Green-Synthesized Silver and Selenium Nanoparticles Using Berberine: A Comparative Assessment of In Vitro Anticancer Potential on Human Hepatocellular Carcinoma Cell Line (HepG2)
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Biosynthesis of Ber-AgNPs
2.3. Biosynthesis of Ber-SeNPs
2.4. Cell Lines and Culture Conditions
2.5. Design of the Study
2.6. Cytotoxicity Assay
2.7. Wound Healing Cell Migration Assay
2.8. Lactate Dehydrogenase (LDH) Assay
2.9. Determination of Factors Related to Apoptosis and Inflammation
2.10. Determination of Cell Cycle-Related Factors
2.11. Determination of the Oxidative Status of Cells
2.12. Statistical Analysis
3. Results
3.1. Cytotoxic Effect of Berberine and Its Nanoderivatives
3.2. Berberine and Its Nanoderivatives Exhibit Antimigratory Properties against HepG2 Cells
3.3. LDH Enzyme Leakage
3.4. Effect of Berberine and Its Nanoderivatives on HepG2 Cell Apoptosis
3.5. Changes in p53 and Caspase-3 Levels
3.6. Cell Cycle Regulators
3.7. Effect on the Inflammatory Mediators
3.8. Oxidative Status
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Parkin, D.M.; Pineros, M.; Znaor, A.; Bray, F. Cancer statistics for the year 2020: An overview. Int. J. Cancer 2021, 149, 778–789. [Google Scholar] [CrossRef]
- Singh, A.; Bajpai, V.; Srivastava, M.; Arya, K.R.; Kumar, B. Rapid screening and distribution of bioactive compounds in different parts of Berberis petiolaris using direct analysis in real time mass spectrometry. J. Pharm. Anal. 2015, 5, 332–335. [Google Scholar] [CrossRef]
- Mo, C.; Wang, L.; Zhang, J.; Numazawa, S.; Tang, H.; Tang, X.; Han, X.; Li, J.; Yang, M.; Wang, Z.; et al. The crosstalk between Nrf2 and AMPK signal pathways is important for the anti-inflammatory effect of berberine in LPS-stimulated macrophages and endotoxin-shocked mice. Antioxid. Redox Signal. 2014, 20, 574–588. [Google Scholar] [CrossRef] [PubMed]
- Hsu, Y.Y.; Tseng, Y.T.; Lo, Y.C. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth. Toxicol. Appl. Pharmacol. 2013, 272, 787–796. [Google Scholar] [CrossRef] [PubMed]
- Dong, H.; Zhao, Y.; Zhao, L.; Lu, F. The effects of berberine on blood lipids: A systemic review and meta-analysis of randomized controlled trials. Planta Medica 2013, 79, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Derosa, G.; Maffioli, P.; Cicero, A.F. Berberine on metabolic and cardiovascular risk factors: An analysis from preclinical evidences to clinical trials. Expert Opin. Biol. 2012, 12, 1113–1124. [Google Scholar] [CrossRef]
- Peng, W.H.; Lo, K.L.; Lee, Y.H.; Hung, T.H.; Lin, Y.C. Berberine produces antidepressant-like effects in the forced swim test and in the tail suspension test in mice. Life Sci. 2007, 81, 933–938. [Google Scholar] [CrossRef]
- Bhutada, P.; Mundhada, Y.; Bansod, K.; Tawari, S.; Patil, S.; Dixit, P.; Umathe, S.; Mundhada, D. Protection of cholinergic and antioxidant system contributes to the effect of berberine ameliorating memory dysfunction in rat model of streptozotocin-induced diabetes. Behav. Brain Res. 2011, 220, 30–41. [Google Scholar] [CrossRef]
- Othman, M.S.; Al-Bagawi, A.H.; Obeidat, S.T.; Fareid, M.A.; Habotta, O.A.; Moneim, A.E.A. Antitumor Activity of Zinc Nanoparticles Synthesized with Berberine on Human Epithelial Colorectal Adenocarcinoma (Caco-2) Cells through Acting on Cox-2/NF-kB and p53 Pathways. Anti-Cancer Agents Med. Chem. 2022, 22, 2002–2010. [Google Scholar] [CrossRef]
- Othman, M.S.; Obeidat, S.T.; Al-Bagawi, A.H.; Fareid, M.A.; Fehaid, A.; Moneim, A.E.A. Green-synthetized selenium nanoparticles using berberine as a promising anticancer agent. J. Integr. Med. 2022, 20, 65–72. [Google Scholar] [CrossRef]
- Rauf, A.; Abu-Izneid, T.; Khalil, A.A.; Imran, M.; Shah, Z.A.; Emran, T.B.; Mitra, S.; Khan, Z.; Alhumaydhi, F.A.; Aljohani, A.S.M.; et al. Berberine as a Potential Anticancer Agent: A Comprehensive Review. Molecules 2021, 26, 7368. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Wang, Q.; Lin, Z.; Yang, P.; Dou, K.; Zhang, R. Berberine Inhibits Growth of Liver Cancer Cells by Suppressing Glutamine Uptake. OncoTargets Ther. 2019, 12, 11751–11763. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Wang, X.; Cao, S.; Sun, Y.; He, X.; Jiang, B.; Yu, Y.; Duan, J.; Qiu, F.; Kang, N. Berberine represses human gastric cancer cell growth in vitro and in vivo by inducing cytostatic autophagy via inhibition of MAPK/mTOR/p70S6K and Akt signaling pathways. Biomed. Pharmacother. 2020, 128, 110245. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Zhang, C.; Yang, X.; Yang, B.; Wang, J.; Kang, Y.; Wang, Z.; Li, D.; Huang, G.; Ma, Z.; et al. Berberine inhibits the expression of hypoxia induction factor-1alpha and increases the radiosensitivity of prostate cancer. Diagn. Pathol. 2014, 9, 98. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, S. Berberine suppresses growth and metastasis of endometrial cancer cells via miR-101/COX-2. Biomed. Pharmacother. 2018, 103, 1287–1293. [Google Scholar] [CrossRef]
- Vlavcheski, F.; O’Neill, E.J.; Gagacev, F.; Tsiani, E. Effects of Berberine against Pancreatitis and Pancreatic Cancer. Molecules 2022, 27, 8630. [Google Scholar] [CrossRef]
- Jin, P.; Zhang, C.; Li, N. Berberine exhibits antitumor effects in human ovarian cancer cells. Anti-Cancer Agents Med. Chem. 2015, 15, 511–516. [Google Scholar] [CrossRef]
- Almeer, R.S.; Aref, A.M.; Hussein, R.A.; Othman, M.S.; Abdel Moneim, A.E. Antitumor Potential of Berberine and Cinnamic Acid against Solid Ehrlich Carcinoma in Mice. Anti-Cancer Agents Med. Chem. 2019, 19, 356–364. [Google Scholar] [CrossRef]
- Choi, J.A.; Lee, E.H.; Cho, H.; Kim, J.H. High-Dose Selenium Induces Ferroptotic Cell Death in Ovarian Cancer. Int. J. Mol. Sci. 2023, 24, 1918. [Google Scholar] [CrossRef]
- Kursvietiene, L.; Mongirdiene, A.; Bernatoniene, J.; Sulinskiene, J.; Staneviciene, I. Selenium Anticancer Properties and Impact on Cellular Redox Status. Antioxidants 2020, 9, 80. [Google Scholar] [CrossRef]
- Alizadeh, S.R.; Abbastabar, M.; Nosratabadi, M.; Ebrahimzadeh, M.A. High antimicrobial, cytotoxicity, and catalytic activities of biosynthesized selenium nanoparticles using Crocus caspius extract. Arab. J. Chem. 2023, 16, 104705. [Google Scholar] [CrossRef]
- Xia, Y.; Xu, T.; Wang, C.; Li, Y.; Lin, Z.; Zhao, M.; Zhu, B. Novel functionalized nanoparticles for tumor-targeting co-delivery of doxorubicin and siRNA to enhance cancer therapy. Int. J. Nanomed. 2018, 13, 143–159. [Google Scholar] [CrossRef]
- Martinez-Esquivias, F.; Gutierrez-Angulo, M.; Perez-Larios, A.; Sanchez-Burgos, J.A.; Becerra-Ruiz, J.S.; Guzman-Flores, J.M. Anticancer Activity of Selenium Nanoparticles In Vitro Studies. Anti-Cancer Agents Med. Chem. 2022, 22, 1658–1673. [Google Scholar] [CrossRef]
- Ivanova, N.; Gugleva, V.; Dobreva, M.; Pehlivanov, I.; Stefanov, S.; Andonova, V. Silver Nanoparticles as Multi-Functional Drug Delivery Systems. In Nanomedicines; Muhammad Akhyar, F., Ed.; IntechOpen: Rijeka, Croatia, 2018; Chapter 4. [Google Scholar]
- Acharya, D.; Satapathy, S.; Somu, P.; Parida, U.K.; Mishra, G. Apoptotic Effect and Anticancer Activity of Biosynthesized Silver Nanoparticles from Marine Algae Chaetomorpha linum Extract against Human Colon Cancer Cell HCT-116. Biol. Trace Element Res. 2021, 199, 1812–1822. [Google Scholar] [CrossRef]
- El-Khadragy, M.; Alolayan, E.M.; Metwally, D.M.; El-Din, M.F.S.; Alobud, S.S.; Alsultan, N.I.; Alsaif, S.S.; Awad, M.A.; Abdel Moneim, A.E. Clinical Efficacy Associated with Enhanced Antioxidant Enzyme Activities of Silver Nanoparticles Biosynthesized Using Moringa oleifera Leaf Extract, against Cutaneous Leishmaniasis in a Murine Model of Leishmania major. Int. J. Environ. Res. Public Health 2018, 15, 1037. [Google Scholar] [CrossRef]
- Zhang, X.F.; Liu, Z.G.; Shen, W.; Gurunathan, S. Silver Nanoparticles: Synthesis, Characterization, Properties, Applications, and Therapeutic Approaches. Int. J. Mol. Sci. 2016, 17, 1534. [Google Scholar] [CrossRef] [PubMed]
- Heidari, Z.; Salehzadeh, A.; Sadat Shandiz, S.A.; Tajdoost, S. Anti-cancer and anti-oxidant properties of ethanolic leaf extract of Thymus vulgaris and its bio-functionalized silver nanoparticles. 3 Biotech 2018, 8, 177. [Google Scholar] [CrossRef]
- Abass Sofi, M.; Sunitha, S.; Ashaq Sofi, M.; Khadheer Pasha, S.K.; Choi, D. An overview of antimicrobial and anticancer potential of silver nanoparticles. J. King Saud Univ.-Sci. 2022, 34, 101791. [Google Scholar] [CrossRef]
- El-Borady, O.M.; Othman, M.S.; Atallah, H.H.; Abdel Moneim, A.E. Hypoglycemic potential of selenium nanoparticles capped with polyvinyl-pyrrolidone in streptozotocin-induced experimental diabetes in rats. Heliyon 2020, 6, e04045. [Google Scholar] [CrossRef] [PubMed]
- Rafael, Á.-C.; Jesús Ángel, A.-A. Green synthesis of nanoparticles. A biological approach. In Advances in Green Chemistry; Kinjal, J.S., Ed.; IntechOpen: Rijeka, Croatia, 2023; Chapter 5. [Google Scholar]
- Shan, R.F.; Zhou, Y.F.; Peng, A.F.; Jie, Z.G. Inhibition of Aurora-B suppresses HepG2 cell invasion and migration via the PI3K/Akt/NF-kappaB signaling pathway in vitro. Exp. Ther. Med. 2014, 8, 1005–1009. [Google Scholar] [CrossRef]
- Ellman, G.L. Tissue sulfhydryl groups. Arch. Biochem. Biophys. 1959, 82, 70–77. [Google Scholar] [CrossRef] [PubMed]
- Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Othman, M.S.; Safwat, G.; Aboulkhair, M.; Abdel Moneim, A.E. The potential effect of berberine in mercury-induced hepatorenal toxicity in albino rats. Food Chem. Toxicol. 2014, 69, 175–181. [Google Scholar] [CrossRef]
- Chen, Z.; Vallega, K.A.; Chen, H.; Zhou, J.; Ramalingam, S.S.; Sun, S.Y. The natural product berberine synergizes with osimertinib preferentially against MET-amplified osimertinib-resistant lung cancer via direct MET inhibition. Pharmacol. Res. 2022, 175, 105998. [Google Scholar] [CrossRef]
- Xia, Y.; Chen, S.; Cui, J.; Wang, Y.; Liu, X.; Shen, Y.; Gong, L.; Jiang, X.; Wang, W.; Zhu, Y.; et al. Berberine suppresses bladder cancer cell proliferation by inhibiting JAK1-STAT3 signaling via upregulation of miR-17-5p. Biochem. Pharmacol. 2021, 188, 114575. [Google Scholar] [CrossRef]
- Bhanumathi, R.; Vimala, K.; Shanthi, K.; Thangaraj, R.; Kannan, S. Bioformulation of silver nanoparticles as berberine carrier cum anticancer agent against breast cancer. New J. Chem. 2017, 41, 14466–14477. [Google Scholar] [CrossRef]
- Liu, J.; Luo, X.; Guo, R.; Jing, W.; Lu, H. Cell Metabolomics Reveals Berberine-Inhibited Pancreatic Cancer Cell Viability and Metastasis by Regulating Citrate Metabolism. J. Proteome Res. 2020, 19, 3825–3836. [Google Scholar] [CrossRef]
- Sahibzada, M.U.K.; Sadiq, A.; Faidah, H.S.; Khurram, M.; Amin, M.U.; Haseeb, A.; Kakar, M. Berberine nanoparticles with enhanced in vitro bioavailability: Characterization and antimicrobial activity. Drug Des. Dev. Ther. 2018, 12, 303–312. [Google Scholar] [CrossRef]
- Schrauzer, G.N. Nutritional selenium supplements: Product types, quality, and safety. J. Am. Coll. Nutr. 2001, 20, 1–4. [Google Scholar] [CrossRef]
- Yazdi, M.H.; Mahdavi, M.; Setayesh, N.; Esfandyar, M.; Shahverdi, A.R. Selenium nanoparticle-enriched Lactobacillus brevis causes more efficient immune responses in vivo and reduces the liver metastasis in metastatic form of mouse breast cancer. DARU J. Pharm. Sci. 2013, 21, 33. [Google Scholar] [CrossRef] [PubMed]
- Mahrous, G.R.; Elkholy, N.S.; Safwat, G.; Shafaa, M.W. Enhanced cytotoxic activity of beta carotene conjugated liposomes towards breast cancer cell line: Comparative studies with cyclophosphamide. Anti-Cancer Drugs 2022, 33, e462–e476. [Google Scholar] [CrossRef]
- Kumar, P.; Nagarajan, A.; Uchil, P.D. Analysis of Cell Viability by the Lactate Dehydrogenase Assay. Cold Spring Harb. Protoc. 2018, 2018, 465–468. [Google Scholar] [CrossRef]
- Wang, L.; Liu, L.; Shi, Y.; Cao, H.; Chaturvedi, R.; Calcutt, M.W.; Hu, T.; Ren, X.; Wilson, K.T.; Polk, D.B. Berberine induces caspase-independent cell death in colon tumor cells through activation of apoptosis-inducing factor. PLoS ONE 2012, 7, e36418. [Google Scholar] [CrossRef] [PubMed]
- Yao, M.; Fan, X.; Yuan, B.; Takagi, N.; Liu, S.; Han, X.; Ren, J.; Liu, J. Berberine inhibits NLRP3 Inflammasome pathway in human triple-negative breast cancer MDA-MB-231 cell. BMC Complement. Altern. Med. 2019, 19, 216. [Google Scholar] [CrossRef]
- Yue, J.; Wang, Z.; Shao, D.; Chang, Z.; Hu, R.; Li, L.; Luo, S.Z.; Dong, W.F. Cancer cell membrane-modified biodegradable mesoporous silica nanocarriers for berberine therapy of liver cancer. RSC Adv. 2018, 8, 40288–40297. [Google Scholar] [CrossRef] [PubMed]
- Paudel, K.R.; Mehta, M.; Yin, G.H.S.; Yen, L.L.; Malyla, V.; Patel, V.K.; Panneerselvam, J.; Madheswaran, T.; MacLoughlin, R.; Jha, N.K.; et al. Berberine-loaded liquid crystalline nanoparticles inhibit non-small cell lung cancer proliferation and migration in vitro. Environ. Sci. Pollut. Res. Int. 2022, 29, 46830–46847. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Liu, F.; Jiang, S.; Liu, J.; Chen, X.; Zhang, S.; Zhao, H. Berberine hydrochloride inhibits cell proliferation and promotes apoptosis of non-small cell lung cancer via the suppression of the MMP2 and Bcl-2/Bax signaling pathways. Oncol. Lett. 2018, 15, 7409–7414. [Google Scholar] [CrossRef]
- James, M.A.; Fu, H.; Liu, Y.; Chen, D.R.; You, M. Dietary administration of berberine or Phellodendron amurense extract inhibits cell cycle progression and lung tumorigenesis. Mol. Carcinog. 2011, 50, 1–7. [Google Scholar] [CrossRef]
- Eo, S.H.; Kim, J.H.; Kim, S.J. Induction of G(2)/M Arrest by Berberine via Activation of PI3K/Akt and p38 in Human Chondrosarcoma Cell Line. Oncol. Res. Featur. Preclin. Clin. Cancer Ther. 2014, 22, 147–157. [Google Scholar] [CrossRef]
- Lin, Y.S.; Chiu, Y.C.; Tsai, Y.H.; Tsai, Y.F.; Wang, J.Y.; Tseng, L.M.; Chiu, J.H. Different mechanisms involved in the berberine-induced antiproliferation effects in triple-negative breast cancer cell lines. J. Cell. Biochem. 2019, 120, 13531–13544. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Zeng, J.; Guo, Q.; Pu, K.; Yang, Y.; Chen, N.; Zhang, G.; Zhao, M.; Zheng, Q.; Tang, J.; et al. Berberine Suppresses Stemness and Tumorigenicity of Colorectal Cancer Stem-Like Cells by Inhibiting m(6)A Methylation. Front. Oncol. 2021, 11, 775418. [Google Scholar] [CrossRef]
- Bhanumathi, R.; Manivannan, M.; Thangaraj, R.; Kannan, S. Drug-Carrying Capacity and Anticancer Effect of the Folic Acid- and Berberine-Loaded Silver Nanomaterial To Regulate the AKT-ERK Pathway in Breast Cancer. ACS Omega 2018, 3, 8317–8328. [Google Scholar] [CrossRef]
- Russwurm, S.; Stonans, I.; Stonane, E.; Weigand, G.; Wiederhold, M.; Jäger, L.; Reinhart, K. HepG2 hepatocytes express IFN-γ, TNF-α, TGF-β, M-CSF, oncostatin-M, ICAM-1, IL-4, IL-5, IL-7, IL-10, IL-11, IL-12 and IL-6 receptor genes in vitro. Crit. Care 1998, 2, P005. [Google Scholar] [CrossRef]
- Kokolakis, G.; Sabat, R.; Kruger-Krasagakis, S.; Eberle, J. Ambivalent Effects of Tumor Necrosis Factor Alpha on Apoptosis of Malignant and Normal Human Keratinocytes. Ski. Pharmacol. Physiol. 2021, 34, 94–102. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.N.; Lu, B.N.; Hu, M.M.; Xu, Y.W.; Han, X.; Qi, Y.; Peng, J.Y. Mechanisms involved in the cytotoxic effects of berberine on human colon cancer HCT-8 cells. Biocell 2012, 36, 113–120. [Google Scholar] [PubMed]
- Wang, X.N.; Han, X.; Xu, L.N.; Yin, L.H.; Xu, Y.W.; Qi, Y.; Peng, J.Y. Enhancement of apoptosis of human hepatocellular carcinoma SMMC-7721 cells through synergy of berberine and evodiamine. Phytomed. Int. J. Phytother. Phytopharm. 2008, 15, 1062–1068. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.S.; Li, Z.M.; Chen, Y.T.; Dai, S.J.; Zhou, X.J.; Yang, Y.X.; Lou, J.S.; Ji, L.T.; Bao, Y.T.; Xuan, L.; et al. Berberine Improves Inflammatory Responses of Diabetes Mellitus in Zucker Diabetic Fatty Rats and Insulin-Resistant HepG2 Cells through the PPM1B Pathway. J. Immunol. Res. 2020, 2020, 2141508. [Google Scholar] [CrossRef]
- Zou, K.; Li, Z.; Zhang, Y.; Zhang, H.Y.; Li, B.; Zhu, W.L.; Shi, J.Y.; Jia, Q.; Li, Y.M. Advances in the study of berberine and its derivatives: A focus on anti-inflammatory and anti-tumor effects in the digestive system. Acta Pharmacol. Sin. 2017, 38, 157–167. [Google Scholar] [CrossRef] [PubMed]
Group | Treatment Dose | Exposure Time |
---|---|---|
Group 1: Control | Vehicle | 24 h |
Group 2: Ber | 13 µg/mL | |
Group 3: Ber-AgNPs 1/3 IC50 | 0.4 µg/mL | |
Group 4: Ber-AgNPs 1/2 IC50 | 0.6 µg/mL | |
Group 5: Ber-SeNPs 1/3 IC50 | 0.013 µg/mL | |
Group 6: Ber-SeNPs 1/2 IC50 | 0.02 µg/mL | |
Group 7: CDDP | 0.17 µg/mL |
Gene | Accession Number | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|---|
Cyclin D1 | NM_053056.3 | GAGGCGGAGGAGAACAAACA | GGAGGGCGGATTGGAAATGA |
CDK2 | NM_001290230.2 | GACACGCTGCTGGATGTCA | GAGGGGAAGAGGAATGCCAG |
β-actin | NM_001101.5 | AGCCTCGCCTTTGCCG | CGCGGCGATATCATCATCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khaled, A.M.; Othman, M.S.; Obeidat, S.T.; Aleid, G.M.; Aboelnaga, S.M.; Fehaid, A.; Hathout, H.M.R.; Bakkar, A.A.; Moneim, A.E.A.; El-Garawani, I.M.; et al. Green-Synthesized Silver and Selenium Nanoparticles Using Berberine: A Comparative Assessment of In Vitro Anticancer Potential on Human Hepatocellular Carcinoma Cell Line (HepG2). Cells 2024, 13, 287. https://doi.org/10.3390/cells13030287
Khaled AM, Othman MS, Obeidat ST, Aleid GM, Aboelnaga SM, Fehaid A, Hathout HMR, Bakkar AA, Moneim AEA, El-Garawani IM, et al. Green-Synthesized Silver and Selenium Nanoparticles Using Berberine: A Comparative Assessment of In Vitro Anticancer Potential on Human Hepatocellular Carcinoma Cell Line (HepG2). Cells. 2024; 13(3):287. https://doi.org/10.3390/cells13030287
Chicago/Turabian StyleKhaled, Azza M., Mohamed S. Othman, Sofian T. Obeidat, Ghada M. Aleid, Shimaa M. Aboelnaga, Alaa Fehaid, Heba M. R. Hathout, Ashraf A. Bakkar, Ahmed E. Abdel Moneim, Islam M. El-Garawani, and et al. 2024. "Green-Synthesized Silver and Selenium Nanoparticles Using Berberine: A Comparative Assessment of In Vitro Anticancer Potential on Human Hepatocellular Carcinoma Cell Line (HepG2)" Cells 13, no. 3: 287. https://doi.org/10.3390/cells13030287
APA StyleKhaled, A. M., Othman, M. S., Obeidat, S. T., Aleid, G. M., Aboelnaga, S. M., Fehaid, A., Hathout, H. M. R., Bakkar, A. A., Moneim, A. E. A., El-Garawani, I. M., & Morsi, D. S. (2024). Green-Synthesized Silver and Selenium Nanoparticles Using Berberine: A Comparative Assessment of In Vitro Anticancer Potential on Human Hepatocellular Carcinoma Cell Line (HepG2). Cells, 13(3), 287. https://doi.org/10.3390/cells13030287