Adipose-Derived Stem Cells (ADSCs) Supplemented with Hepatocyte Growth Factor (HGF) Attenuate Hepatic Stellate Cell Activation and Liver Fibrosis by Inhibiting the TGF-β/Smad Signaling Pathway in Chemical-Induced Liver Fibrosis Associated with Diabetes
Abstract
1. Introduction
2. Materials and Methods
2.1. In Vitro Experiments
2.1.1. Cell Cultures and In Vitro Coculture Experimental Model
2.1.2. Immunofluorescence Staining (IF) of Fibrosis Markers
2.1.3. Gene Expression Evaluation by Real-Time PCR (qPCR)
2.2. In Vivo Experiments
2.2.1. Animals and In Vivo Experimental Design
2.2.2. Histology and Immunohistochemistry
2.2.3. Immunofluorescence
2.2.4. Transmission Electron Microscopy
2.2.5. Quantitative Real-Time PCR Analysis
2.2.6. Statistical Analysis
3. Results
3.1. Immunofluorescence Staining (IF) of Fibrosis Markers
3.2. Gene Expression Evaluation by Real-Time PCR (qPCR)
3.3. ADSC and HGF Cotreatment Inhibit Activation of Hepatic Stellate Cells (HSCs) in Fibrotic Livers of Diabetic Mice
3.4. ADSCs and HGF Suppress the Production of the Collagen in a Liver Fibrosis Model of Diabetic Mice
3.5. ADSC and HGF Cotreatment Downregulate TGF- β1/Smad Signaling in Fibrotic Livers of Diabetic Mice
3.6. ADSC and HGF Cotreatment Improve Liver Function and Morphology of Fibrotic Livers in Diabetic Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ADSCs | adipose-derived stem cells |
| Col I | collagen type I |
| DM | diabetes mellitus |
| ECM | extracellular matrix |
| EGF | epidermal growth factor |
| EVs | extracellular vesicles |
| HGF | hepatocyte growth factor |
| HSCs | hepatic stellate cells |
| LF | liver fibrosis |
| MMPs | metalloproteinases |
| MSCs | mesenchymal stem cells |
| SCs | stem cells |
| TGF-β | transforming growth factor β |
| TIMPs | tissue inhibitors of MMPs |
| VEGF | vascular endothelial growth factor |
| α-SMA | alpha-smooth muscle actin |
References
- Westman, E.C. Type 2 Diabetes Mellitus: A Pathophysiologic Perspective. Front. Nutr. 2021, 8, 707371. [Google Scholar] [CrossRef] [PubMed]
- Liao, N.; Zheng, Y.; Xie, H.; Zhao, B.; Zeng, Y.; Liu, X.; Liu, J. Adipose tissue-derived stem cells ameliorate hyperglycemia, insulin resistance and liver fibrosis in the type 2 diabetic rats. Stem Cell Res. Ther. 2017, 8, 286. [Google Scholar] [CrossRef] [PubMed]
- Elkrief, L.; Rautou, P.-E.; Sarin, S.; Valla, D.; Paradis, V.; Moreau, R. Diabetes mellitus in patients with cirrhosis: Clinical implications and management. Liver Int. 2016, 36, 936–948. [Google Scholar] [CrossRef] [PubMed]
- Thompson, A.J.; Patel, K. Antifibrotic Therapies: Will We Ever Get There? Curr. Gastroenterol. Rep. 2010, 12, 23–29. [Google Scholar] [CrossRef] [PubMed]
- El-serag, H.B.; Tran, T.; Everhart, J.E. Diabetes increases the risk of chronic liver disease and hepatocellular carcinoma. Gastroenterology 2004, 126, 460–468. [Google Scholar] [CrossRef]
- Hoffmann, C.; Djerir, N.E.H.; Danckaert, A.; Fernandes, J.; Roux, P.; Charrueau, C.; Lachagès, A.-M.; Charlotte, F.; Brocheriou, I.; Clément, K.; et al. Hepatic stellate cell hypertrophy is associated with metabolic liver fibrosis. Sci. Rep. 2020, 10, 3850. [Google Scholar] [CrossRef]
- Puche, J.E.; Saiman, Y.; Friedman, S.L. Hepatic Stellate Cells and Liver Fibrosis. In Comprehensive Physiology; Wiley: Hoboken, NJ, USA, 2013; pp. 1473–1492. [Google Scholar]
- Zhang, R.; Li, W.; Jiang, X.; Cui, X.; You, H.; Tang, Z.; Liu, W. Ferulic Acid Combined With Bone Marrow Mesenchymal Stem Cells Attenuates the Activation of Hepatic Stellate Cells and Alleviates Liver Fibrosis. Front. Pharmacol. 2022, 13, 863797. [Google Scholar] [CrossRef]
- Arthur, M.J.P. Fibrogenesis II. Metalloproteinases and their inhibitors in liver fibrosis. Am. J. Physiol. Liver Physiol. 2000, 279, G245–G249. [Google Scholar] [CrossRef]
- Hu, H.-H.; Chen, D.-Q.; Wang, Y.-N.; Feng, Y.-L.; Cao, G.; Vaziri, N.D.; Zhao, Y.-Y. New insights into TGF-β/Smad signaling in tissue fibrosis. Chem. Biol. Interact. 2018, 292, 76–83. [Google Scholar] [CrossRef]
- Paradis, V. High glucose and hyperinsulinemia stimulate connective tissue growth factor expression: A potential mechanism involved in progression to fibrosis in nonalcoholic steatohepatitis. Hepatology 2001, 34, 738–744. [Google Scholar] [CrossRef]
- Petta, S.; Camma, C.; Di Marco, V.; Alessi, N.; Cabibi, D.; Caldarella, R.; Licata, A.; Massenti, F.; Tarantino, G.; Marchesini, G.; et al. Insulin Resistance and Diabetes Increase Fibrosis in the Liver of Patients with Genotype 1 HCV Infection. Am. J. Gastroenterol. 2008, 103, 1136–1144. [Google Scholar] [CrossRef]
- Donath, M.Y.; Shoelson, S.E. Type 2 diabetes as an inflammatory disease. Nat. Rev. Immunol. 2011, 11, 98–107. [Google Scholar] [CrossRef]
- Schattenberg, J.M.; Schuchmann, M. Diabetes and apoptosis: Liver. Apoptosis 2009, 14, 1459–1471. [Google Scholar] [CrossRef]
- Malhi, H.; Guicciardi, M.E.; Gores, G.J. Hepatocyte Death: A Clear and Present Danger. Physiol. Rev. 2010, 90, 1165–1194. [Google Scholar] [CrossRef]
- Kitade, M.; Yoshiji, H.; Noguchi, R.; Ikenaka, Y.; Kaji, K.; Shirai, Y.; Yamazaki, M.; Uemura, M.; Yamao, J.; Fujimoto, M.; et al. Crosstalk between angiogenesis, cytokeratin-18, and insulinresistance in the progression of non-alcoholic steatohepatitis. World J. Gastroenterol. 2009, 15, 5193. [Google Scholar] [CrossRef]
- Costa, P.Z.; Soares, R. Neovascularization in diabetes and its complications. Unraveling the angiogenic paradox. Life Sci. 2013, 92, 1037–1045. [Google Scholar] [CrossRef]
- Nazarie, S.R.; Gharbia, S.; Hermenean, A.; Dinescu, S.; Costache, M. Regenerative Potential of Mesenchymal Stem Cells’ (MSCs) Secretome for Liver Fibrosis Therapies. Int. J. Mol. Sci. 2021, 22, 13292. [Google Scholar] [CrossRef]
- Zhu, M.; Hua, T.; Ouyang, T.; Qian, H.; Yu, B. Applications of Mesenchymal Stem Cells in Liver Fibrosis: Novel Strategies, Mechanisms, and Clinical Practice. Stem Cells Int. 2021, 2021, 1–17. [Google Scholar] [CrossRef]
- Hu, C.; Zhao, L.; Zhang, L.; Bao, Q.; Li, L. Mesenchymal stem cell-based cell-free strategies: Safe and effective treatments for liver injury. Stem Cell Res. Ther. 2020, 11, 377. [Google Scholar] [CrossRef]
- Kang, S.H.; Kim, M.Y.; Eom, Y.W.; Baik, S.K. Mesenchymal Stem Cells for the Treatment of Liver Disease: Present and Perspectives. Gut Liver 2020, 14, 306–315. [Google Scholar] [CrossRef]
- Dinescu, S.; Hermenean, A.; Costache, M. Human Adipose-Derived Stem Cells for Tissue Engineering Approaches: Current Challenges and Perspectives. In Stem Cells in Clinical Practice and Tissue Engineering; IntechOpen: London, UK, 2018. [Google Scholar]
- Vizoso, F.; Eiro, N.; Cid, S.; Schneider, J.; Perez-Fernandez, R. Mesenchymal Stem Cell Secretome: Toward Cell-Free Therapeutic Strategies in Regenerative Medicine. Int. J. Mol. Sci. 2017, 18, 1852. [Google Scholar] [CrossRef] [PubMed]
- Beer, L.; Mildner, M.; Ankersmit, H.J. Cell secretome based drug substances in regenerative medicine: When regulatory affairs meet basic science. Ann. Transl. Med. 2017, 5, 170. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Fu, Z.; Chen, Y.; Tang, N.; Wang, L.; Wang, F.; Sun, R.; Yan, S. Effects of autologous adipose-derived stem cell infusion on type 2 diabetic rats. Endocr. J. 2015, 62, 339–352. [Google Scholar] [CrossRef] [PubMed]
- Xie, M.; Hao, H.J.; Cheng, Y.; Xie, Z.Y.; Yin, Y.Q.; Zhang, Q.; Gao, J.Q.; Liu, H.Y.; Mu, Y.M.; Han, W.D. Adipose-derived mesenchymal stem cells ameliorate hyperglycemia through regulating hepatic glucose metabolism in type 2 diabetic rats. Biochem. Biophys. Res. Commun. 2017, 483, 435–441. [Google Scholar] [CrossRef] [PubMed]
- Acharya, P.; Chouhan, K.; Weiskirchen, S.; Weiskirchen, R. Cellular Mechanisms of Liver Fibrosis. Front. Pharmacol. 2021, 12, 671640. [Google Scholar] [CrossRef]
- Klaunig, J.E.; Li, X.; Wang, Z. Role of xenobiotics in the induction and progression of fatty liver disease. Toxicol. Res. 2018, 7, 664–680. [Google Scholar] [CrossRef]
- Massart, J.; Begriche, K.; Corlu, A.; Fromenty, B. Xenobiotic-Induced Aggravation of Metabolic-Associated Fatty Liver Disease. Int. J. Mol. Sci. 2022, 23, 1062. [Google Scholar] [CrossRef]
- Rehman, J.; Traktuev, D.; Li, J.; Merfeld-Clauss, S.; Temm-Grove, C.J.; Bovenkerk, J.E.; Pell, C.L.; Johnstone, B.H.; Considine, R.V.; March, K.L. Secretion of Angiogenic and Antiapoptotic Factors by Human Adipose Stromal Cells. Circulation 2004, 109, 1292–1298. [Google Scholar] [CrossRef]
- Nakagami, H.; Maeda, K.; Morishita, R.; Iguchi, S.; Nishikawa, T.; Takami, Y.; Kikuchi, Y.; Saito, Y.; Tamai, K.; Ogihara, T.; et al. Novel Autologous Cell Therapy in Ischemic Limb Disease through Growth Factor Secretion by Cultured Adipose Tissue–Derived Stromal Cells. Arterioscler. Thromb. Vasc. Biol. 2005, 25, 2542–2547. [Google Scholar] [CrossRef]
- Son, G.; Hines, I.N.; Lindquist, J.; Schrum, L.W.; Rippe, R.A. Inhibition of phosphatidylinositol 3-kinase signaling in hepatic stellate cells blocks the progression of hepatic fibrosis. Hepatology 2009, 50, 1512–1523. [Google Scholar] [CrossRef]
- Sato, M.; Kakubari, M.; Kawamura, M.; Sugimoto, J.; Matsumoto, K.; Ishii, T. The decrease in total collagen fibers in the liver by hepatocyte growth factor after formation of cirrhosis induced by thioacetamide. Biochem. Pharmacol. 2000, 59, 681–690. [Google Scholar] [CrossRef]
- He, F.; Wu, L.-X.; Shu, K.-X.; Liu, F.-Y.; Yang, L.-J.; Zhou, X.; Zhang, Y.; Huang, B.-S.; Huang, D.; Deng, X.-L. HGF protects cultured cortical neurons against hypoxia/reoxygenation induced cell injury via ERK1/2 and PI-3K/Akt pathways. Colloids Surf. B Biointerfaces 2008, 61, 290–297. [Google Scholar] [CrossRef]
- Zhu, X.-Y.; Zhang, X.-Z.; Xu, L.; Zhong, X.-Y.; Ding, Q.; Chen, Y.-X. Transplantation of adipose-derived stem cells overexpressing hHGF into cardiac tissue. Biochem. Biophys. Res. Commun. 2009, 379, 1084–1090. [Google Scholar] [CrossRef]
- Cai, L.; Johnstone, B.H.; Cook, T.G.; Liang, Z.; Traktuev, D.; Cornetta, K.; Ingram, D.A.; Rosen, E.D.; March, K.L. Suppression of Hepatocyte Growth Factor Production Impairs the Ability of Adipose-Derived Stem Cells to Promote Ischemic Tissue Revascularization. Stem Cells 2007, 25, 3234–3243. [Google Scholar] [CrossRef]
- Zhang, J.; Zhou, S.; Zhou, Y.; Feng, F.; Wang, Q.; Zhu, X.; Ai, H.; Huang, X.; Zhang, X. Hepatocyte Growth Factor Gene-Modified Adipose-Derived Mesenchymal Stem Cells Ameliorate Radiation Induced Liver Damage in a Rat Model. PLoS ONE 2014, 9, e114670. [Google Scholar] [CrossRef]
- Xia, J.-L.; Dai, C.; Michalopoulos, G.K.; Liu, Y. Hepatocyte Growth Factor Attenuates Liver Fibrosis Induced by Bile Duct Ligation. Am. J. Pathol. 2006, 168, 1500–1512. [Google Scholar] [CrossRef]
- Tahara, M.; Matsumoto, K.; Nukiwa, T.; Nakamura, T. Hepatocyte growth factor leads to recovery from alcohol-induced fatty liver in rats. J. Clin. Investig. 1999, 103, 313–320. [Google Scholar] [CrossRef]
- Xu, L. Human hepatic stellate cell lines, LX-1 and LX-2: New tools for analysis of hepatic fibrosis. Gut 2005, 54, 142–151. [Google Scholar] [CrossRef]
- Ignat, S.-R.; Dinescu, S.; Váradi, J.; Fenyvesi, F.; Nguyen, T.L.P.; Ciceu, A.; Hermenean, A.; Costache, M. Complexation with Random Methyl-β-Cyclodextrin and (2-Hydroxypropyl)-β-Cyclodextrin Promotes Chrysin Effect and Potential for Liver Fibrosis Therapy. Materials 2020, 13, 5003. [Google Scholar] [CrossRef]
- Yu, Q.; Cheng, P.; Wu, J.; Guo, C. PPARγ/NF-κB and TGF-β1/Smad pathway are involved in the anti-fibrotic effects of levo-tetrahydropalmatine on liver fibrosis. J. Cell. Mol. Med. 2021, 25, 1645–1660. [Google Scholar] [CrossRef]
- Ozaki, I.; Zhao, G.; Mizuta, T.; Ogawa, Y.; Hara, T.; Kajihara, S.; Hisatomi, A.; Sakai, T.; Yamamoto, K. Hepatocyte growth factor induces collagenase (matrix metalloproteinase-1) via the transcription factor Ets-1 in human hepatic stellate cell line. J. Hepatol. 2002, 36, 169–178. [Google Scholar] [CrossRef]
- Platania, C.B.M.; Maisto, R.; Trotta, M.C.; D’Amico, M.; Rossi, S.; Gesualdo, C.; D’Amico, G.; Balta, C.; Herman, H.; Hermenean, A.; et al. Retinal and circulating miRNA expression patterns in diabetic retinopathy: An in silico and in vivo approach. Br. J. Pharmacol. 2019, 176, 2179–2194. [Google Scholar] [CrossRef] [PubMed]
- Gharbia, S.; Balta, C.; Herman, H.; Rosu, M.; Váradi, J.; Bácskay, I.; Vecsernyés, M.; Gyöngyösi, S.; Fenyvesi, F.; Voicu, S.N.; et al. Enhancement of Silymarin Anti-fibrotic Effects by Complexation With Hydroxypropyl (HPBCD) and Randomly Methylated (RAMEB) β-Cyclodextrins in a Mouse Model of Liver Fibrosis. Front. Pharmacol. 2018, 9, 883. [Google Scholar] [CrossRef] [PubMed]
- Matsuda, Y.; Matsumoto, K.; Nakamura, T.; Ichida, T. Hepatocyte Growth Factor Suppresses the Onset of Liver Cirrhosis and Abrogates Lethal Hepatic Dysfunction in Rats. J. Biochem. 1995, 118, 643–649. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Yu, F.; Ji, S.; Su, L.; Wan, L.; Zhang, S.; Dai, C.; Wang, Y.; Fu, J.; Zhang, Q. Adipose-derived mesenchymal stem cells inhibit activation of hepatic stellate cells in vitro and ameliorate rat liver fibrosis In Vivo. J. Formos. Med. Assoc. 2015, 114, 130–138. [Google Scholar] [CrossRef]
- Abdel-Moneim, A.M.; Al-Kahtani, M.A.; El-Kersh, M.A.; Al-Omair, M.A. Free Radical-Scavenging, Anti-Inflammatory/Anti-Fibrotic and Hepatoprotective Actions of Taurine and Silymarin against CCl4 Induced Rat Liver Damage. PLoS ONE 2015, 10, e0144509. [Google Scholar] [CrossRef]
- Shao, C.; Chen, S.; Dong, T.; Chai, H.; Yu, Y.; Deng, L.; Wang, Y.; Cheng, F. Transplantation of bone marrow—Derived mesenchymal stem cells after regional hepatic irradiation ameliorates thioacetamide-induced liver fibrosis in rats. J. Surg. Res. 2014, 186, 408–416. [Google Scholar] [CrossRef]
- Tacke, F.; Trautwein, C. Mechanisms of liver fibrosis resolution. J. Hepatol. 2015, 63, 1038–1039. [Google Scholar] [CrossRef]
- Lee, Y.A.; Wallace, M.C.; Friedman, S.L. Pathobiology of liver fibrosis: A translational success story. Gut 2015, 64, 830–841. [Google Scholar] [CrossRef]
- Zhao, Y.; Ye, W.; Wang, Y.-D.; Chen, W.-D. HGF/c-Met: A Key Promoter in Liver Regeneration. Front. Pharmacol. 2022, 13, 808855. [Google Scholar] [CrossRef]
- Forte, G.; Minieri, M.; Cossa, P.; Antenucci, D.; Sala, M.; Gnocchi, V.; Fiaccavento, R.; Carotenuto, F.; De Vito, P.; Baldini, P.M.; et al. Hepatocyte Growth Factor Effects on Mesenchymal Stem Cells: Proliferation, Migration, and Differentiation. Stem Cells 2006, 24, 23–33. [Google Scholar] [CrossRef]
- Kao, Y.-H.; Lin, Y.-C.; Lee, P.-H.; Lin, C.-W.; Chen, P.-H.; Tai, T.-S.; Chang, Y.-C.; Chou, M.-H.; Chang, C.-Y.; Sun, C.-K. Infusion of Human Mesenchymal Stem Cells Improves Regenerative Niche in Thioacetamide-Injured Mouse Liver. Tissue Eng. Regen. Med. 2020, 17, 671–682. [Google Scholar] [CrossRef]
- Chen, L.; Zhang, C.; Chen, L.; Wang, X.; Xiang, B.; Wu, X.; Guo, Y.; Mou, X.; Yuan, L.; Chen, B.; et al. Human Menstrual Blood-Derived Stem Cells Ameliorate Liver Fibrosis in Mice by Targeting Hepatic Stellate Cells via Paracrine Mediators. Stem Cells Transl. Med. 2017, 6, 272–284. [Google Scholar] [CrossRef]
- Abdelgwad, M.; Ewaiss, M.; Sabry, D.; Khalifa, W.A.; Altaib, Z.M.; Alhelf, M. Comparative study on effect of mesenchymal stem cells and endothelial progenitor cells on treatment of experimental CCL4-induced liver fibrosis. Arch. Physiol. Biochem. 2022, 128, 1071–1080. [Google Scholar] [CrossRef]
- Ma, J.; Yan, X.; Lin, Y.; Tan, Q. Hepatocyte Growth Factor Secreted from Human Adipose-Derived Stem Cells Inhibits Fibrosis in Hypertrophic Scar Fibroblasts. Curr. Mol. Med. 2020, 20, 558–571. [Google Scholar] [CrossRef]









| Target | Sense | Antisense |
|---|---|---|
| TGF-β1 | 5′ TTTGGAGCCTGGACACACAGTACi 3′ | 5′ TGTGTTGGTTGTAGAGGGCAAGGA 3′ |
| α-SMA | 5′ CCGACCGAATGCAGAAG GA 3′ | 5′ ACAGAGTATTTGCGCTCCGAA 3′ |
| Smad 2 | 5′ GTTCCTGCCTTTGCTGAGAC 3′ | 5′ TCTCTTTGCCAGGAATGCTT 3′ |
| Smad 3 | 5′ TGCTGGTGACTGGATAGCAG 3′ | 5′ CTCCTTGGAAGGTGCTGAAG 3′ |
| Smad 7 | 5′ GCTCACGCACTCGGTGCTCA 3′ | 5′ CCAGGCTCCAGAAGAAGTTG 3′ |
| Col I | 5′ CAGCCGCTTCACCTACAGC 3′ | 5′ TTTTGTATTCAATCACTGTCTTGCC 3′ |
| GAPDH | 5′ CGACTTCAACAGCAACTCCCACTCTTCC-3′ | 5′ TGGGTGGTCCAGGGTTTCTTACTCCTT 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gharbia, S.; Nazarie, S.-R.; Dinescu, S.; Balta, C.; Herman, H.; Peteu, V.E.; Gherghiceanu, M.; Hermenean, A.; Costache, M. Adipose-Derived Stem Cells (ADSCs) Supplemented with Hepatocyte Growth Factor (HGF) Attenuate Hepatic Stellate Cell Activation and Liver Fibrosis by Inhibiting the TGF-β/Smad Signaling Pathway in Chemical-Induced Liver Fibrosis Associated with Diabetes. Cells 2022, 11, 3338. https://doi.org/10.3390/cells11213338
Gharbia S, Nazarie S-R, Dinescu S, Balta C, Herman H, Peteu VE, Gherghiceanu M, Hermenean A, Costache M. Adipose-Derived Stem Cells (ADSCs) Supplemented with Hepatocyte Growth Factor (HGF) Attenuate Hepatic Stellate Cell Activation and Liver Fibrosis by Inhibiting the TGF-β/Smad Signaling Pathway in Chemical-Induced Liver Fibrosis Associated with Diabetes. Cells. 2022; 11(21):3338. https://doi.org/10.3390/cells11213338
Chicago/Turabian StyleGharbia, Sami, Simona-Rebeca Nazarie, Sorina Dinescu, Cornel Balta, Hildegard Herman, Victor Eduard Peteu, Mihaela Gherghiceanu, Anca Hermenean, and Marieta Costache. 2022. "Adipose-Derived Stem Cells (ADSCs) Supplemented with Hepatocyte Growth Factor (HGF) Attenuate Hepatic Stellate Cell Activation and Liver Fibrosis by Inhibiting the TGF-β/Smad Signaling Pathway in Chemical-Induced Liver Fibrosis Associated with Diabetes" Cells 11, no. 21: 3338. https://doi.org/10.3390/cells11213338
APA StyleGharbia, S., Nazarie, S.-R., Dinescu, S., Balta, C., Herman, H., Peteu, V. E., Gherghiceanu, M., Hermenean, A., & Costache, M. (2022). Adipose-Derived Stem Cells (ADSCs) Supplemented with Hepatocyte Growth Factor (HGF) Attenuate Hepatic Stellate Cell Activation and Liver Fibrosis by Inhibiting the TGF-β/Smad Signaling Pathway in Chemical-Induced Liver Fibrosis Associated with Diabetes. Cells, 11(21), 3338. https://doi.org/10.3390/cells11213338

