The Lysine Methylase SMYD3 Modulates Mesendodermal Commitment during Development
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Cultures
2.2. In Vitro Differentiation of ES Cells
2.3. Zebrafish Lines and Maintenance
2.4. Whole Mount In Situ Hybridization, Embryo Sectioning and Imaging
2.5. Morpholino Microinjection
2.6. Virus Production and Plasmids
2.7. Reverse Transcriptase PCR and Real-Time PCR
2.8. Protein Extracts
2.9. Immunofluorescence Analysis
2.10. Statistical Analysis
3. Results
3.1. SMYD3 Is Expressed in the Developing Mouse Embryo and in Embryonic Stem Cells
3.2. SMYD3 Depletion Does Not Affect Stemness
3.3. SMYD3 Depletion Accelerates Mesendoderm Marker Expression in mESCs
3.4. smyd3 Knockdown Promotes Mesendodermal Fate during Zebrafish Gastrulation
3.5. SMYD3 Knockdown Influences Later Stages of Differentiation
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Fisher, C.L.; Fisher, A.G. Chromatin states in pluripotent, differentiated, and reprogrammed cells. Curr. Opin. Genet. Dev. 2011, 21, 140–146. [Google Scholar] [CrossRef] [PubMed]
- Ong, C.-T.; Corces, V.G. Enhancer function: New insights into the regulation of tissue-specific gene expression. Nat. Rev. Genet. 2011, 12, 283–293. [Google Scholar] [CrossRef] [PubMed]
- Young, R.A. Control of the Embryonic Stem Cell State. Cell 2011, 144, 940–954. [Google Scholar] [CrossRef] [PubMed]
- Orkin, S.H.; Hochedlinger, K. Chromatin Connections to Pluripotency and Cellular Reprogramming. Cell 2011, 145, 835–850. [Google Scholar] [CrossRef]
- Delmore, J.E.; Issa, G.C.; Lemieux, M.E.; Rahl, P.B.; Shi, J.; Jacobs, H.M.; Kastritis, E.; Gilpatrick, T.; Paranal, R.M.; Qi, J.; et al. BET Bromodomain Inhibition as a Therapeutic Strategy to Target c-Myc. Cell 2011, 146, 904–917. [Google Scholar] [CrossRef]
- Li, X.; Li, L.; Pandey, R.; Byun, J.S.; Gardner, K.; Qin, Z.; Dou, Y. The Histone Acetyltransferase MOF Is a Key Regulator of the Embryonic Stem Cell Core Transcriptional Network. Cell Stem Cell 2012, 11, 163–178. [Google Scholar] [CrossRef]
- Ohtani, K.; Zhao, C.; Dobreva, G.; Manavski, Y.; Kluge, B.; Braun, T.; Rieger, M.A.; Zeiher, A.M.; Dimmeler, S. Jmjd3 Controls Mesodermal and Cardiovascular Differentiation of Embryonic Stem Cells. Circ. Res. 2013, 113, 856–862. [Google Scholar] [CrossRef]
- Ding, J.; Xu, H.; Faiola, F.; Ma’Ayan, A.; Wang, J. Oct4 links multiple epigenetic pathways to the pluripotency network. Cell Res. 2011, 22, 155–167. [Google Scholar] [CrossRef]
- Boyer, L.A.; Lee, T.I.; Cole, M.F.; Johnstone, S.E.; Levine, S.S.; Zucker, J.P.; Guenther, M.G.; Kumar, R.M.; Murray, H.L.; Jenner, R.G.; et al. Core Transcriptional Regulatory Circuitry in Human Embryonic Stem Cells. Cell 2005, 122, 947–956. [Google Scholar] [CrossRef] [PubMed]
- Campbell, P.A.; Perez-Iratxeta, C.; Andrade-Navarro, M.A.; Rudnicki, M.A. Oct4 Targets Regulatory Nodes to Modulate Stem Cell Function. PLoS ONE 2007, 2, e553. [Google Scholar] [CrossRef]
- Chen, X.; Xu, H.; Yuan, P.; Fang, F.; Huss, M.; Vega, V.B.; Wong, E.; Orlov, Y.L.; Zhang, W.; Jiang, J.; et al. Integration of External Signaling Pathways with the Core Transcriptional Network in Embryonic Stem Cells. Cell 2008, 133, 1106–1117. [Google Scholar] [CrossRef]
- Tracy, C.M.; Warren, J.S.; Szulik, M.; Wang, L.; Garcia, J.; Makaju, A.; Russell, K.; Miller, M.; Franklin, S. The Smyd family of methyltransferases: Role in cardiac and skeletal muscle physiology and pathology. Curr. Opin. Physiol. 2018, 1, 140–152. [Google Scholar] [CrossRef] [PubMed]
- Du, S.J.; Tan, X.; Zhang, J. SMYD Proteins: Key Regulators in Skeletal and Cardiac Muscle Development and Function. Anat. Rec. Adv. Integr. Anat. Evol. Biol. 2014, 297, 1650–1662. [Google Scholar] [CrossRef] [PubMed]
- Gottlieb, P.D.; Pierce, S.A.; Sims, R.J.; Yamagishi, H.; Weihe, E.K.; Harriss, J.V.; Maika, S.D.; Kuziel, W.A.; King, H.L.; Olson, E.N.; et al. Bop encodes a muscle-restricted protein containing MYND and SET domains and is essential for cardiac differentiation and morphogenesis. Nat. Genet. 2002, 31, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.-J.; Xu, P.-F.; Zhou, T.; Hu, M.; Fu, C.-T.; Zhang, Y.; Jin, Y.; Chen, Y.; Chen, S.-J.; Huang, Q.-H.; et al. Genome-Wide Survey and Developmental Expression Mapping of Zebrafish SET Domain-Containing Genes. PLoS ONE 2008, 3, e1499. [Google Scholar] [CrossRef] [PubMed]
- Thompson, E.C.; Travers, A.A. A Drosophila Smyd4 Homologue Is a Muscle-Specific Transcriptional Modulator Involved in Development. PLoS ONE 2008, 3, e3008. [Google Scholar] [CrossRef]
- Nagandla, H.; Lopez, S.; Yu, W.; Rasmussen, T.L.; Tucker, H.O.; Schwartz, R.J.; Stewart, M.D. Defective myogenesis in the absence of the muscle-specific lysine methyltransferase SMYD1. Dev. Biol. 2016, 410, 86–97. [Google Scholar] [CrossRef]
- Tan, X.; Rotllant, J.; Li, H.; De Deyne, P.; Du, S.J. SmyD1, a histone methyltransferase, is required for myofibril organization and muscle contraction in zebrafish embryos. Proc. Natl. Acad. Sci. USA 2006, 103, 2713–2718. [Google Scholar] [CrossRef] [PubMed]
- Cai, M.; Han, L.; Liu, L.; He, F.; Chu, W.; Zhang, J.; Tian, Z.; Du, S. Defective sarcomere assembly in smyd1a and smyd1b zebrafish mutants. Faseb J. 2019, 33, 6209–6225. [Google Scholar] [CrossRef]
- Just, S.; Meder, B.; Berger, I.M.; Etard, C.; Trano, N.; Patzel, E.; Hassel, D.; Marquart, S.; Dahme, T.; Vogel, B.; et al. The myosin-interacting protein SMYD1 is essential for sarcomere organization. J. Cell Sci. 2011, 124, 3127–3136. [Google Scholar] [CrossRef]
- Voelkel, T.; Andresen, C.; Unger, A.; Just, S.; Rottbauer, W.; Linke, W.A. Lysine methyltransferase Smyd2 regulates Hsp90-mediated protection of the sarcomeric titin springs and cardiac function. Biochim. Biophys. Acta Bioenerg. 2013, 1833, 812–822. [Google Scholar] [CrossRef]
- Sesé, B.; Barrero, M.; Fabregat, M.-C.; Sander, V.; Belmonte, J.C.I. SMYD2 is induced during cell differentiation and participates in early development. Int. J. Dev. Biol. 2013, 57, 357–364. [Google Scholar] [CrossRef]
- Bai, H.-J.; Zhang, P.; Ma, L.; Liang, H.; Wei, G.; Yang, H.-T. SMYD2 Drives Mesendodermal Differentiation of Human Embryonic Stem Cells Through Mediating the Transcriptional Activation of Key Mesendodermal Genes. Stem Cells 2019, 37, 1401–1415. [Google Scholar] [CrossRef]
- Kidder, B.L.; He, R.; Wangsa, D.; Padilla-Nash, H.M.; Bernardo, M.M.; Sheng, S.; Ried, T.; Zhao, K. SMYD5 Controls Heterochromatin and Chromosome Integrity during Embryonic Stem Cell Differentiation. Cancer Res. 2017, 77, 6729–6745. [Google Scholar] [CrossRef]
- Fujii, T.; Tsunesumi, S.-I.; Sagara, H.; Munakata, M.; Hisaki, Y.; Sekiya, T.; Furukawa, Y.; Sakamoto, K.; Watanabe, S. Smyd5 plays pivotal roles in both primitive and definitive hematopoiesis during zebrafish embryogenesis. Sci. Rep. 2016, 6, 29157. [Google Scholar] [CrossRef] [PubMed]
- Hamamoto, R.; Furukawa, Y.; Morita, M.; Iimura, Y.; Silva, F.P.; Li, M.; Yagyu, R.; Nakamura, Y. SMYD3 encodes a histone methyltransferase involved in the proliferation of cancer cells. Nat. Cell Biol. 2004, 6, 731–740. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.-N.; Wang, S.-Z.; Yang, J.-S.; Luo, X.-G.; Xie, J.-H.; Xi, T. Knockdown of SMYD3 by RNA interference down-regulates c-Met expression and inhibits cells migration and invasion induced by HGF. Cancer Lett. 2009, 280, 78–85. [Google Scholar] [CrossRef] [PubMed]
- Fenizia, C.; Bottino, C.; Corbetta, S.; Fittipaldi, R.; Floris, P.; Gaudenzi, G.; Carra, S.; Cotelli, F.; Vitale, G.; Caretti, G. SMYD3 promotes the epithelial–mesenchymal transition in breast cancer. Nucleic Acids Res. 2019, 47, 1278–1293. [Google Scholar] [CrossRef] [PubMed]
- Peserico, A.; Germani, A.; Sanese, P.; Barbosa, A.J.; Di Virgilio, V.; Fittipaldi, R.; Fabini, E.; Bertucci, C.; Varchi, G.; Moyer, M.P.; et al. A SMYD3 Small-Molecule Inhibitor Impairing Cancer Cell Growth. J. Cell. Physiol. 2015, 230, 2447–2460. [Google Scholar] [CrossRef]
- Sanese, P.; Fasano, C.; Buscemi, G.; Bottino, C.; Corbetta, S.; Fabini, E.; Silvestri, V.; Valentini, V.; Disciglio, V.; Forte, G.; et al. Targeting SMYD3 to Sensitize Homologous Recombination-Proficient Tumors to PARP-Mediated Synthetic Lethality. iScience 2020, 23, 101604. [Google Scholar] [CrossRef]
- Luo, X.-G.; Zhang, C.-L.; Zhao, W.-W.; Liu, Z.-P.; Liu, L.; Mu, A.; Guo, S.; Wang, N.; Zhou, H.; Zhang, T.-C. Histone methyltransferase SMYD3 promotes MRTF-A-mediated transactivation of MYL9 and migration of MCF-7 breast cancer cells. Cancer Lett. 2014, 344, 129–137. [Google Scholar] [CrossRef]
- Cock-Rada, A.M.; Medjkane, S.; Janski, N.; Yousfi, N.; Perichon, M.; Chaussepied, M.; Chluba, J.; Langsley, G.; Weitzman, J.B. SMYD3 Promotes Cancer Invasion by Epigenetic Upregulation of the Metalloproteinase MMP-9. Cancer Res. 2012, 72, 810–820. [Google Scholar] [CrossRef]
- Fujii, T.; Tsunesumi, S.-I.; Yamaguchi, K.; Watanabe, S.; Furukawa, Y. Smyd3 Is Required for the Development of Cardiac and Skeletal Muscle in Zebrafish. PLoS ONE 2011, 6, e23491. [Google Scholar] [CrossRef]
- Codato, R.; Perichon, M.; Divol, A.; Fung, E.; Sotiropoulos, A.; Bigot, A.; Weitzman, J.B.; Medjkane, S. The SMYD3 methyltransferase promotes myogenesis by activating the myogenin regulatory network. Sci. Rep. 2019, 9, 1–14. [Google Scholar] [CrossRef]
- Proserpio, V.; Fittipaldi, R.; Ryall, J.G.; Sartorelli, V.; Caretti, G. The methyltransferase SMYD3 mediates the recruitment of transcriptional cofactors at the myostatin and c-Met genes and regulates skeletal muscle atrophy. Genes Dev. 2013, 27, 1299–1312. [Google Scholar] [CrossRef]
- Kim, J.-D.; Kim, E.; Koun, S.; Ham, H.-J.; Rhee, M.; Kim, M.-J.; Huh, A.T.-L. Proper Activity of Histone H3 Lysine 4 (H3K4) Methyltransferase Is Required for Morphogenesis during Zebrafish Cardiogenesis. Mol. Cells 2015, 38, 580–586. [Google Scholar] [CrossRef]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef] [PubMed]
- Thisse, C.; Thisse, B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 2007, 3, 59–69. [Google Scholar] [CrossRef]
- Nasevicius, A.; Ekker, S.C. Effective targeted gene ‘knockdown’ in zebrafish. Nat. Genet. 2000, 26, 216–220. [Google Scholar] [CrossRef] [PubMed]
- Kita-Matsuo, H.; Barcova, M.; Prigozhina, N.; Salomonis, N.; Wei, K.; Jacot, J.; Nelson, B.; Spiering, S.; Haverslag, R.; Kim, C.; et al. Lentiviral Vectors and Protocols for Creation of Stable hESC Lines for Fluorescent Tracking and Drug Resistance Selection of Cardiomyocytes. PLoS ONE 2009, 4, e5046. [Google Scholar] [CrossRef] [PubMed]
- Segatto, M.; Fittipaldi, R.; Pin, F.; Sartori, R.; Ko, K.D.; Zare, H.; Fenizia, C.; Zanchettin, G.; Pierobon, E.S.; Hatakeyama, S.; et al. Epigenetic targeting of bromodomain protein BRD4 counteracts cancer cachexia and prolongs survival. Nat. Commun. 2017, 8, 1–16. [Google Scholar] [CrossRef]
- Jia, S.; Ivanov, A.; Blasevic, D.; Müller, T.; Purfürst, B.; Sun, W.; Chen, W.; Poy, M.N.; Rajewsky, N.; Birchmeier, C. Insm1 cooperates with N eurod1 and F oxa2 to maintain mature pancreatic β-cell function. Embo J. 2015, 34, 1417–1433. [Google Scholar] [CrossRef] [PubMed]
- Hackett, J.A.; Kobayashi, T.; Dietmann, S.; Surani, M.A. Activation of Lineage Regulators and Transposable Elements across a Pluripotent Spectrum. Stem Cell Rep. 2017, 8, 1645–1658. [Google Scholar] [CrossRef] [PubMed]
- Hart, D.O.; Santra, M.K.; Raha, T.; Green, M.R. Selective interaction between Trf3 and Taf3 required for early development and hematopoiesis. Dev. Dyn. 2009, 238, 2540–2549. [Google Scholar] [CrossRef] [PubMed]
- Lehmann, M.; Nguemo, F.; Wagh, V.; Pfannkuche, K.; Hescheler, J.; Reppel, M. Evidence for a Critical Role of Catecholamines for Cardiomyocyte Lineage Commitment in Murine Embryonic Stem Cells. PLoS ONE 2013, 8, e70913. [Google Scholar] [CrossRef][Green Version]
- Tadaishi, M.; Miura, S.; Kai, Y.; Kano, Y.; Oishi, Y.; Ezaki, O. Skeletal Muscle-Specific Expression of PGC-1α-b, an Exercise-Responsive Isoform, Increases Exercise Capacity and Peak Oxygen Uptake. PLoS ONE 2011, 6, e28290. [Google Scholar] [CrossRef]
- Vargel, Ö.; Zhang, Y.; Kosim, K.; Ganter, K.; Foehr, S.; Mardenborough, Y.; Shvartsman, M.; Enright, A.J.; Krijgsveld, J.; Lancrin, C. Activation of the TGFβ pathway impairs endothelial to haematopoietic transition. Sci. Rep. 2016, 6, 21518. [Google Scholar] [CrossRef]
- Grote, P.; Wittler, L.; Hendrix, D.; Koch, F.; Währisch, S.; Beisaw, A.; Macura, K.; Bläss, G.; Kellis, M.; Werber, M.; et al. The Tissue-Specific lncRNA Fendrr Is an Essential Regulator of Heart and Body Wall Development in the Mouse. Dev. Cell 2013, 24, 206–214. [Google Scholar] [CrossRef] [PubMed]
- Segatto, M.; Szokoll, R.; Fittipaldi, R.; Bottino, C.; Nevi, L.; Mamchaoui, K.; Filippakopoulos, P.; Caretti, G. BETs inhibition attenuates oxidative stress and preserves muscle integrity in Duchenne muscular dystrophy. Nat. Commun. 2020, 11, 1–13. [Google Scholar] [CrossRef]
- Toyooka, Y.; Shimosato, D.; Murakami, K.; Takahashi, K.; Niwa, H. Identification and characterization of subpopulations in undifferentiated ES cell culture. Development 2008, 135, 909–918. [Google Scholar] [CrossRef]
- Méndez, J.; Stillman, B. Chromatin Association of Human Origin Recognition Complex, Cdc6, and Minichromosome Maintenance Proteins during the Cell Cycle: Assembly of Prereplication Complexes in Late Mitosis. Mol. Cell. Biol. 2000, 20, 8602–8612. [Google Scholar] [CrossRef] [PubMed]
- Giakountis, A.; Moulos, P.; Sarris, M.E.; Hatzis, P.; Talianidis, I. Smyd3-associated regulatory pathways in cancer. Semin. Cancer Biol. 2017, 42, 70–80. [Google Scholar] [CrossRef] [PubMed]
- Sarris, M.E.; Moulos, P.; Haroniti, A.; Giakountis, A.; Talianidis, I. Smyd3 Is a Transcriptional Potentiator of Multiple Cancer-Promoting Genes and Required for Liver and Colon Cancer Development. Cancer Cell 2016, 29, 354–366. [Google Scholar] [CrossRef]
- Tosic, J.; Kim, G.-J.; Pavlovic, M.; Schröder, C.M.; Mersiowsky, S.-L.; Barg, M.; Hofherr, A.; Probst, S.; Köttgen, M.; Hein, L.; et al. Eomes and Brachyury control pluripotency exit and germ-layer segregation by changing the chromatin state. Nat. Cell Biol. 2019, 21, 1518–1531. [Google Scholar] [CrossRef]
- Mazur, P.K.; Reynoird, N.; Khatri, P.; Jansen, P.W.T.C.; Wilkinson, A.W.; Liu, S.; Barbash, O.; Van Aller, G.S.; Huddleston, M.J.; Dhanak, D.; et al. SMYD3 links lysine methylation of MAP3K2 to Ras-driven cancer. Nat. Cell Biol. 2014, 510, 283–287. [Google Scholar] [CrossRef]
- Willems, E.; Leyns, L. Patterning of mouse embryonic stem cell-derived pan-mesoderm by Activin A/Nodal and Bmp4 signaling requires Fibroblast Growth Factor activity. Differentiation 2008, 76, 745–759. [Google Scholar] [CrossRef]
- Lindsley, C.; Gill, J.G.; Kyba, M.; Murphy, T.L.; Murphy, K.M. Canonical Wnt signaling is required for development of embryonic stem cell-derived mesoderm. Development 2006, 133, 3787–3796. [Google Scholar] [CrossRef]
- Gadue, P.; Huber, T.L.; Paddison, P.J.; Keller, G.M. Wnt and TGF-beta signaling are required for the induction of an in vitro model of primitive streak formation using embryonic stem cells. Proc. Natl. Acad. Sci. USA 2006, 103, 16806–16811. [Google Scholar] [CrossRef] [PubMed]
- Yoshioka, Y.; Suzuki, T.; Matsuo, Y.; Nakakido, M.; Tsurita, G.; Simone, C.; Watanabe, T.; Dohmae, N.; Nakamura, Y.; Hamamoto, R. SMYD3-mediated lysine methylation in the PH domain is critical for activation of AKT1. Oncotarget 2016, 7, 75023–75037. [Google Scholar] [CrossRef]
GENE | Sequence | Reference | |
---|---|---|---|
Nanog | F R | GCGGACTGTGTTCTCTCAGG CCACCGCTTGCACTTCATCC | [42] |
Klf4 | F R | CGTCCCAGTCACAGTGGTAA AAAAGAACAGCCACCCACAC | [43] |
Eomes | F R | CCCACGTCTACCTGTGCAAC GGTGGGGTTGAGTCCGTTTA | |
Pou5f1/Oct4 | F R | AAGCAACTCAGAGGGAACCT GGTGATCCTCTTCTGCTTCA | |
Mesp1 | F R | GTTCCTGTACGCAGAAACAGCAT GTTTCTAGAAGAGCCAGCATGTC | [44] |
Sox17 | F R | GCCGATGAACGCCTTTATGGTG TCTCTGCCAAGGTCAACGCCTT | [45] |
T/Brachyury | F R | TGCCTACCAGAATGAGGAGATTA CCATTACATCTTTGTGGTCGTTT | |
TnnT2 | F R | AGCGCGTGGAGAAGGACCTGA CCGCTCTGCCCGACGCTTT | |
Myh7 | F R | CCAAGGGCCTGAATGAGGAG GCAAAGGCTCCAGGTCTGAG | [46] |
Myl7 | F R | AGGAAGCCATCCTGAGTGCCTT CATGGGTGTCAGCGCAAACAGT | [45] |
Acta2/αSMA | F R | AGGCACCACTGAACCCTAAG ACAGCACAGCCTGAATAGCC | [47] |
Nkx2-5 | F R | GTCCAGCTCCACTGCCTTCT CAAGTGCTCTCCTGCTTTCC | [48] |
Isl1 | F R | GGCTACACAGCGGAAACACT ACGTGCTTTGTTAGGGATGG | [49] |
Otx2 | F R | CTTCATGAGGGAAGAGGTGGCAC TGGCGGCACTTAGCTCTTCGATTC | |
Fgf5 | F R | GCTGTGTCTCAGGGGATTGT CACTCTCGGCCTGTCTTTTC | [50] |
Smyd3 | F R | AGAGGTGTGCAAGTGATGAAAGT ATCAAATCTTCAATCAGGCTGTG | [35] |
Gapdh | F R | AACATCAAATGGGGTGAGGCC GTTGTCATGGATGACCTTGGC | [49] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fittipaldi, R.; Floris, P.; Proserpio, V.; Cotelli, F.; Beltrame, M.; Caretti, G. The Lysine Methylase SMYD3 Modulates Mesendodermal Commitment during Development. Cells 2021, 10, 1233. https://doi.org/10.3390/cells10051233
Fittipaldi R, Floris P, Proserpio V, Cotelli F, Beltrame M, Caretti G. The Lysine Methylase SMYD3 Modulates Mesendodermal Commitment during Development. Cells. 2021; 10(5):1233. https://doi.org/10.3390/cells10051233
Chicago/Turabian StyleFittipaldi, Raffaella, Pamela Floris, Valentina Proserpio, Franco Cotelli, Monica Beltrame, and Giuseppina Caretti. 2021. "The Lysine Methylase SMYD3 Modulates Mesendodermal Commitment during Development" Cells 10, no. 5: 1233. https://doi.org/10.3390/cells10051233
APA StyleFittipaldi, R., Floris, P., Proserpio, V., Cotelli, F., Beltrame, M., & Caretti, G. (2021). The Lysine Methylase SMYD3 Modulates Mesendodermal Commitment during Development. Cells, 10(5), 1233. https://doi.org/10.3390/cells10051233