Next Article in Journal
Effects of Different Types of Pot-Mat Trays on the Growth of Densely Sown Seedlings and Root Morphology of Machine-Transplanted Rice
Next Article in Special Issue
A Novel Semi-Hydroponic Root Observation System Combined with Unsupervised Semantic Segmentation for Root Phenotyping
Previous Article in Journal
Agronomic Experiments and Analysis of Garlic Mechanization-Friendly Cultivation Patterns in China
Previous Article in Special Issue
Root Phenotyping: A Contribution to Understanding Drought Stress Resilience in Grain Legumes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Maize and Pea Root Interactions Promote Symbiotic Nitrogen Fixation, Thereby Accelerating Nitrogen Assimilation and Partitioning in Intercropped Pea

1
State Key Laboratory of Aridland Crop Science, Gansu Agricultural University, Lanzhou 730070, China
2
College of Agronomy, Gansu Agricultural University, Lanzhou 730070, China
*
Authors to whom correspondence should be addressed.
Agronomy 2025, 15(7), 1615; https://doi.org/10.3390/agronomy15071615
Submission received: 29 May 2025 / Revised: 27 June 2025 / Accepted: 30 June 2025 / Published: 1 July 2025

Abstract

Cereal/legume intercropping enhances legume nodulation and improves nitrogen use efficiency (NUE) in cereal crops. This facilitation of symbiotic nitrogen fixation (SNF) in intercropped legumes involves a complex eco-physiological mechanism driven by multiple factors. Among them, interspecific root interactions (IRIs) are a key factor influencing SNF in intercropped legumes. Currently, it remains unclear whether and how IRIs modulate SNF to affect NUE and yield formation in legume species. In this study, maize/pea intercropping with different types of root separation [no barrier (NB) and plastic barrier (PB)] and pea monocropping (IP) were simulated in a nitrogen (N)-free nutrient matrix in pots, and the SNF, N metabolism, and N partitioning were investigated. We demonstrated that IRIs optimize SNF performance. N assimilation is positively regulated following increases in enzyme activity and gene expression in intercropped roots and nodules. Furthermore, IRIs facilitate amino acid (AA) export from nodules to roots and shoots, which is followed by an increase in AA levels in leaves (source) and leaf exudates (sink). Overall, intensive SNF drives N metabolism and alters source-to-sink N partitioning, thereby increasing NUE (by 23%) and yield (by 15%) in intercropped pea. This study reveals the positive roles of IRIs to the NUE and yield and provides useful reference material for increasing N contents derived from SNF to maximize NUE and crop yields in intercropped legumes.

1. Introduction

The continuous application of nitrogen (N) fertilizers has been the main method for improving crop yields since fertilizers were first synthesized on an industrial scale. However, the use of manufactured fertilizers is both expensive and harmful to the environment, which has hindered sustainable agricultural development [1,2]. Alternatively, symbiotic N fixation (SNF) in legumes is a sustainable source of N for agriculture, generating more than 50 million tons of available N annually [3]. To meet the requirements of both high yields and environmentally friendly agricultural practices, N-fixing species should be incorporated into a viable farming system.
So far, there is considerable interest in the effectiveness of cereal/legume intercropping systems, especially because the intercropping system enhances SNF in leguminous plants [4,5,6,7,8,9], supplying additional N to associated cereal crops and improving their nitrogen use efficiency (NUE) and yield, which positively affects intensive farming systems [10,11]. The cereal/legume intercropping is a complex eco-physiological process involving multiple factors, including light competition-induced shading effects [12], interspecific root interactions (IRIs) [13,14], the restructuring of the rhizosphere microbiome [15], and feedback-regulated soil N dynamics [16]. These factors collectively determine crop NUE and yield. Among them, IRIs is a key factor influencing SNF in intercropped leguminous plants [17]. Current understanding remains unclear regarding whether IRIs modulate SNF to promote NUE and yield formation in intercropped legume species.
Intercropping can promote legume nodulation and N fixation [4,9,18,19]. The resulting ammonia from SNF is transported across the symbiosomal membrane into the infected nodule cells [20]. Subsequently, several N-assimilating enzymes, such as glutamine synthetase, glutamate synthase, and glutamate dehydrogenase, convert ammonia into glutamine, asparagine, and other amino acids (AAs) [21]. In pea plants grown under N-deficient conditions, AAs are synthesized primarily in nodules, after which they are transported through the xylem to the mature source leaf or through the phloem to the root [22]. In the leaf, amino-N is used in multiple metabolic processes. For example, it may be impermanently stored as AAs or proteins or loaded into the phloem to provide N for the developing sink (seed) [23]. Some root-derived AAs may also be transported from the xylem to the phloem, directly providing a sink for N or exiting the xylem to be stored in the stem [22,24]. During the reproductive stage, N stored in the stem and leaf is remobilized and transported to the flower, pod, and seed [25]. The embryo absorbs AAs for metabolism or accumulates them in the form of protein and starch for the developing seed [26,27]. Both AA loading into the phloem and uptake by the embryo are crucial for the regulation of N allocation from source to sink [23,28]. Furthermore, AA transporters mediating AA partitioning in legumes has been identified as a potentially important factor influencing NUE [29,30]. In monoculture legumes, N assimilation and AA partitioning contributes to legume NUE. However, whether enhanced SNF promotes NUE and yield by driving N assimilation and AA partitioning in intercropped legumes remains undetermined.
In the northwestern China, maize–pea intercropping significantly increases system productivity by mitigating interspecific competition and improving N fixation compared to monocropping [31,32,33], making it a key strategy for sustainable agricultural intensification. The objective was to investigate the effect of SNF on N assimilation and partitioning via IRIs in intercropped pea using maize–pea intercropping. It was hypothesized that IRIs-mediated SNF drives N assimilation and source-to-sink N partitioning, increasing the NUE and yield of intercropped pea. In this study, maize/pea intercropping with different types of root separation [no barrier (NB) and plastic barrier (PB)] and pea monocropping (IP) were simulated in an N-free nutrient matrix in pots, and the SNF, N metabolism and partitioning were analyzed. The study provides an integrated view of SNF, N assimilation, and AA remobilization and strengthens the understanding of the improvement of intercropped legume NUE and yield.

2. Materials and Methods

2.1. Experiment Design and Plant Cultivation

We conducted a pot experiment in a greenhouse at Gansu Agricultural University (Lanzhou, China). Figure 1 illustrates the experimental layout, which comprised two cropping systems: pea/maize intercropping and pea monocropping (IP). The intercropping system included two treatments: (1) no barrier (NB), which allowed full contact between pea and maize roots; (2) plastic barrier (PB; 0.5 mm thick), which blocked material and signal exchange and ensured pea and maize roots were separated (i.e., no contact). After cutting the middle of each side of the pot (length, width, and height of 50, 35, and 30 cm, respectively), a plastic sheet was inserted and the seams were glued to create two separate growth chambers.
The “Dingwan No. 1” from pea (Pisum sativum L.) and “Xianyu No. 335” from maize (Zea mays L.) were used in this study. Surface sterilization of pea seeds was performed using 75% ethanol (30 s) and subsequently 50% sodium hypochlorite solution (4 min). Maize seeds were surface-sterilized in 15% commercial bleach solution containing 0.01% Triton X-100 for 15 min. After five sterile-water rinses, seeds were transferred to inverted agar plates and dark-incubated for 2 days to induce germination. The growth substrate, comprising perlite and vermiculite (2:1 v/v), was sterilized by autoclaving at 121 °C for 1 h before portioning into plastic pots. Germinated seedlings were transplanted to opposite sides of partitioned pots and maintained in a controlled growth chamber (16/8 h light/dark cycle, 60% RH, 23 °C/25 °C). Upon reaching 3 cm height, uniform pea and maize seedlings were manually thinned to retain one healthy plant per species per pot. Pea and maize were planted 8 and 4 seedlings in a row, respectively. Pea plants were inoculated with Rhizobium leguminosarum bv. viciae USDA 2370 (OD600 = 0.1) after 7 days of growth. Plants were supplied with fresh N-free Fåhraeus nutrient medium every 2 days [34]. Pea and maize were sown on 1 April, 1 August, and 1 November 2023, with corresponding harvests on 2 June 2023, 3 October 2023, and 2 January 2024.

2.2. Root Characteristics, Chlorophyll Concentration, and Nodule Performance

At 35 days post-inoculation (dpi), entire root systems were harvested for architectural analysis. Root length, surface area, diameter, volume, and tip number were quantified using an image-based root scanning platform (Winches; Regent, Québec, QC, Canada). Also, chlorophyll a, carotenoid, total chlorophyll, and chlorophyll b concentrations were quantified by the Wellburn′s approach [35]. Chlorophyll a and b, total chlorophyll, and carotenoid contents were derived from tri-wavelength spectrophotometry (470, 645, and 663 nm). For the completely expanded leaf, a portable photosynthesis system (Li-6400; Li-Cor) was used to assess photosynthesis. Assays were conducted between 9 and 11 am to prevent temperature stress and suboptimal vapor pressure. Throughout measurements, environmental parameters were maintained at 800 µmol m−2 s−1 photosynthetically active radiation, 25 °C air temperature, 80% relative humidity, and 400 µL L−1 CO2.
The nodule primordia or nodules were collected to evaluate nodule biomass and nodule number. For nodule biomass quantification, root-derived nodule primordia and mature nodules were separated into individual envelopes, then dehydrated at 65 °C for 48 h until reaching a constant weight. Nitrogenase activity was measured by the acetylene reduction assay [36]. When collecting fresh nodules, a trace amount of root tissue at the base of each nodule was retained to ensure that the nodule was undamaged. All nodules removed from each plant were mixed well, weighed (0.5 g), and placed in 20 mL test tubes that were then sealed. Following air displacement with acetylene (10% v/v final concentration), gas samples (1 mL/tube) were analyzed using an Agilent 7890A gas chromatograph (Agilent Technologies, Santa Clara, CA, USA) after 18–24 h incubation at 28 °C. Leghemoglobin (LB) was extracted from the fresh nodule (0.5 g) and measured as previously described [37]. Fresh nodules were cryogenically pulverized in liquid nitrogen, homogenized with ice-cold phosphate buffer (0.1 M, pH 6.8; 4:1 v/w), and centrifuged (100× g, 15 min). The supernatant underwent ultracentrifugation (21,460× g, 20 min), followed by spectrophotometric analysis (540 nm) of the final supernatant after pellet discard. The bovine hemoglobin protein was used to develop a standard curve to calculate the LB content. All of the above experiments were repeated three times.

2.3. N Metabolic Enzyme Activities

The enzymes (NR, NiR, GS, GOGAT, GDH) in roots (nodule-excised) and nodules were assayed at 35 dpi via microplate kits (Suzhou Comin, Suzhou, China). Fresh samples (0.1 g) were homogenized for enzyme extraction, with protein concentrations determined prior to kinetic assays. Substrate-specific reactions were initiated per enzymatic catalysis principles, and reaction kinetics monitored via microplate spectrophotometry. Activities (μmol·min−1·mg−1 protein) were calculated per the manufacturer’s algorithms with triplicate biological replicates.

2.4. Ammonium and AA Concentrations

The ammonium concentration in the nodule was determined at 35 dpi using a colorimetric-based ammonium assay kit. Firstly, 2 mg of fresh nodule was collected and snap-frozen in liquid N to avoid the deamination or deamidation of AAs and proteins as well as the accumulation of ammonium. Following the addition of 500 μL deionized water, samples were centrifuged (20,000× g, 15 min, 4 °C). The supernatant was membrane-filtered (0.2 μm nylon, Thermo Fisher) and a 100 μL aliquot was reserved for ammonium analysis. The enzymatic reaction was initiated by adding NADPH, 2-oxoglutarate, and glutamate dehydrogenase (GDH) to the extract. Ammonium-dependent NADPH oxidation was quantified via absorbance decrease at 340 nm, with the concentration determined against an ammonium standard curve.
For AA extraction, the extract was obtained from 3 mg of leaf, stem, root, and nodule according to previous research [23]. Methanol (300 μL, 80% v/v) and internal standard 6-aminohexanoic acid (15 pM) were added to the lyophilized tissues and centrifuged (70 °C at 1000 rpm for 15 min). Subsequently, the supernatant was collected after the centrifugation (25 °C at 10,000 g for 15 min). The pellets were re-extracted with 20% methanol as in the above steps. The resulting supernatant was combined, dried, and dissolved in 160 µL HPLC-grade water. Xylem sap was collected [30]. Xylem sap and nodule extract were prepared in 20-fold dilutions and stem, leaf, and root extracts were diluted 10-fold for the derivatization of AA extracts with 4-fluoro-7-nitro-2,1,3-benzoxadiazole [38]. HPLC analyses of free AAs employed a Waters 2695 separations system coupled to a 2475 multi-fluorescence detector, with data processed through Empower™ 2 chromatography software [28]. The above experiments were repeated three times.

2.5. RNA Extraction and qRT-PCR Analysis

Root and nodule samples collected at 7 and 35 dpi underwent total RNA extraction using a TaKaRa MiniBest Plant RNA Extract Kit (Takara Bio, Dalian, China). For qRT-PCR, first-strand cDNA was synthesized from 1 μg RNA using oligo (dT)18 from 1 μg RNA with M-MLV reverse transcriptase. Quantitative PCR employed the Bio-Rad CFX96 Touch™ system with SYBR® Green I Master Mix, using Ubiquitin and EF1α as reference genes. Relative expression (2−ΔΔct) was calculated from three biological replicates, with primers listed in Table 1.

2.6. The Seed Number, Seed Yield, N Contents, and NUE in Pea

Six individual plants from each treatment at 63 days were harvested to evaluate the seed yield, N accumulation, harvest index (HI), N harvest index (NHI), and NUE. The plants were separated into non-seed residues (DR; root + stem+ leaf + pod) and total seed (SEED). Samples were dried at 105 °C (initial dehydration) and maintained at 80 °C until mass stabilization. The harvest index (HI), quantifying seed production efficiency, was derived as follows: HI = (DWSEED)/(DWDR + DWSEED).
The dried samples were ground into powder and well-mixed to analyze N accumulation. Dry samples were transferred to digestion tubes, treated with 10 mL H2SO4, and homogenized. Microwave digestion (Labtech™ Line, FOSS, Denmark) proceeded at 365 °C with iterative additions of 30% H2O2 (7–8 drops every 30 min; 3–4 cycles) until solution clarification. The digestate was diluted to volume with distilled water prior to automated Kjeldahl nitrogen determination (Kjeltec™ 8400, FOSS). Plant N content was derived from dry weight (DW) measurements. (N%DR DWDR + N%SEED DWSEED) was considered to be the N accumulation in plants. The NHI, a key indicator of grain filling with N, was determined by the DW and N content (N%), as (N%SEED DWSEED)/(N%DR DWDR + N%SEED DWSEED). Therefore, the NUE was evaluated as the ratio of NHI/HI. All of the above experiments were repeated three times.

3. Results

3.1. Effects of IRIs on Chlorophyll Concentrations, Root Properties, and Nodule N-Fixing Performances

First, plant characteristics were examined. The aboveground and belowground parts of pea plants differed among treatments (Figure 1). For example, almost all of the leaves on NB plants were bright green, while a few leaves on the plants in the other two groups were yellow or wilted (Figure 2A). The chlorophyll concentration and photosynthetic rate increased significantly in NB leaves (Figure 2B,C). For the belowground pea plant parts, the NB plant root system was more expanded than the other treated root systems (Figure 2D). Subsequently, the systematic effects of IRIs on root phenotypes were investigated. Although the NB treatment did not significantly shift root diameter (Figure 2H), it markedly increased root surface area, root length, root tips number, and root volume (Figure 2E–G,I).
Nodule number and biomass were monitored from 7 dpi. Compared with PB and IP plants, NB plants had considerably more nodules and a higher biomass at 7, 15, and 25 dpi (Figure 3B,C). Apart from obvious quantitative differences, there were no regular changes in the nodule phenotype at 25 dpi (Figure 3A). Surprisingly, nodule number and biomass for NB roots did not increase at 35 dpi (Figure 3B,C). At 15, 25, and 35 dpi, the NB treatment obviously increased the nitrogenase activity and LB content (Figure 3E,F).

3.2. N Metabolism Is Regulated Following Increases in Enzyme Activity and Gene Expression

To investigate the effects of IRIs on N assimilation, the expression levels of genes involved in the transport of ammonium from the symbiosome membrane into the host cell and genes related to N assimilation were determined in nodules and roots, respectively (Figure 4A,B). In roots, PsNIP (Nodulin 26-like intrinsic protein) transcription increased following the NB treatment (approximately 2-fold higher than the corresponding transcription level after the PB and IP treatments) (Figure 4B). The NB treatment also significantly up-regulated the expression of NIP in nodules (Figure 4A). In roots and nodules, IRIs significantly increased the expression of AMF (ammonium facilitator), NR (nitrate reductase), GS2 (glutamine synthetase), GOGAT (glutamine 2-oxoglutarate aminotransferase), AS1 (asparagine synthetases), and AS2 (Figure 4A,B). NIR (nitrite reductase) was relatively stable when expressed in roots under different treatment conditions (Figure 4B), but the NB treatment apparently increased the NIR expression level in nodules (Figure 4A). Although IRIs did not significantly affect GDH (glutamate dehydrogenase) expression in nodules (Figure 4A), the NB treatment resulted in a significant increase in GDH expression in roots (Figure 4B). There was no apparent difference in the transcription of an ASNase-encoding gene in roots and nodules after the IP and PB treatments. However, the expression of this gene decreased following the NB treatment (Figure 4A,B).
In addition, nodules and roots were analyzed in terms of the activities of key enzymes involved in N metabolism (Figure 4C–G). Compared with IP and PB, NB did not alter the NIR activity in roots, but it significantly increased the NIR activity in nodules (Figure 4D). Moreover, NR, GS, GOGAT, and GDH activities increased in NB roots and nodules (Figure 4C,E–G). Furthermore, their activities were higher in nodules than in roots, indicative of the positive effects of IRIs on N metabolism, especially in nodules.

3.3. IRIs Accelerate AA Delivery from Nodules to Roots and Shoots

When pea is grown in an N-free matrix, the N required for plant growth is derived from N fixation and AA turnover in nodules. In NB nodules, the total AA levels decreased significantly (by 23% and 26% relative to the levels in PB and IP nodules, respectively) (Figure 5A). In pea, asparagine (i.e., main N compound for metabolism and growth) accelerated this decrease, although the amounts of other AAs, including glutamine and glutamate, also decreased significantly (Figure S1D). Similarly, ammonium (NH4+) concentrations decreased in NB nodules (Figure 5B). In addition, the total elemental N content was 33% and 32% lower in NB nodules than in PB and IP nodules, respectively (Figure 5C). Transporters play an important role in the phloem loading of AAs in pea. In pea nodules, we analyzed the expression of genes encoding AAP family members and cationic AA transporter 6 (CAT6), and the results showed AAP1, AAP2, AAP3, and CAT6 expression levels were significantly higher in NB nodules than in PB and IP nodules (Figure 5I). Therefore, the increase in AA transporter abundance resulted in a decrease in AA contents in nodules.
Furthermore, we investigated whether IRIs affect N transport from nodules to shoots. Xylem exudates were collected and examined in terms of AAs levels. The total xylem AA content increased in NB plants (by 42% and 44% relative to the corresponding contents in PB and IP plants, respectively) (Figure 5D), supporting the increase in N translocation from the nodules to the shoots of intercropped pea plants. The increased translocation of N from nodules to shoots was verified by analyzing stem and leaf AA contents. Compared with the PB or IP, the total AA content in stems and leaves of the NB increased by about 25% and 41%, respectively (Figure 5E,F). In both tissues, this increase mainly involved certain AAs, particularly glutamate and asparagine (Figure S1A,B). Similarly, developing roots obtain N either via the xylem-to-phloem transfer or through the direct transport of N from nodule phloem. To investigate whether IRIs affect organic N allocation from nodules to roots, root AA levels were measured. A comparison with PB roots revealed a 35% increase in the total AA level in NB roots (Figure 5G), with asparagine identified as the main contributor to this increase (Figure S1C). Considered together, these findings suggest that the increased N supply was mainly mediated by both nodule phloem loading and the root xylem-to-phloem transfer.
To analyze the effects of IRIs on N partitioning to the sink, the expression levels of phloem AA transporter-encoding genes as well as AA levels in leaf exudates were examined. The expression levels of AAP1 and CAT6 were up-regulated in leaves (Figure 5J). Phloem sap secreted from leaf petioles was collected to analyze the AA levels of leaf exudates, which revealed a clear increase in the total AA concentration in NB leaf exudates (Figure 5H). Collectively, these results are in accordance with the positive effects of IRIs on the source-to-sink translocation of N.

3.4. IRIs Improve Pea NUE and Crop Quality by Increasing the Number of Seeds

To evaluate the effects of IRIs on intercropped pea NUE, we analyzed the long-term effects of IRIs after reproductive harvest. The leaf, pod, seed, stem, root, and whole plant N contents were higher following the NB treatment than after the other two treatments (Figures S2A–C,E,F and S3B), indicating that the systematic regulation of IRIs substantially promoted the accumulation of N in plants. In contrast, compared with the effects of the other two treatments, the NB treatment significantly decreased the N content in nodules (Figure S2D). Whether the increased accumulation of N in leaf, seed, stem, and root tissues due to IRIs favors sink development was assessed. There were no differences in the number of pods per plant and in the seed N and protein contents among the NB, PB, and IP plants (Figure 6A,D,E and Figure S3A). Nevertheless, the number of seeds per pod was highest for the NB plants (Figure 6B), resulting in a significant increase in the number of seeds (Figure 6C). These findings suggest that the increased allocation of N to the sink increases the number of seeds rather than the amount of protein per seed. Furthermore, NB plants performed significantly better than PB and IP plants in terms of the total seed N and protein contents per plant (Figure 6F,G), indicating that IRIs increased the allocation of N to seeds (sink) as well as protein contents. More importantly, IRIs significantly increased HI and NHI at harvest (Figure S3C,D). As expected, NUE (NHI/HI) increased in NB plants (Figure 6H). Therefore, the increased allocation of N to seeds due to IRI considerably increased NUE and seed quality. In addition, correlation analyses showed that root properties and nodule N-fixing performances affected the seed yield, N accumulation, and NUE (Figure 7). To a large extent, enhanced nodule N fixation in concert with changes in root architecture accelerated N translocation, providing N sources for the increase in NUE and crop yield.

4. Discussions

4.1. IRIs Optimize Intercropped Pea Phenotypes

Intercropped crop phenotypes are shaped by a combination of ecological mechanisms, including the structural complementarity of tall/short species in canopy architecture and spatial niche partitioning through differential root distribution patterns [14,39,40]. In pea plants grown under NB and IP cultivation systems, these synergistic mechanisms may collectively contribute to the observed phenotypic divergence. While maize shading imposes physiological constraints on PB peas compared to IP, their complementary growth architecture with maize may partially mitigate light competition, potentially leading to an increase in chlorophyll a content and Pn (Figure 2B,C). Furthermore, reduced intraspecific competition for nutrients within PB pea populations is likely to contribute to their increased root volume compared to IP plants (Figure 2I). However, the observed phenotypic differences between NB and PB plants were exclusively attributed to IRIs.
Numerous studies have demonstrated that cereal crops intercropped with legumes significantly enhance both the growth and N fixation capacity of the legumes. For instance, intercropping systems such as faba bean with wheat, and alfalfa with triticale, have consistently shown marked increases in legume nodule number, biomass, and N fixation activity [19,41]. In this study, IRIs optimized nodule phenotypes (Figure 3B,C) and nodule N fixation performance (Figure 3E,F) in intercropped pea. These findings demonstrate that IRIs serve as key regulators of nodule development and SNF efficiency in intercropped legumes.

4.2. SNF-Driven N Metabolism and AAs Transport Accelerates Source-to-Sink N Partitioning, Thereby Increasing NUE and Crop Quality

Plants rely critically on N absorption, assimilation, and remobilization under low-N conditions [42]. In the wheat–faba bean intercropping system, interspecific interactions enhance both the expression levels and enzymatic activities of GS and GOGAT genes in wheat leaves, which is associated with higher NUE [43]. Furthermore, under N-deficient conditions, rhizobium inoculation significantly enhance the expression levels of GmNR and GmGDH in soybean leaves and GmGOGAT in roots, suggesting that SNF-driven N metabolism in leguminous plants. N assimilation is a critical factor influencing crop yield and NUE [44]. In our study, IRIs promote the expression of N metabolism-related genes and enzymatic activities in roots and nodules of intercropped legumes (Figure 4), suggesting SNF-driven N metabolism have a positive impact on the NUE of leguminous plants.
N translocation and remobilization also contributed to NUE and yield performance in intercropping systems [45]. Intercropping improved N remobilization efficiency from vegetative tissues to grain sinks, which was strongly associated with grain yield gains [46]. Notably, intercropping-induced N allocation (e.g., shoot-to-grain or root-to-shoot transport) exhibited species-specific variation [47]. In nodules, the accumulation of ammonium, AAs, or other N compounds negatively regulates N assimilation [48,49,50]. In soybean, ureides act primarily as N transporters [22]. Decreases in ureide-mediated N transport from nodules and the subsequent accumulation of N in nodules negatively affect N metabolism [51]. In contrast, decreases in AAs, NH4+, and N contents (Figure 5A–C) promote N assimilation by regulating enzyme activities and gene expression associated with N metabolism and ammonium movement in nodules (Figure 4), with more N entering the N assimilation pathway. Therefore, IRIs positively affect N metabolism. In addition, the enhanced deamination of asparagine increased its metabolism in NB nodules, leading to a further decrease in abundance (Figure 5A). Although continuous N assimilation may have led to the accumulation of AAs in NB nodules, these AAs were not stored in nodules. Instead, they were exported to other tissues; this is supported by the observed decrease in AA levels in nodules (Figure 5A) and increase in AA levels in the stem, leaf, and root of NB plants (Figure 5E–G). Indeed, an examination of NB nodules revealed the up-regulation of transporters responsible for moving ammonium (Figure 5I). Asparagine contents decreased significantly in NB nodules (Figure S1D), but increased markedly in shoots (Figure S1A,B), reflecting the enhanced translocation of N from belowground to aboveground plant parts.
In general, some N may be temporarily stored in leaves or the stem as AAs or proteins undergoing N assimilation [46,47] or are transported to the developing sink [25]. During the reproductive stage, N stored in the form of AAs is remobilized and reallocated for fruit growth or seed filling [52,53]. In fact, crops with optimal NUE acquire N very efficiently to produce seeds [25,54,55]. In this study, when pea was intercropped with maize, additional N was transferred from source to sink (Figure 5J,H), producing a higher total seed N and protein contents per NB plant (Figure 6F,G). During source–sink N partitioning, the importance of AA partitioning for seed development and NUE has been confirmed [56]. Knocking out AA transporters involved in phloem loading results in a decrease in the number of Arabidopsis thaliana seeds [23]. However, the overexpression of AA transporters in legumes increases seed N and protein contents [56,57,58]. In intercropped pea, the enhanced AA transporters positively regulate source–sink N partitioning, which is of great significance for improving crop NUE.

4.3. Mechanisms of SNF Enhancement in Pea via IRIs During Intercropping

Root exudates and the rhizosphere microbiomes in IRIs are important factors influencing plant performance [13]. In intercropping systems, root exudates affect SNF and disease resistance via rhizosphere microbiomes. Root exudates in a tomato/potato–onion intercropping system improve tomato plant fitness by changing the rhizosphere microbiome [15]. In a maize/faba bean intercropping system, maize root exudates promote faba been flavonoid synthesis, resulting in increased nodulation and SNF [17]. In the current study, IRIs enhanced nodulation and SNF, but we did not determine whether improved SNF is associated with maize root exudates or the rhizosphere microbiomes. A combination of metabolomics and molecular biology methods should be used to further clarify the effect of maize root exudates and the rhizosphere microbiomes on SNF in intercropped pea as well as the underlying regulatory mechanism.
In addition to the root exudates and rhizobiome mentioned above, the response of the plant itself to its environment is extremely important. For legumes, SNF and N metabolism are related to the shoot N demand. The regulation of SNF and N metabolism involves a whole-plant N feedback mechanism that coordinates the shoot N demand and induces changes in nitrogenase activity via shoot–root signaling [59,60]. In a maize/pea intercropping system, nitrate stored in seeds and ammonium derived from SNF are two major sources of N for pea development in the absence of exogenous N. Legumes provide a significant advantage in intercropping systems by enabling nitrogen transfer to associated non-legume plants [9]. The fixed N transferred from legume crops to cereal crops decreases the biomass of intercropped legumes and negatively affects legume development [4]. In maize/pea intercropping system, N transfer may further exacerbate N deficiency in the aboveground parts of pea plants. Whether this process stimulates the production and long-distance transport of some signals, such as γ-aminobutyric acid [61], from the shoots to the roots to regulate SNF, thereby affecting N metabolism and AA transport, remains to be further investigated.

5. Conclusions

This study reveals that IRIs enhance legume NUE and yield through coordinated physiological regulation: i) Optimized N fixation: IRIs improve nodulation and SNF capacity. ii) Underground N metabolism regulation: The elevating key enzyme activities and up-regulating genes for N transport/assimilation in roots and nodules ensure adequate N supply for shoot development. iii) Source-sink repartitioning: AA remobilization driven by enhanced N assimilation modified nitrogen partitioning patterns. These findings provide practical insights for optimizing SNF-derived N allocation to maximize both NUE and crop productivity in legume-based intercropping systems.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy15071615/s1. Figure S1. Concentrations of individual AAs. Figure S2. Evaluation of the long-term effects of IRIs on the N content in plant tissues. Figure S3. Pea pod number, N accumulation, plant HI, and NHI on day 60 of the reproductive growth stage under NB, PB, and, IP treatment conditions.

Author Contributions

Y.S.: Conceptualization, Data curation, Funding acquisition, Investigation, Methodology, Visualization, Writing—original draft, and Writing—review and editing. Q.C.: Conceptualization, Funding acquisition, and Writing—review and editing. C.Z.: Conceptualization and Writing—review and editing. Z.W. and F.H.: Data curation, Investigation, Methodology, Visualization, Writing—review and editing. H.F.: Funding acquisition, Formal analysis, Investigation, Methodology, and Visualization. W.H., L.Z., C.G. and X.B.: Data curation, Methodology, and Visualization. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the State Key Laboratory of Aridland Crop Science of China (GSCS-2023-05), the Major Science and Technology Projects of Gansu Province (23ZDNA008), Gansu Province Joint Research Foundation of China (24JRRA844), the Less Developed Regions of the Natural Science Foundation of China (32360550), the Gansu Province Natural Science Foundation of China (23JRRA1421 and 23JRRA1429), and the National Key Research and Development Program of China (2022YFD1900200).

Data Availability Statement

The datasets used or analyzed during the current study are available from the corresponding author upon reasonable request.

Acknowledgments

The authors would like to thank the anonymous reviewers for their critical comments and suggestions for improving this manuscript.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

  1. Cui, Z.L.; Zhang, H.Y.; Chen, X.P.; Zhang, C.C.; Ma, W.Q.; Huang, C.D.; Zhang, W.F.; Mi, G.H.; Miao, Y.X.; Li, X.L.; et al. Pursuing sustainable productivity with millions of smallholder farmers. Nature 2018, 555, 363–366. [Google Scholar] [CrossRef]
  2. Ferguson, B.J.; Ross, J.J.; Reid, J.B. Nodulation phenotypes of gibberellin and brassinosteroid mutants of pea. Plant Physiol. 2005, 138, 2396–2405. [Google Scholar] [CrossRef] [PubMed]
  3. Canfield, D.E.; Glazer, A.N.; Falkowski, P.G. The evolution and future of earth’s Nitrogen cycle. Science 2010, 330, 192–196. [Google Scholar] [CrossRef]
  4. Zhao, Y.; Tian, Y.Q.; Li, X.B.; Song, M.H.; Fang, X.X.; Jiang, Y.; Xu, X.L. Nitrogen fixation and transfer between legumes and cereals under various cropping regimes. Rhizosphere 2022, 22, 100546. [Google Scholar] [CrossRef]
  5. Jensen, E.S.; Carlsson, G.; Hauggaard-Nielsen, H. Intercropping of grain legumes and cereals improves the use of soil N resources and reduces the requirement for synthetic fertilizer N: A global-scale analysis. Agron. Sustain. Dev. 2020, 40, 9. [Google Scholar] [CrossRef]
  6. Chamkhi, I.; Cheto, S.; Geistlinger, J.; Zeroual, Y.; Kouisni, L.; Bargaz, A.; Ghoulam, C. Legume-based intercropping systems promote beneficial rhizobacterial community and crop yield under stressing conditions. Ind. Crops Prod. 2022, 183, 114958. [Google Scholar] [CrossRef]
  7. Shao, Z.Q.; Zheng, C.C.; Postma, J.A.; Lu, W.L.; Gao, Q.; Gao, Y.Z.; Zhang, J.J. Nitrogen acquisition, fixation and transfer in maize/alfalfa intercrops are increased through root contact and morphological responses to interspecies competition. J. Integr. Agric. 2021, 20, 2240–2254. [Google Scholar] [CrossRef]
  8. Liu, R.; Zhou, G.P.; Chang, D.N.; Gao, S.J.; Han, M.; Zhang, J.D.; Sun, X.F.; Cao, W.D. Transfer characteristics of nitrogen fixed by leguminous green manure crops when intercropped with maize in northwestern China. J. Integr. Agric. 2022, 21, 1177–1187. [Google Scholar] [CrossRef]
  9. Zheng, B.; Zhou, Y.; Chen, P.; Zhang, X.; Du, Q.; Yang, H.; Wang, X.; Yang, F.; Xiao, T.; Li, L.; et al. Maize–legume intercropping promote N uptake through changing the root spatial distribution, legume nodulation capacity, and soil N availability. J. Integr. Agric. 2022, 21, 1755–1771. [Google Scholar]
  10. Duchene, O.; Vian, J.F.; Celette, F. Intercropping with legume for agroecological cropping systems: Complementarity and facilitation processes and the importance of soil microorganisms. Agric. Ecosyst. Environ. 2017, 240, 148–161. [Google Scholar] [CrossRef]
  11. Glaze-Corcoran, S.; Hashemi, M.; Sadeghpour, A.; Jahanzad, E.; Afshar, R.K.; Liu, X.B.; Herbert, S.J. Understanding intercropping to improve agricultural resiliency and environmental sustainability. Adv. Agron. 2020, 162, 199–256. [Google Scholar]
  12. Lv, Y.; Francis, C.; Wu, P.; Chen, X.; Zhao, X. Maize–Soybean Intercropping Interactions Above and Below Ground. Crop Sci. 2014, 54, 914–922. [Google Scholar] [CrossRef]
  13. Mommer, L.; Kirkegaard, J.; van Ruijven, J. Root–Root interactions: Towards a rhizosphere framework. Trends Plant Sci. 2016, 21, 209–217. [Google Scholar] [CrossRef]
  14. Li, L.; Liu, Y.-X.; Li, X.-F. Intercropping to maximize root–root interactions in agricultural plants. In The Root Systems in Sustainable Agricultural Intensification; Rengel, Z., Djalovic, I., Eds.; Wiley: New York, NY, USA, 2021; pp. 309–328. [Google Scholar]
  15. Zhou, X.; Zhang, J.; Khashi u Rahman, M.; Gao, D.; Wei, Z.; Wu, F.; Dini-Andreote, F. Interspecific plant interaction via root exudates structures the disease suppressiveness of rhizosphere microbiomes. Mol. Plant 2023, 16, 849–864. [Google Scholar] [CrossRef]
  16. Hu, F.; Tan, Y.; Yu, A.; Zhao, C.; Fan, Z.; Yin, W.; Chai, Q.; Coulter, J.A.; Cao, W. Optimizing the split of N fertilizer application over time increases grain yield of maize-pea intercropping in arid areas. Eur. J. Agron. 2020, 119, 126117. [Google Scholar] [CrossRef]
  17. Li, B.; Li, Y.-Y.; Wu, H.-M.; Zhang, F.-F.; Li, C.-J.; Li, X.-X.; Lambers, H.; Li, L. Root exudates drive interspecific facilitation by enhancing nodulation and N2 fixation. Proc. Natl. Acad. Sci. USA 2016, 113, 6496–6501. [Google Scholar] [CrossRef]
  18. Liu, Y.C.; Yin, X.H.; Xiao, J.X.; Tang, L.; Zheng, Y. Interactive influences of intercropping by nitrogen on flavonoid exudation and nodulation in faba bean. Sci. Rep. 2019, 9, 4818. [Google Scholar] [CrossRef] [PubMed]
  19. Zhao, Y.J.; Liu, X.J.; Tong, C.C.; Wu, Y. Effect of root interaction on nodulation and nitrogen fixation ability of alfalfa in the simulated alfalfa/triticale intercropping in pots. Sci. Rep. 2020, 10, 4269. [Google Scholar] [CrossRef]
  20. White, J.; Prell, J.; James, E.K.; Poole, P.S. Nutrient sharing between symbionts. Plant Physiol. 2007, 144, 604–614. [Google Scholar] [CrossRef]
  21. Tian, C.J.; Kasiborski, B.; Koul, R.; Lammers, P.J.; Bücking, H.; Shachar-Hill, Y. Regulation of the nitrogen transfer pathway in the arbuscular mycorrhizal symbiosis: Gene characterization and the coordination of expression with nitrogen flux. Plant Physiol. 2010, 153, 1175–1187. [Google Scholar] [CrossRef]
  22. Tegeder, M. Transporters involved in source to sink partitioning of amino acids and ureides: Opportunities for crop improvement. J. Exp. Bot. 2014, 65, 1865–1878. [Google Scholar] [CrossRef]
  23. Santiago, J.P.; Tegeder, M. Connecting source with sink: The role of Arabidopsis AAP8 in phloem loading of amino acids. Plant Physiol. 2016, 171, 508–521. [Google Scholar] [CrossRef]
  24. Zhang, L.; Tan, Q.; Lee, R.; Trethewy, A.; Lee, Y.-H.; Tegeder, M. Altered xylem-phloem transfer of amino acids affects metabolism and leads to increased seed yield and oil content in Arabidopsis. Plant Cell 2010, 22, 3603–3620. [Google Scholar] [CrossRef] [PubMed]
  25. Schiltz, S.; Munier-Jolain, N.; Jeudy, C.; Burstin, J.; Salon, C. Dynamics of exogenous Nitrogen partitioning and Nitrogen remobilization from vegetative organs in Pea revealed by 15N in vivo labeling throughout seed filling. Plant Physiol. 2005, 137, 1463–1473. [Google Scholar] [CrossRef] [PubMed]
  26. Sanders, A.; Collier, R.; Trethewy, A.; Gould, G.; Sieker, R.; Tegeder, M. AAP1 regulates import of amino acids into developing Arabidopsis embryos. Plant J. 2009, 59, 540–552. [Google Scholar] [CrossRef]
  27. Zhang, L.; Garneau, M.G.; Majumdar, R.; Grant, J.; Tegeder, M. Improvement of pea biomass and seed productivity by simultaneous increase of phloem and embryo loading with amino acids. Plant J. 2015, 81, 134–146. [Google Scholar] [CrossRef] [PubMed]
  28. Tan, Q.; Zhang, L.; Grant, J.; Cooper, P.; Tegeder, M. Increased phloem transport of S-Methylmethionine positively affects sulfur and Nitrogen metabolism and seed development in pea plants. Plant Physiol. 2010, 154, 1886–1896. [Google Scholar] [CrossRef]
  29. Xu, G.; Fan, X.; Miller, A.J. Plant nitrogen assimilation and use efficiency. Annu. Rev. Plant Biol. 2012, 63, 153–182. [Google Scholar] [CrossRef]
  30. Perchlik, M.; Tegeder, M. Improving plant Nitrogen use efficiency through alteration of amino acid transport processes. Plant Physiol. 2017, 175, 235–247. [Google Scholar] [CrossRef]
  31. Mao, L.L.; Zhang, L.Z.; Li, W.Q.; van der Werf, W.; Sun, J.H.; Spiertz, H.; Li, L. Yield advantage and water saving in maize/pea intercrop. Field Crops Res. 2012, 138, 11–20. [Google Scholar] [CrossRef]
  32. Yin, W.; Chai, Q.; Zhao, C.; Yu, A.Z.; Fan, Z.L.; Hu, F.L.; Fan, H.; Guo, Y.; Coulter, J.A. Water utilization in intercropping: A review. Agric. Water Manag. 2020, 241, 11–20. [Google Scholar] [CrossRef]
  33. Chai, Q.; Nemecek, T.; Liang, C.; Zhao, C.; Yu, A.Z.; Coulter, J.A.; Wang, Y.F.; Hu, F.L.; Wang, L.; Siddique, K.H.M.; et al. Integrated farming with intercropping increases food production while reducing environmental footprint. Proc. Natl. Acad. Sci. USA 2021, 118, e2106382118. [Google Scholar] [CrossRef] [PubMed]
  34. Fåhraeus, G. The infection of clover root hairs by nodule bacteria studied by a simple glass slide technique. Microbiology 1957, 16, 374–381. [Google Scholar] [CrossRef]
  35. Wellburn, A.R.; Lichtenthaler, H. Formulae and program to determine total carotenoids and chlorophylls A and B of leaf extracts in different solvents. In Advances in Photosynthesis Research, Proceedings of the VIth International Congress on Photosynthesis, Brussels, Belgium, 1–6 August 1983; Sybesma, C., Ed.; Springer: Berlin/Heidelberg, Germany, 1984; Volume 2, pp. 9–12. [Google Scholar]
  36. Oke, V.; Long, S.R. Bacterial genes induced within the nodule during the Rhizobium-legume symbiosis. Mol. Microbiol. 1999, 32, 837–849. [Google Scholar] [CrossRef]
  37. Riley, I.T.; Dilworth, M.J. Cobalt requirement for nodule development and function in Lupinus angustifolius L. New Phytol. 1985, 100, 347–359. [Google Scholar] [CrossRef]
  38. Aoyama, C.; Santa, T.; Tsunoda, M.; Fukushima, T.; Kitada, C.; Imai, K. A fully automated amino acid analyzer using NBD-F as a fluorescent derivatization reagent. Biomed. Chromatogr. 2004, 18, 630–636. [Google Scholar] [CrossRef]
  39. Bongers, F.J.; Evers, J.B.; Anten, N.P.R. Plastic responses for intercrop functioning. NPJ Sustain. Agric. 2025, 3, 8. [Google Scholar] [CrossRef]
  40. Yin, W.; Chai, Q.; Fan, Z.L.; Hu, F.L.; Zhao, L.H.; Fan, H.; He, W.; Zhao, C.; Yu, A.Z.; Sun, Y.L.; et al. Review on physiological and ecological characteristics and agronomic regulatory pathways of intercropping to delay root and canopy senescence of crops. J. Integr. Agric. 2025, 24, 1–22. [Google Scholar] [CrossRef]
  41. Liu, Y.C.; Qin, X.M.; Xiao, J.X.; Tang, L.; Wei, C.Z.; Wei, J.J.; Zheng, Y. Intercropping influences component and content change of flavonoids in root exudates and nodulation of Faba bean. J. Plant Interact. 2017, 12, 187–192. [Google Scholar] [CrossRef]
  42. Kant, S.; Bi, Y.M.; Rothstein, S.J. Understanding plant response to nitrogen limitation for the improvement of crop nitrogen use efficiency. J. Exp. Bot. 2011, 62, 1499–1509. [Google Scholar] [CrossRef]
  43. Liu, Z.; Zhu, Y.-A.; Dong, Y.; Tang, L.; Zheng, Y.; Xiao, J. Interspecies interaction for nitrogen use efficiency via up-regulated glutamine and glutamate synthase under wheat-faba bean intercropping. Field Crops Res. 2021, 274, 108324. [Google Scholar] [CrossRef]
  44. Andrews, M.; Lea, P.J.; Raven, J.A.; Lindsey, K. Can genetic manipulation of plant nitrogen assimilation enzymes result in increased crop yield and greater N-use efficiency? An assessment. Ann. Appl. Biol. 2004, 145, 25–40. [Google Scholar] [CrossRef]
  45. Atkins, C.A.; Smith, P.M.C. Translocation in Legumes: Assimilates, Nutrients, and Signaling Molecules. Plant Physiol. 2007, 144, 550–561. [Google Scholar] [CrossRef] [PubMed]
  46. Zhao, Y.H.; Fan, Z.L.; Hu, F.L.; Yin, W.; Zhao, C.; Yu, A.Z.; Chai, Q. Source-to-Sink Translocation of Carbon and Nitrogen Is Regulated by Fertilization and Plant Population in Maize-Pea Intercropping. Front. Plant Sci. 2019, 10, 891. [Google Scholar] [CrossRef] [PubMed]
  47. Xia, H.Y.; Zhao, J.H.; Sun, J.J.; Xue, Y.F.; Eagling, T.; Bao, X.X.; Zhang, F.S.; Li, L. Maize grain concentrations and above-ground shoot acquisition of micronutrients as affected by intercropping with turnip, faba bean, chickpea, and soybean. Sci. China Life Sci. 2013, 56, 823–834. [Google Scholar] [CrossRef]
  48. Ladrera, R.; Marino, D.; Larrainzar, E.; González, E.; Arrese-Igor, C. Reduced carbon availability to bacteroids and elevated ureides in nodules, but not in shoots, are involved in the Nitrogen fixation response to early drought in Soybean. Plant Physiol. 2007, 145, 539–546. [Google Scholar] [CrossRef]
  49. Gil-Quintana, E.; Larrainzar, E.; Arrese-Igor, C.; González, E. Is N-feedback involved in the inhibition of nitrogen fixation in drought-stressed Medicago truncatula? J. Exp. Bot. 2013, 64, 281–292. [Google Scholar] [CrossRef]
  50. Sulieman, S.; Tran, L.-S.P. Asparagine: An amide of particular distinction in the regulation of symbiotic nitrogen fixation of legumes. Crit. Rev. Biotechnol. 2013, 33, 309–327. [Google Scholar] [CrossRef]
  51. Collier, R.; Tegeder, M. Soybean ureide transporters play a critical role in nodule development, function and nitrogen export. Plant J. 2012, 72, 355–367. [Google Scholar] [CrossRef]
  52. Schulze, J. Source-sink manipulations suggest an N-feedback mechanism for the drop in N2 fixation during pod-filling in pea and broad bean. J. Plant Physiol. 2003, 160, 531–537. [Google Scholar] [CrossRef]
  53. Masclaux-Daubresse, C.; Chardon, F. Exploring nitrogen remobilization for seed filling using natural variation in Arabidopsis thaliana. J. Exp. Bot. 2011, 62, 2131–2142. [Google Scholar] [CrossRef] [PubMed]
  54. Salon, C.; Munier-Jolain, N.; Duc, G.; Voisin, A.-S.; Grandgirard, D.; Larmure, A.; Emery, R.J.; Ney, B. Grain legume seed filling in relation to nitrogen acquisition: A review and prospects with particular reference to Pea. Agronomy 2001, 21, 539–552. [Google Scholar] [CrossRef]
  55. Burstin, J.; Marget, P.; Huart, M.; Moessner, A.; Mangin, B.; Duchene, C.; Desprez, B.; Munier-Jolain, N.; Duc, G. Developmental genes have pleiotropic effects on plant morphology and source capacity, eventually impacting on seed protein content and productivity in pea. Plant Physiol. 2007, 144, 768–781. [Google Scholar] [CrossRef] [PubMed]
  56. Garneau, M.G.; Lu, M.-Z.; Grant, J.; Tegeder, M. Role of source-to-sink transport of methionine in establishing seed protein quantity and quality in legumes. Plant Physiol. 2021, 187, 2134–2155. [Google Scholar] [CrossRef] [PubMed]
  57. Weigelt, K.; Küster, H.; Radchuk, R.; Müller, M.; Weichert, H.; Fait, A.; Fernie, A.R.; Saalbach, I.; Weber, H. Increasing amino acid supply in pea embryos reveals specific interactions of N and C metabolism, and highlights the importance of mitochondrial metabolism. Plant J. 2008, 55, 909–926. [Google Scholar] [CrossRef]
  58. Rolletschek, H.; Hosein, F.; Miranda, M.; Heim, U.; Götz, K.-P.; Schlereth, A.; Borisjuk, L.; Saalbach, I.; Wobus, U.; Weber, H. Ectopic expression of an amino acid transporter (VfAAP1) in seeds of Vicia narbonensis and Pea increases storage proteins. Plant Physiol. 2005, 137, 1236–1249. [Google Scholar] [CrossRef]
  59. Lepetit, M.; Brouquisse, R. Control of the rhizobium-legume symbiosis by the plant nitrogen demand is tightly integrated at the whole plant level and requires inter-organ systemic signaling. Front. Plant Sci. 2023, 14, 1114840. [Google Scholar] [CrossRef]
  60. Parsons, R.; Stanforth, A.; Raven, J.A.; Sprent, J.I. Nodule growth and activity may be regulated by a feedback mechanism involving phloem nitrogen. Plant Cell Environ. 2010, 16, 125–136. [Google Scholar] [CrossRef]
  61. Sulieman, S.; Schulze, J. Phloem-derived γ-aminobutyric acid (GABA) is involved in upregulating nodule N2 fixation efficiency in the model legume Medicago truncatula. Plant Cell Environ. 2010, 33, 2162–2172. [Google Scholar] [CrossRef]
Figure 1. Schematic illustrations of maize/pea intercropping system treated with no barrier (NB) or plastic barrier (PB) and monocropped pea (SP). The intercropping system included two treatments: (1) NB group, which allowed full contact between pea and maize roots; (2) PB group, which blocked material and signal exchange and ensured pea and maize roots were separated.
Figure 1. Schematic illustrations of maize/pea intercropping system treated with no barrier (NB) or plastic barrier (PB) and monocropped pea (SP). The intercropping system included two treatments: (1) NB group, which allowed full contact between pea and maize roots; (2) PB group, which blocked material and signal exchange and ensured pea and maize roots were separated.
Agronomy 15 01615 g001
Figure 2. Phenotypes analyses of leaf and root in NB, PB, and IP-plants at 35 days post inoculation (dpi). (A,D) Overviews of leaf (A) and root (D) are representative images from one independent experiment, respectively. NB, no barrier; PB, plastic barrier; IP, monocropping. Bar = 1 cm. (B,C) The chlorophyll concentration (B) and photosynthetic rate (Pn) (C) defined the leaf growth status and photosynthetic efficiency. Data from one representative experiment out of three independent experiments are presented as mean ± standard error (SE) for six plants per treatment. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test). (EI) The root properties were mostly reflected in root surface area (E), root length (F), root tips number (G), root diameter (H), and root volume (I). Data from one representative experiment out of three independent experiments are presented as mean ± SE for six plants per treatment. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test).
Figure 2. Phenotypes analyses of leaf and root in NB, PB, and IP-plants at 35 days post inoculation (dpi). (A,D) Overviews of leaf (A) and root (D) are representative images from one independent experiment, respectively. NB, no barrier; PB, plastic barrier; IP, monocropping. Bar = 1 cm. (B,C) The chlorophyll concentration (B) and photosynthetic rate (Pn) (C) defined the leaf growth status and photosynthetic efficiency. Data from one representative experiment out of three independent experiments are presented as mean ± standard error (SE) for six plants per treatment. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test). (EI) The root properties were mostly reflected in root surface area (E), root length (F), root tips number (G), root diameter (H), and root volume (I). Data from one representative experiment out of three independent experiments are presented as mean ± SE for six plants per treatment. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test).
Agronomy 15 01615 g002
Figure 3. Symbiotic nodulation phenotypes of pea inoculated with rhizobia. (A) Nodules formed on NB, PB, and IP-plants at 25 dpi is representative image from one independent experiment. Bars = 1 cm. (BD) Total number of nodules (B) and nodule biomass (C) at 7, 15, 25, and 35 dpi. Moreover, the number of pink and white/gray nodules (D) was counted at 35 dpi. Data from one representative experiment out of three independent experiments are presented as mean ± SE for six plants per treatment. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test). (E,F) Nitrogenase activity (E) and leghemoglobin (LB) content (F) in nodule were detected at 15, 25, and 35 dpi, respectively. Data from one representative experiment out of three independent experiments are presented as mean ± SE for six biological replications per treatment. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test).
Figure 3. Symbiotic nodulation phenotypes of pea inoculated with rhizobia. (A) Nodules formed on NB, PB, and IP-plants at 25 dpi is representative image from one independent experiment. Bars = 1 cm. (BD) Total number of nodules (B) and nodule biomass (C) at 7, 15, 25, and 35 dpi. Moreover, the number of pink and white/gray nodules (D) was counted at 35 dpi. Data from one representative experiment out of three independent experiments are presented as mean ± SE for six plants per treatment. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test). (E,F) Nitrogenase activity (E) and leghemoglobin (LB) content (F) in nodule were detected at 15, 25, and 35 dpi, respectively. Data from one representative experiment out of three independent experiments are presented as mean ± SE for six biological replications per treatment. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test).
Agronomy 15 01615 g003
Figure 4. Analysis of N assimilation and metabolism at 35 dpi. (A,B) Expression analysis of N transport and metabolism genes in nodules (A) and roots (B) by qRT-PCR, respectively. Expression of ammonium transporter NIP1 (Nodulin 26-like intrinsic protein) and AMF (ammonium facilitator), as well as that of genes related to N assimilation (GS2, glutamine synthetase; GOGAT, glutamine 2-oxoglutarate aminotransferase), asparagine synthesis (asparagine synthetases AS1, AS2), and asparagine deamination (ASNase, asparaginase). Ubiquitin and EF1α were used as internal controls. Data from one representative experiment out of three independent experiments are presented as mean ± SE for three biological replicates. Different letters indicate significant differences at p < 0.01 (one-way ANOVA with Tukey’s test). (CG) The activity of enzymes associated with N metabolism in nodules and roots, including nitrate reductase (NR) (C), nitrite reductase (NiR) (D), glutamine synthetase (GS) (E), glutamate synthase (GOGAT) (F), and glutamate dehydrogenase (GDH) (G). Data from one representative experiment out of three independent experiments are presented as mean ± SE for six biological replicates. Different letters indicate significant differences at p < 0.01 (one-way ANOVA with Tukey’s test).
Figure 4. Analysis of N assimilation and metabolism at 35 dpi. (A,B) Expression analysis of N transport and metabolism genes in nodules (A) and roots (B) by qRT-PCR, respectively. Expression of ammonium transporter NIP1 (Nodulin 26-like intrinsic protein) and AMF (ammonium facilitator), as well as that of genes related to N assimilation (GS2, glutamine synthetase; GOGAT, glutamine 2-oxoglutarate aminotransferase), asparagine synthesis (asparagine synthetases AS1, AS2), and asparagine deamination (ASNase, asparaginase). Ubiquitin and EF1α were used as internal controls. Data from one representative experiment out of three independent experiments are presented as mean ± SE for three biological replicates. Different letters indicate significant differences at p < 0.01 (one-way ANOVA with Tukey’s test). (CG) The activity of enzymes associated with N metabolism in nodules and roots, including nitrate reductase (NR) (C), nitrite reductase (NiR) (D), glutamine synthetase (GS) (E), glutamate synthase (GOGAT) (F), and glutamate dehydrogenase (GDH) (G). Data from one representative experiment out of three independent experiments are presented as mean ± SE for six biological replicates. Different letters indicate significant differences at p < 0.01 (one-way ANOVA with Tukey’s test).
Agronomy 15 01615 g004
Figure 5. Evaluation of N levels in nodules and AA transport ad 35 dpi. (AH) Total free AA (A), ammonium (NH4+) (B), and elemental N (C) were detected in nodules. Total AA concentrations were analyzed in xylem (D), stem (E), leaf (F), root (G), and leaf exudate (H), respectively. Data from one representative experiment out of three independent experiments are presented as mean ± SE for six biological replicates. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test). (I,J) qRT-PCR analysis of AA transporters. These genes (AA permeases (AAP1, AAP2, and AAP3) and cationic AA transporter 6 (CAT6) were detected in nodules (I) and AAP1 and CAT6 (J) in leaf. Ubiquitin and EF1α were used as internal controls. Data from one representative experiment out of three independent experiments are presented as mean ± SE for three biological replicates. Different letters indicate significant differences at p < 0.01 (one-way ANOVA with Tukey’s test).
Figure 5. Evaluation of N levels in nodules and AA transport ad 35 dpi. (AH) Total free AA (A), ammonium (NH4+) (B), and elemental N (C) were detected in nodules. Total AA concentrations were analyzed in xylem (D), stem (E), leaf (F), root (G), and leaf exudate (H), respectively. Data from one representative experiment out of three independent experiments are presented as mean ± SE for six biological replicates. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test). (I,J) qRT-PCR analysis of AA transporters. These genes (AA permeases (AAP1, AAP2, and AAP3) and cationic AA transporter 6 (CAT6) were detected in nodules (I) and AAP1 and CAT6 (J) in leaf. Ubiquitin and EF1α were used as internal controls. Data from one representative experiment out of three independent experiments are presented as mean ± SE for three biological replicates. Different letters indicate significant differences at p < 0.01 (one-way ANOVA with Tukey’s test).
Agronomy 15 01615 g005
Figure 6. Analyses of pod phenotype, seed N, seed protein, and nitrogen use efficiency (NUE) during reproductive growth under NB, PB, and IP treatments at 63 days. (A) Overviews of pea pod phenotype is representative image from one independent experiment. Bars = 1 cm. (BH) Total seed number per plant (B), seed yield per plant (C), seed elemental N content (D), seed protein content (E), total seed N yield per plant (F), total seed protein yield per plant (G), and plant NUE (H) were detected. Data from one representative experiment out of three independent experiments are presented as mean ± SE for six biological replicates. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test).
Figure 6. Analyses of pod phenotype, seed N, seed protein, and nitrogen use efficiency (NUE) during reproductive growth under NB, PB, and IP treatments at 63 days. (A) Overviews of pea pod phenotype is representative image from one independent experiment. Bars = 1 cm. (BH) Total seed number per plant (B), seed yield per plant (C), seed elemental N content (D), seed protein content (E), total seed N yield per plant (F), total seed protein yield per plant (G), and plant NUE (H) were detected. Data from one representative experiment out of three independent experiments are presented as mean ± SE for six biological replicates. Different letters indicate significant differences at p < 0.05 (one-way ANOVA with Tukey’s test).
Agronomy 15 01615 g006
Figure 7. Correlations between yield parameters and root characteristics (A) as well as the N fixation performance of nodules (B). NA, N accumulation; GY, grain/seed yield; GN, grain/seed number; AR, nitrogenase activity; NB, nodule biomass; NN, nodule number. A correlation coefficient was calculated for each yield parameter and root property pair. Correlation coefficients greater than 0.8 are presented.
Figure 7. Correlations between yield parameters and root characteristics (A) as well as the N fixation performance of nodules (B). NA, N accumulation; GY, grain/seed yield; GN, grain/seed number; AR, nitrogenase activity; NB, nodule biomass; NN, nodule number. A correlation coefficient was calculated for each yield parameter and root property pair. Correlation coefficients greater than 0.8 are presented.
Agronomy 15 01615 g007
Table 1. Primers used for gene expression analysis by qRT-PCR.
Table 1. Primers used for gene expression analysis by qRT-PCR.
GenesForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)
Nitrogen transport and assimilation
Ammonium facilitator 3 (AMF)CTCGCCTCTTGTCGGAGTTGTCCCGGTGGTTGTACTTGTCTCCTCTAC
Nodulin26-like protein 1(NIP1)CACCGATAACAGAGCGATTGGTCCATATTCCTCGATATTCATTGTG
Nitrite reductase (NiR)TGATACACGACCTTACAACAACACTGAAGAAACCACCAACAA
Nitrate reductase (NR)GAGATTGCGGTGCGTGCTTGCGGATTGGTTGCCTGGTTGG
Glutamine synthetase 2 (GS2)GAAAATGGCACCATCAATAGGGTAGAAGGGATGCGAAACAGGCTTTGATAT
Glutamate dehydrogenase (GDH)CGAATAAATGACTGGAACGAGGTG GTGCTGGGCATACCCTACCG
Glutamate synthase-NADH dependent (GOGAT)CACAGATTGCATWGGAACATCCATTCCATTTTCATCTCCCAMAAACCTCTT
Asparagine synthetase 1 (AS1)CTGTCACTGCTAGATACCTTGCTGGTCTGTCACTGCTAGATACCTTGCTGGT
Asparagine synthetase 2 (AS2)CCATCACTTCTCGCTACCTAGCAACCTCGACATGAGAAACATAGGCGTGCT
L-Asparaginase (ASNase)GTYATGGAHAARTCYCCDCATTCCTAAMCARGATTGYDTTTGCYTCCTTTG
Amino acid phloem loading and transporter
Amino acid permease 1 (AAP1)GCTGGAACCATTACTGGAGTAAATGAGACTCTGACGGTGGTGGTGCTTTTA
Amino acid permease 2 (AAP2)AGCAAGCCACGAGGATAAGTATAGGCCAGTGAGTAAGTTTCCTGGCGATGTG
Amino acid permease 3 (AAP3)CGTCACAGATTATTGAACATCAAGCAGGGTCAAAATCACGGGTTGAAATAG
Cationic amino acid transporter 6 (CAT6)GGTTCGGAGTGTTTTCGGCTGTTACGGGTTCGGAGTGTTTTCGGCTGTTACG
Reference genes
UbiquitinGGCAAAAATACAGGACAAGGAGGGAGCAAMACHAGGTGRAGAGTRGACT
Elongation factor 1α (EF1α)CAGTGGGACGTGTTGAAACTGGTGTTATCGAACATTGTCTCCTGGAAGAGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sun, Y.; Wu, Z.; Hu, F.; Fan, H.; He, W.; Zhao, L.; Guo, C.; Bao, X.; Chai, Q.; Zhao, C. Maize and Pea Root Interactions Promote Symbiotic Nitrogen Fixation, Thereby Accelerating Nitrogen Assimilation and Partitioning in Intercropped Pea. Agronomy 2025, 15, 1615. https://doi.org/10.3390/agronomy15071615

AMA Style

Sun Y, Wu Z, Hu F, Fan H, He W, Zhao L, Guo C, Bao X, Chai Q, Zhao C. Maize and Pea Root Interactions Promote Symbiotic Nitrogen Fixation, Thereby Accelerating Nitrogen Assimilation and Partitioning in Intercropped Pea. Agronomy. 2025; 15(7):1615. https://doi.org/10.3390/agronomy15071615

Chicago/Turabian Style

Sun, Yali, Zefeng Wu, Falong Hu, Hong Fan, Wei He, Lianhao Zhao, Congcong Guo, Xiaoyuan Bao, Qiang Chai, and Cai Zhao. 2025. "Maize and Pea Root Interactions Promote Symbiotic Nitrogen Fixation, Thereby Accelerating Nitrogen Assimilation and Partitioning in Intercropped Pea" Agronomy 15, no. 7: 1615. https://doi.org/10.3390/agronomy15071615

APA Style

Sun, Y., Wu, Z., Hu, F., Fan, H., He, W., Zhao, L., Guo, C., Bao, X., Chai, Q., & Zhao, C. (2025). Maize and Pea Root Interactions Promote Symbiotic Nitrogen Fixation, Thereby Accelerating Nitrogen Assimilation and Partitioning in Intercropped Pea. Agronomy, 15(7), 1615. https://doi.org/10.3390/agronomy15071615

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop