach, L.A. Insulin-like growth factor binding protein-6: The “forgotten” binding protein? Horm. Metab. Res. 1999, 31, 226–234. [Google Scholar] [CrossRef]
- Bach, L.A. IGFBP-6 five years on; not so ‘forgotten’? Growth Horm. IGF Res. 2005, 15, 185–192. [Google Scholar] [CrossRef]
- Varjosalo, M.; Taipale, J. Hedgehog: Functions and mechanisms. Genes Dev. 2008, 22, 2454–2472. [Google Scholar] [CrossRef] [Green Version]
- Le, H.; Kleinerman, R.; Lerman, O.Z.; Brown, D.; Galiano, R.; Gurtner, G.C.; Warren, S.M.; Levine, J.P.; Saadeh, P.B. Hedgehog signaling is essential for normal wound healing. Wound Repair Regen. 2008, 16, 768–773. [Google Scholar] [CrossRef]
- Watkins, D.N.; Berman, D.M.; Burkholder, S.G.; Wang, B.; Beachy, P.A.; Baylin, S.B. Hedgehog signalling within airway epithelial progenitors and in small-cell lung cancer. Nature 2003, 422, 313–317. [Google Scholar] [CrossRef]
- Karhadkar, S.S.; Bova, G.S.; Abdallah, N.; Dhara, S.; Gardner, D.; Maitra, A.; Isaacs, J.T.; Berman, D.M.; Beachy, P.A. Hedgehog signalling in prostate regeneration, neoplasia and metastasis. Nature 2004, 431, 707–712. [Google Scholar] [CrossRef]
- Fendrich, V.; Esni, F.; Garay, M.V.; Feldmann, G.; Habbe, N.; Jensen, J.N.; Dor, Y.; Stoffers, D.; Jensen, J.; Leach, S.D.; et al. Hedgehog signaling is required for effective regeneration of exocrine pancreas. Gastroenterology 2008, 135, 621–631. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bailey, J.M.; Mohr, A.M.; Hollingsworth, M.A. Sonic hedgehog paracrine signaling regulates metastasis and lymphangiogenesis in pancreatic cancer. Oncogene 2009, 28, 3513–3525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, X.; Sheng, T.; Zhang, Y.; Zhang, X.; He, J.; Huang, S.; Chen, K.; Sultz, J.; Adegboyega, P.A.; Zhang, H.; et al. Hedgehog signaling is activated in subsets of esophageal cancers. Int. J. Cancer 2006, 118, 139–148. [Google Scholar] [CrossRef] [PubMed]
- Vicario, N.; Bernstock, J.D.; Spitale, F.M.; Giallongo, C.; Giunta, M.A.S.; Li Volti, G.; Gulisano, M.; Leanza, G.; Tibullo, D.; Parenti, R.; et al. Clobetasol Modulates Adult Neural Stem Cell Growth via Canonical Hedgehog Pathway Activation. Int. J. Mol. Sci. 2019, 20, 1991. [Google Scholar] [CrossRef] [Green Version]
- Vicario, N.; Spitale, F.M.; Tibullo, D.; Giallongo, C.; Amorini, A.M.; Scandura, G.; Spoto, G.; Saab, M.W.; D’Aprile, S.; Alberghina, C.; et al. Clobetasol promotes neuromuscular plasticity in mice after motoneuronal loss via sonic hedgehog signaling, immunomodulation and metabolic rebalancing. Cell Death Dis. 2021, 12, 625. [Google Scholar] [CrossRef] [PubMed]
- Torrisi, F.; Alberghina, C.; Lo Furno, D.; Zappala, A.; Valable, S.; Li Volti, G.; Tibullo, D.; Vicario, N.; Parenti, R. Connexin 43 and Sonic Hedgehog Pathway Interplay in Glioblastoma Cell Proliferation and Migration. Biology 2021, 10, 767. [Google Scholar] [CrossRef]
- Skoda, A.M.; Simovic, D.; Karin, V.; Kardum, V.; Vranic, S.; Serman, L. The role of the Hedgehog signaling pathway in cancer: A comprehensive review. Bosn. J. Basic Med. Sci. 2018, 18, 8–20. [Google Scholar] [CrossRef] [Green Version]
- Kawai, T.; Akira, S. TLR signaling. Cell Death Differ. 2006, 13, 816–825. [Google Scholar] [CrossRef] [Green Version]
- Latz, E.; Schoenemeyer, A.; Visintin, A.; Fitzgerald, K.A.; Monks, B.G.; Knetter, C.F.; Lien, E.; Nilsen, N.J.; Espevik, T.; Golenbock, D.T. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat. Immunol. 2004, 5, 190–198. [Google Scholar] [CrossRef]
- Longhitano, L.; Tibullo, D.; Vicario, N.; Giallongo, C.; La Spina, E.; Romano, A.; Lombardo, S.; Moretti, M.; Masia, F.; Coda, A.R.D.; et al. IGFBP-6/sonic hedgehog/TLR4 signalling axis drives bone marrow fibrotic transformation in primary myelofibrosis. Aging 2021, 13, 25055–25071. [Google Scholar] [CrossRef]
- Sorrenti, V.; Pittala, V.; Romeo, G.; Amata, E.; Dichiara, M.; Marrazzo, A.; Turnaturi, R.; Prezzavento, O.; Barbagallo, I.; Vanella, L.; et al. Targeting heme Oxygenase-1 with hybrid compounds to overcome Imatinib resistance in chronic myeloid leukemia cell lines. Eur. J. Med. Chem. 2018, 158, 937–950. [Google Scholar] [CrossRef]
- Giallongo, C.; Tibullo, D.; La Cava, P.; Branca, A.; Parrinello, N.; Spina, P.; Stagno, F.; Conticello, C.; Chiarenza, A.; Vigneri, P.; et al. BRIT1/MCPH1 expression in chronic myeloid leukemia and its regulation of the G2/M checkpoint. Acta Haematol. 2011, 126, 205–210. [Google Scholar] [CrossRef]
- Giallongo, C.; Romano, A.; Parrinello, N.L.; La Cava, P.; Brundo, M.V.; Bramanti, V.; Stagno, F.; Vigneri, P.; Chiarenza, A.; Palumbo, G.A.; et al. Mesenchymal Stem Cells (MSC) Regulate Activation of Granulocyte-Like Myeloid Derived Suppressor Cells (G-MDSC) in Chronic Myeloid Leukemia Patients. PLoS ONE 2016, 11, e0158392. [Google Scholar] [CrossRef]
- Mannino, G.; Gennuso, F.; Giurdanella, G.; Conti, F.; Drago, F.; Salomone, S.; Furno, D.L.; Bucolo, C.; Giuffrida, R. Pericyte-like differentiation of human adipose-derived mesenchymal stem cells: An in vitro study. World J. Stem Cells 2020, 12, 1152–1170. [Google Scholar] [CrossRef]
- Barbagallo, I.; Giallongo, C.; Volti, G.L.; Distefano, A.; Camiolo, G.; Raffaele, M.; Salerno, L.; Pittala, V.; Sorrenti, V.; Avola, R.; et al. Heme Oxygenase Inhibition Sensitizes Neuroblastoma Cells to Carfilzomib. Mol. Neurobiol. 2019, 56, 1451–1460. [Google Scholar] [CrossRef]
- Gulino, R.; Vicario, N.; Giunta, M.A.S.; Spoto, G.; Calabrese, G.; Vecchio, M.; Gulisano, M.; Leanza, G.; Parenti, R. Neuromuscular Plasticity in a Mouse Neurotoxic Model of Spinal Motoneuronal Loss. Int. J. Mol. Sci. 2019, 20, 1500. [Google Scholar] [CrossRef] [Green Version]
- Russo, C.; Mannino, G.; Patane, M.; Parrinello, N.L.; Pellitteri, R.; Stanzani, S.; Giuffrida, R.; Lo Furno, D.; Russo, A. Ghrelin peptide improves glial conditioned medium effects on neuronal differentiation of human adipose mesenchymal stem cells. Histochem. Cell Biol. 2021, 156, 35–46. [Google Scholar] [CrossRef]
- Lo Furno, D.; Mannino, G.; Pellitteri, R.; Zappala, A.; Parenti, R.; Gili, E.; Vancheri, C.; Giuffrida, R. Conditioned Media From Glial Cells Promote a Neural-Like Connexin Expression in Human Adipose-Derived Mesenchymal Stem Cells. Front. Physiol. 2018, 9, 1742. [Google Scholar] [CrossRef] [Green Version]
- Lo Furno, D.; Graziano, A.C.; Caggia, S.; Perrotta, R.E.; Tarico, M.S.; Giuffrida, R.; Cardile, V. Decrease of apoptosis markers during adipogenic differentiation of mesenchymal stem cells from human adipose tissue. Apoptosis 2013, 18, 578–588. [Google Scholar] [CrossRef]
- Longhitano, L.; Vicario, N.; Forte, S.; Giallongo, C.; Broggi, G.; Caltabiano, R.; Barbagallo, G.M.V.; Altieri, R.; Raciti, G.; Di Rosa, M.; et al. Lactate modulates microglia polarization via IGFBP6 expression and remodels tumor microenvironment in glioblastoma. Cancer Immunol. Immunother. 2022, 72, 1–20. [Google Scholar] [CrossRef]
- Longhitano, L.; Forte, S.; Orlando, L.; Grasso, S.; Barbato, A.; Vicario, N.; Parenti, R.; Fontana, P.; Amorini, A.M.; Lazzarino, G.; et al. The Crosstalk between GPR81/IGFBP6 Promotes Breast Cancer Progression by Modulating Lactate Metabolism and Oxidative Stress. Antioxidants 2022, 11, 275. [Google Scholar] [CrossRef] [PubMed]
- Vicario, N.; Denaro, S.; Turnaturi, R.; Longhitano, L.; Spitale, F.M.; Spoto, S.; Marrazzo, A.; Zappala, A.; Tibullo, D.; Li Volti, G.; et al. Mu and Delta Opioid Receptor Targeting Reduces Connexin 43-Based Heterocellular Coupling during Neuropathic Pain. Int. J. Mol. Sci. 2022, 23, 5864. [Google Scholar] [CrossRef] [PubMed]
- Mannino, G.; Vicario, N.; Parenti, R.; Giuffrida, R.; Lo Furno, D. Connexin expression decreases during adipogenic differentiation of human adipose-derived mesenchymal stem cells. Mol. Biol. Rep. 2020, 47, 9951–9958. [Google Scholar] [CrossRef] [PubMed]
- Calabrese, G.; Giuffrida, R.; Lo Furno, D.; Parrinello, N.L.; Forte, S.; Gulino, R.; Colarossi, C.; Schinocca, L.R.; Giuffrida, R.; Cardile, V.; et al. Potential Effect of CD271 on Human Mesenchymal Stromal Cell Proliferation and Differentiation. Int. J. Mol. Sci. 2015, 16, 15609–15624. [Google Scholar] [CrossRef] [Green Version]
- Mannino, G.; Russo, C.; Longo, A.; Anfuso, C.D.; Lupo, G.; Lo Furno, D.; Giuffrida, R.; Giurdanella, G. Potential therapeutic applications of mesenchymal stem cells for the treatment of eye diseases. World J. Stem Cells 2021, 13, 632–644. [Google Scholar] [CrossRef]
- Olsson, B.; Legros, L.; Guilhot, F.; Stromberg, K.; Smith, J.; Livesey, F.J.; Wilson, D.H.; Zetterberg, H.; Blennow, K. Imatinib treatment and Abeta42 in humans. Alzheimers Dement 2014, 10, S374–S380. [Google Scholar] [CrossRef]
- Camiolo, G.; Barbato, A.; Giallongo, C.; Vicario, N.; Romano, A.; Parrinello, N.L.; Parenti, R.; Sandoval, J.C.; Garcia-Moreno, D.; Lazzarino, G.; et al. Iron regulates myeloma cell/macrophage interaction and drives resistance to bortezomib. Redox Biol. 2020, 36, 101611. [Google Scholar] [CrossRef]
- Poreba, E.; Durzynska, J. Nuclear localization and actions of the insulin-like growth factor 1 (IGF-1) system components: Transcriptional regulation and DNA damage response. Mutat. Res. Rev. Mutat. Res. 2020, 784, 108307. [Google Scholar] [CrossRef]
- Feng, B.; Wu, J.; Shen, B.; Jiang, F.; Feng, J. Cancer-associated fibroblasts and resistance to anticancer therapies: Status, mechanisms, and countermeasures. Cancer Cell Int. 2022, 22, 166. [Google Scholar] [CrossRef]
- Sanchez, P.; Clement, V.; Ruiz i Altaba, A. Therapeutic targeting of the Hedgehog-GLI pathway in prostate cancer. Cancer Res. 2005, 65, 2990–2992. [Google Scholar] [CrossRef]
- Tibullo, D.; Longo, A.; Vicario, N.; Romano, A.; Barbato, A.; Di Rosa, M.; Barbagallo, I.; Anfuso, C.D.; Lupo, G.; Gulino, R.; et al. Ixazomib Improves Bone Remodeling and Counteracts sonic Hedgehog signaling Inhibition Mediated by Myeloma Cells. Cancers 2020, 12, 323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamazaki, M.; Nakamura, K.; Mizukami, Y.; Ii, M.; Sasajima, J.; Sugiyama, Y.; Nishikawa, T.; Nakano, Y.; Yanagawa, N.; Sato, K.; et al. Sonic hedgehog derived from human pancreatic cancer cells augments angiogenic function of endothelial progenitor cells. Cancer Sci. 2008, 99, 1131–1138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, X.; Horiuchi, A.; Kikuchi, N.; Osada, R.; Yoshida, J.; Shiozawa, T.; Konishi, I. Hedgehog signal pathway is activated in ovarian carcinomas, correlating with cell proliferation: It’s inhibition leads to growth suppression and apoptosis. Cancer Sci. 2007, 98, 68–76. [Google Scholar] [CrossRef] [PubMed]
- Su, W.; Meng, F.; Huang, L.; Zheng, M.; Liu, W.; Sun, H. Sonic hedgehog maintains survival and growth of chronic myeloid leukemia progenitor cells through beta-catenin signaling. Exp. Hematol. 2012, 40, 418–427. [Google Scholar] [CrossRef]
- Dierks, C.; Beigi, R.; Guo, G.R.; Zirlik, K.; Stegert, M.R.; Manley, P.; Trussell, C.; Schmitt-Graeff, A.; Landwerlin, K.; Veelken, H.; et al. Expansion of Bcr-Abl-positive leukemic stem cells is dependent on Hedgehog pathway activation. Cancer Cell 2008, 14, 238–249. [Google Scholar] [CrossRef] [Green Version]
- Sadarangani, A.; Pineda, G.; Lennon, K.M.; Chun, H.J.; Shih, A.; Schairer, A.E.; Court, A.C.; Goff, D.J.; Prashad, S.L.; Geron, I.; et al. GLI2 inhibition abrogates human leukemia stem cell dormancy. J. Transl. Med. 2015, 13, 98. [Google Scholar] [CrossRef] [Green Version]
- Zhao, C.; Chen, A.; Jamieson, C.H.; Fereshteh, M.; Abrahamsson, A.; Blum, J.; Kwon, H.Y.; Kim, J.; Chute, J.P.; Rizzieri, D.; et al. Hedgehog signalling is essential for maintenance of cancer stem cells in myeloid leukaemia. Nature 2009, 458, 776–779. [Google Scholar] [CrossRef] [Green Version]
- Zhao, S.; Zhang, Y.; Zhang, Q.; Wang, F.; Zhang, D. Toll-like receptors and prostate cancer. Front. Immunol. 2014, 5, 352. [Google Scholar] [CrossRef]
Gene of Interest | Forward Primer (5′ → 3′) | Reverse Primer (5′ → 3′) |
---|---|---|
SIRT1 | AGGCCACGGATAGGTCCATA | GTGGAGGTATTGTTTCCGGC |
PGC1α | ATGAAGGGTACTTTTCTGCCCC | GGTCTTCACCAACCAGAGCA |
TGF-β | CCCAGCATCTGCAAAGCTC | GTCAATGTACAGCTGCCGCA |
IFNγ | TGAATGTCCAACGCAAAGCA | CGACCTCGAAACAGCATCTGA |
IGFBP-6 | CCTGCTGTTGCAGAGGAGAAT | CTCTGCGGTTCACATCCTGT |
SHH | GCGAGATGTCTGCTGCTAGT | TTACACCTCTGAGTCATCAGC |
TLR4 | AAGCCGAAAGGTGATTGTTG | CTGAGCAGGGTCTTCTCCAC |
βActin | CCTTTGCCGATCCGCCG | AACATGATCTGGGTCATCTTCTCGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cambria, D.; Longhitano, L.; La Spina, E.; Giallongo, S.; Orlando, L.; Giuffrida, R.; Tibullo, D.; Fontana, P.; Barbagallo, I.; Nicoletti, V.G.; et al. IGFBP-6 Alters Mesenchymal Stromal Cell Phenotype Driving Dasatinib Resistance in Chronic Myeloid Leukemia. Life 2023, 13, 259. https://doi.org/10.3390/life13020259
Cambria D, Longhitano L, La Spina E, Giallongo S, Orlando L, Giuffrida R, Tibullo D, Fontana P, Barbagallo I, Nicoletti VG, et al. IGFBP-6 Alters Mesenchymal Stromal Cell Phenotype Driving Dasatinib Resistance in Chronic Myeloid Leukemia. Life. 2023; 13(2):259. https://doi.org/10.3390/life13020259
Chicago/Turabian StyleCambria, Daniela, Lucia Longhitano, Enrico La Spina, Sebastiano Giallongo, Laura Orlando, Rosario Giuffrida, Daniele Tibullo, Paolo Fontana, Ignazio Barbagallo, Vincenzo Giuseppe Nicoletti, and et al. 2023. "IGFBP-6 Alters Mesenchymal Stromal Cell Phenotype Driving Dasatinib Resistance in Chronic Myeloid Leukemia" Life 13, no. 2: 259. https://doi.org/10.3390/life13020259
APA StyleCambria, D., Longhitano, L., La Spina, E., Giallongo, S., Orlando, L., Giuffrida, R., Tibullo, D., Fontana, P., Barbagallo, I., Nicoletti, V. G., Volti, G. L., Fabro, V. D., Coda, A. R. D., Liso, A., & Palumbo, G. A. (2023). IGFBP-6 Alters Mesenchymal Stromal Cell Phenotype Driving Dasatinib Resistance in Chronic Myeloid Leukemia. Life, 13(2), 259. https://doi.org/10.3390/life13020259