Next Article in Journal
Organic Manure Amendment Fortifies Soil Health by Enriching Beneficial Metabolites and Microorganisms and Suppressing Plant Pathogens
Next Article in Special Issue
Optimising the Vase Life of Cut Hydrangeas: A Review of the Impact of Various Treatments
Previous Article in Journal
The Effect of Silicon–Melatonin Nanoparticles on Improving Germination Parameters and Reducing Salinity Toxicity by Maintaining Ion Homeostasis in Cyamopsis tetragonoloba L. Seedlings
Previous Article in Special Issue
Spray-Induced Gene Silencing (SIGS): Nanocarrier-Mediated dsRNA Delivery Improves RNAi Efficiency in the Management of Lettuce Gray Mold Caused by Botrytis cinerea
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 2
10.3390/agronomy15020428
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Exogenous Melatonin Application Delays Senescence and Improves Postharvest Antioxidant Capacity in Blueberries

by
Jie Li
,
Ying Wang
,
Jinying Li
,
Yanan Li
,
Chunze Lu
,
Zihuan Hou
,
Haiguang Liu
and
Lin Wu
*
College of Horticulture, Jilin Agricultural University, Changchun 130118, China
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(2), 428; https://doi.org/10.3390/agronomy15020428
Submission received: 10 January 2025 / Revised: 2 February 2025 / Accepted: 6 February 2025 / Published: 9 February 2025
(This article belongs to the Special Issue Applications of Pre- and Post-harvest Techniques in Horticultural Products)
Browse Figures
Versions Notes

Abstract

:
Blueberries are highly prone to postharvest decay, resulting in significant nutrient loss and economic damage. Current research on the postharvest storage of blueberries primarily focuses on storage techniques, while the underlying mechanisms remain insufficiently explored. To further explore the role of exogenous melatonin (MT) in delaying the senescence of blueberry fruit, this study treated fruits with sterile water (control) and 300 μmol·L−1 MT during the pink fruit stage. After maturation, the fruits were stored at 4 °C for 30 days, and we investigated the effects of exogenous MT on postharvest blueberry quality, reactive oxygen species (ROS) metabolism, antioxidant enzyme activities, and the expression of related genes. The results showed that, compared to the control, 300 μmol·L−1 MT effectively delayed the increase in fruit decay rate and the decline in firmness, while enhancing the total soluble solids (TSS) content and ascorbic acid (AsA) levels. It also reduced the accumulation of malondialdehyde (MDA), hydrogen peroxide (H2O2), and the production rate of superoxide anion (O2−), while maintaining higher activities of ascorbate peroxidase (APX), superoxide dismutase (SOD), and catalase (CAT). Furthermore, MT treatment upregulated the expression of antioxidant enzyme-related genes VcSOD1, VcSOD2, and VcAPX3. These findings indicate that treating blueberries with 300 μmol·L−1 MT at the pink fruit stage improves postharvest quality, alleviates oxidative damage, and delays senescence. This study provides a theoretical foundation and practical reference for blueberry storage and preservation, laying the groundwork for further understanding the regulatory mechanisms of exogenous MT in postharvest fruit senescence.

1. Introduction

The blueberry (Vaccinium spp.) is a perennial shrub-like berry from the Ericaceae family. Upon maturation, the surface of blueberry fruit becomes glossy and is coated with a layer of waxy bloom. The fruit has a sweet-tart taste and unique flavor, and is rich in nutrients such as organic acids, sugars, phenolics, vitamins, and anthocyanins, which contribute to its notable health benefits [1]. It is recognized as one of the five major health foods by the Food and Agriculture Organization, and is also known as the ’King of Fruits’ and a ’Superfruit’ [2,3,4]. However, blueberries grow and mature during the rainy mid-summer season. Due to the high field temperatures and the vigorous postharvest respiration of the fruit, various physiological and metabolic processes accelerate. Without timely intervention, mature blueberries will soften and decay within 2–4 days at room temperature (20 °C), resulting in nutrient loss, economic damage, and significantly hindering the development of the blueberry industry [5]. Currently, a variety of methods have been employed to delay the deterioration of blueberry fruit quality, including coating preservation [6], antibacterial treatments [7], 1-methylcyclopropene (1-MCP) [8], hyperoxia treatments [9], and preservation using natural active compounds [10]. As blueberries are primarily consumed fresh, growing concerns regarding the use of chemical fungicides, preservatives, and food safety issues have emerged. Consequently, the investigation of non-toxic, efficient, and environmentally friendly preservation methods, and their impact on postharvest quality, has become a major focus of research in the field of fruit and vegetable storage and preservation.
Melatonin (MT), chemically referred to as N-acetyl-5-methoxytryptamine, is a bioactive small molecule with a range of physiological functions. Initially discovered in the bovine pineal gland, subsequent studies have confirmed its widespread presence in both animals and plants [11]. To date, MT has been found in the roots, stems, leaves, fruits, and seeds of most plants [12,13,14]. As a non-toxic, endogenous indoleamine, MT is regarded as a natural supplement due to its inherent properties [15]. MT is a potent free radical scavenger with direct antioxidant activity, playing a crucial role in maintaining cellular redox balance. Its application has expanded to the preservation of postharvest quality in fruits and vegetables, as well as extending their storage periods [16,17,18,19,20]. Reactive oxygen species (ROS), including superoxide anion (O2−), hydrogen peroxide (H2O2), and hydroxyl radicals (·OH), can accumulate in excess, leading to the degradation of cellular membranes, nucleic acids, and proteins, resulting in cell damage and fruit senescence [21]. Antioxidants and enzymatic scavenging systems play a critical role in mitigating excessive ROS, thereby maintaining cellular ROS homeostasis and delaying the senescence process of fruit [22,23]. Thus, enhancing the antioxidant system of postharvest blueberries may represent one of the most effective approaches for preserving fruit quality and prolonging storage periods.
Melatonin (MT) has a strong ROS scavenging ability and can maintain high antioxidant enzyme activity (such as superoxide dismutase (SOD), catalase (CAT), and ascorbate peroxidase (APX) [24,25]), enhancing the content of antioxidants and thereby mitigating the toxic effects of ROS on plants [26]. Numerous studies have demonstrated that MT treatment is an effective method for maintaining the postharvest quality of fruits. For example, Yusof et al. [27] found that MT treatment could delay the decay rate of carambola fruit and maintain the fruit quality during storage. Similarly, strawberry fruit soaked in 100 μmol·L−1 MT for 15 min effectively maintained its fresh weight and fruit firmness, and increased the accumulation of DPPH scavenging capacity and the activity of antioxidant enzymes (SOD, POD, and APX) other than CAT [28]. A treatment with 500 μmol·L−1 MT was more effective in maintaining the quality and bioactive compounds of ‘Sweetheart’ fruit [29]. Kakaei et al. [30] showed that MT treatment can inhibit the browning index of white mulberry by regulating ROS metabolism and prolong the fruit storage time. Other studies have also indicated that MT treatment delays pear fruit ripening by downregulating related genes [31]. Furthermore, MT treatment inhibits the transcriptional activation of genes involved in the biosynthesis of flavonoids and anthocyanins, cell wall modification, and energy supply, thereby suppressing redness and chilling injury in plum fruit during cold storage [32]. These findings suggest that the mechanism by which MT delays fruit senescence is complex and requires further investigation. Recently, high-throughput sequencing technologies, including transcriptomics, metabolomics, and proteomics, have provided new avenues for exploring the mechanisms of fruit storage and preservation [33]. Previous studies have demonstrated that exogenous application of 300 μmol·L−1 melatonin during the pink fruit stage results in the best postharvest storage performance of blueberries [34]. However, it remains unclear how MT regulates ROS metabolism in blueberry fruit at the molecular level to delay fruit senescence, and whether it cooperates with or antagonizes specific metabolic pathways. This study investigates the effects of 300 μmol·L−1 melatonin (MT) on fruit quality, ROS-related compound content, and antioxidant enzyme activity during postharvest storage at 4 °C, and employs transcriptome sequencing technology to analyze the transcriptional changes in blueberry fruit induced using exogenous MT. These findings provide valuable insights for the development of innovative blueberry storage and preservation technologies.

2. Materials and Methods

2.1. Fruit Selecting and Treatment

The effects of MT treatment at different concentrations (0, 100, 200, 300, and 400 μmol·L−1) during various developmental stages (green, white, pink, and blue fruit stages) of blueberry on postharvest storage quality through preliminary experiments were investigated from May to October 2023. The criterion for determining the transition between different color stages in blueberry fruits was that 80% of the fruits had reached the respective color. The results indicated that exogenous application of 300 μmol·L−1 MT during the pink fruit stage resulted in the best postharvest storage performance at 4 °C (Figure A1) [34]. Therefore, subsequent experiments were conducted with 300 μmol·L−1 MT treatment applied at the pink fruit stage.
This experiment was conducted using 8-year-old ‘Northland’ blueberry plants in full fruiting stage, grown at the Jingyu Blueberry Technology Institute in Jingyu County, Baishan City, Jilin Province, China (126°30′–127°16′ E, 42°06′–42°48′ N; annual average precipitation 776.4 mm, annual average temperature 3.4 °C, and approximately 120 frost-free days) from May to August 2024. Five blueberry plants at the pink fruit color change stage were selected for the experiment. A 300 μmol·L−1 MT solution (dissolved in distilled water) was applied as the treatment, and sterile water was used as the control. The solutions were evenly sprayed onto the fruit surface before harvest until droplets were uniformly and tightly adhered to each fruit without dripping. Fruits with inconsistent size and color on each cluster were removed prior to treatment to ensure that all fruits on the cluster were at the same developmental stage, with uniform size and color. The treated clusters were then labeled accordingly. After fruit maturation, fruits with consistent size, growth status, and maturity, free from mechanical damage or pests, were harvested. A total of about 1300 fruits was harvested for both control and treatment groups, with sampling performed on sunny days. After harvest, the fruit was placed in a cool dark place for about 30 min, and the field heat was removed with a high-power fan, then immediately transported to the laboratory in refrigerated vehicles. All fruits were stored at 4 °C (where water density is maximum and stable, and, theoretically, lower temperatures reduce microbial activity, but freezing below 0 °C may damage blueberry cell walls) and relative humidity of 90–95% for 30 days. The postharvest experiments were conducted from September to October 2024. The fruits of CK and MT groups were stored separately, and each treatment was divided into 4 boxes. Three boxes for each treatment were used to determine the fruit decay rate (100 fruits per box), and 50 fruits were randomly sampled from another box every 6 days. Part of the samples was used for physiological measurements, and the remaining samples were quickly mixed with liquid nitrogen and stored at −80 °C for subsequent analyses. Transcriptome analysis was performed on the MT-treated and CK-treated samples at 0 and 30 days, with each treatment repeated three times.

2.2. Determination of Physiological and Biochemical Indexes

The decay rate (%) was calculated as the ratio of decayed fruits to total fruits, expressed as a percentage. The determination of fruit decay rate under the two groups of treatment with 3 boxes, each box with 100 fruit. Decay was defined as the presence of at least one area of juice leakage or visible mold on the fruit surface. Fruit firmness was measured using a GY firmness meter. The fruit’s horizontal diameter ranged from 16 to 18 mm, and the vertical diameter ranged from 13 to 14 mm. For the firmness measurement, the penetrometer was held with the right hand, ensuring that it was perpendicular to the surface of the fruit. Under uniform pressure, the probe was slowly pressed into the center of the fruit, maintaining a vertical position. The measurement was stopped when the probe reached the scale line, avoiding any rotation or impact. The reading at this point, taken from the inner scale, was recorded as the fruit’s firmness, with the unit expressed in kg/cm2. While soluble solids content (%) was determined using a handheld refractometer (LYT-330, Shanghai Linyu Instrument Co., Ltd., Shanghai, China). AsA content (mg/g) in blueberry fruits was determined using the molybdenum blue colorimetric method [35].
The rate of O2− production (mmol·s−1·kg−1) was measured following the method described by Yang et al. [36], with slight modifications. We weighed 5 g of the sample and placed it in 5.0 mL of phosphate buffer. The fruit tissue was homogenized into a viscous liquid, and then centrifuged at 12,000 rpm for 20 min at 4 °C. The supernatant was extracted and adjusted to a final volume of 1.0 mL. To this, 1.0 mL of phosphate buffer (50.0 mmol/L, pH 7.8) and 1.0 mL of hydroxylamine hydrochloride was added and reacted at 25 °C for 20 min. The reaction solution was then diluted to 0.5 mL, and 0.5 mL of p-aminobenzenesulfonic acid and 0.5 mL of α-naphthylamine were added. After mixing, the solution was incubated at 20 °C for 30 min to allow the color reaction. The absorbance was measured at 530 nm. H2O2 content (μmol/g) was determined according to the TCA-KI method modified from Liu et al. [37]. MDA content (nmol/g) was measured using the TBARS method as described by Zhao et al. [38].
SOD activity (U/min·mg Pro) was assessed using the NBT photochemical reduction method [39], while CAT activity (U/min·mg Pro) was determined using ultraviolet absorption [40]. APX activity was measured following the method described by Cao et al. [41] with minor modifications. We weighed 1 g of the sample and placed it in a pre-cooled mortar. Then, 3 mL of 0.05 mM sodium phosphate buffer was added, and the mixture was homogenized in an ice bath. The homogenate was subsequently centrifuged at 12,000× g for 30 min at 4 °C. The supernatant was collected as the crude enzyme extract and used for subsequent experiments. The absorbance of the reaction system was recorded at 290 nm, and the change in absorbance at 290 nm by 0.01 per minute was defined as one unit (U) of APX enzyme activity.

2.3. Data Analysis

Statistical significance and correlation analyses of the experimental data were performed using SPSS 26.0. Data shown are the means ± standard error (SE) of the three biological replicates. Data were analyzed using one-way ANOVA and the significance of difference between the data sets was analyzed at the level of * p < 0.05 or ** p < 0.01. Charts were created using Excel 2021, Origin 2022, and Chiplot. All experiments were repeated three times.

2.4. Transcriptome Data Analysis

2.4.1. Total RNA Extraction

Total RNA was extracted from blueberry fruit using polysaccharide polyphenol plant RNA extraction kit (DP441, Beijing Tiangen Biotechnology Co., Ltd., Beijing, China). The purity and integrity of RNA were detected using NanoDrop-2000 C spectrophotometer (Semmerfeld Technology, New York, NY, USA) and agarose gel electrophoresis. Based on the Nova Seq TM X Plus platform, the library was sequenced using the PE150 sequencing strategy.

2.4.2. Transcriptome Data Quality Assessment

The quality of transcriptome data was evaluated by analyzing the raw data of transcriptome. The quality of transcriptome data was evaluated using the proportion of Q20%, Q30% and GC% to the total number of bases. After filtration, the proportion of bases with a mass of not less than 20 (Q20) was 98–99%, and the proportion of bases with a mass of not less than 30 (Q30) was 93–97% (Table A1). After filtration, the number of G and C bases accounted for 47–49% of the total number of bases, and the sequencing quality was good. HISAT2 was used to compare the quality-controlled sequence with the reference genome, and string tie was used to quantify the expression of known and new genes and transcripts.

2.4.3. Screening of DEGs and GO, KEGG Pathway Enrichment Analysis

DEGs were identified based on a fold change (FC) ≥ 2 (|log2FC| ≥ 1) and a p-value < 0.05. These genes were then categorized using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses. GO is a gene function database that classifies genes into three categories: Biological Process (BP), Cellular Component (CC), and Molecular Function (MF), with a significance threshold set at p < 0.05. KEGG, which focuses on metabolic pathways, also uses p < 0.05 as the criterion for significant enrichment.

2.5. Quantitative Real-Time PCR (RT-qPCR) Analysis

To validate the transcriptome sequencing results, five differentially expressed genes, Vcev1_p0.Chr03.06495, Vcev1_p0.Chr12.32833, Vcev1_p0.Chr06.16320, Vcev1_p0.C139.66919, and Vcev1_p0.Chr04.10852 (Table A2), were selected for RT-qPCR analysis to examine their expression patterns. cDNA was synthesized using PrimeScript™ Reverse Transcriptase (Takara, Dalian, China; Cat. No. 2680A). RT-qPCR was performed using the SYBR Green Pro Taq HS Premixed qPCR Kit IV (Accurate Biotechnology, Changsha, China, AG11746) on a 7900HT Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). GAPDH (Table A2) was used as the internal reference gene. Gene-specific primers were designed using Primer Premier 6 (listed in the table below) and synthesized by Sangon Biotech (Shanghai) Co., Ltd., Shanghai, China. The relative expression levels of the selected genes were calculated using the 2−ΔΔCt method.

3. Results

3.1. Effects of MT on the Appearance Changes of Blueberry

At 6 days of storage (Figure 1), the bloom on the fruits in the CK group had faded, while it remained largely intact in the MT-treated group. By 12 days (Figure 1), the bloom had completely disappeared from both groups, and water droplets appeared on the fruit surface. During the storage period from 18 to 30 days (Figure 1), both groups reached the decay stage, with distinct differences becoming apparent. At 18 days of storage, both groups exhibited slight cracks, with the CK group showing noticeable oxidation and discoloration of the fruit flesh, while the MT group showed only slight discoloration. From 18 to 24 days of storage, the CK group’s fruit surface progressed from slight shrinkage to cracking and collapse, with an increasing amount of juice leakage and the internal flesh collapsing into a viscous liquid. In contrast, the MT-treated group’s surface showed a gradual worsening of wrinkling and water loss, ranging from moderate to severe, but no cracks or juice leakage occurred, indicating a lower level of decay. Compared to the CK group, the decay of the MT-treated fruit was significantly delayed (Figure 1).

3.2. Effects of MT on the Decay Rate of Blueberry

The blueberry fruits in both the CK and MT groups began to rot after 12 days of storage. Subsequently, the decay rate (Figure 2A) increased with prolonged storage. Between days 18 and 30, the decay rate in the MT-treated group was significantly lower than that of the CK group. After 30 days of storage, the decay rate of CK group was the highest, reaching 57.3%, the decay rate of the MT-treated group was reduced by 63.4% compared to the CK group (p < 0.05).

3.3. Effects of MT on Firmness, Soluble Solids Content (TSS), and Ascorbic Acid (AsA) Levels in Blueberry

The firmness of blueberry fruits in both the CK and MT groups (Figure 2B) declined during storage. By day 12, the firmness of the MT-treated group was significantly higher than that of the CK group (p < 0.05), with a smaller decrease in firmness observed in the MT-treated fruits. No significant difference in fruit firmness was observed between the two groups during the initial 0–6 days of storage. When stored for 30 days, the firmness of the CK group was 0.44 kg/cm2, which decreased to the lowest.
The TSS content of blueberries (Figure 2C) decreased over the storage period. Between 0 and 12 days, the TSS content gradually decreased in both groups. After day 12, the TSS content in the CK group decreased sharply, while by day 30, the TSS content of the CK group decreased to 9.51% and the TSS content in the MT-treated group was 24.5% higher than the CK group.
Similarly, the AsA content in both groups initially increased, peaking at day 6, when the AsA content of CK group was 1.36 mg/g and the AsA content of MT group was 1.51 mg/g, followed by a subsequent decrease. By day 30, the AsA content in the CK group (Figure 2D) had decreased by 26.6%, while the MT-treated group showed a smaller reduction of 19.0%.

3.4. Effects of MT on the Levels of H2O2, O2−, and MDA in Blueberry

During storage, the H2O2 content in both the CK- and MT-treated groups (Figure 2E) increased rapidly, the content of H2O2 in the CK group and MT group reached the peak at 18 days, 6.22 μmol/g and 5.47 μmol/g, respectively, and then decreased slightly between 18 and 24 days. After 24 days, H2O2 levels stabilized in the CK group, while a significant reduction was observed in the MT-treated group. By 30 days, the H2O2 content in MT-treated fruits was 24.8% lower than that of the CK group. A similar trend was observed for O2− levels (Figure 2F), which peaked at 24 days (0.242 mmol·s−1·kg−1 and 0.214 mmol·s−1·kg−1 in CK group and MT group, respectively) and subsequently decreased. From 24 to 30 days, O2− levels in the CK group declined marginally, whereas those in the MT-treated group showed a more substantial reduction, resulting in a 19.3% decrease compared to the CK group at 30 days. Starting at 6 days, both H2O2 and O2− levels in the MT-treated group were significantly lower than those in the CK group (p < 0.05).
The MDA content (Figure 2G) exhibited a continuous increase during storage. Between 0 and 12 days, no significant difference was observed between the two groups (p > 0.05). However, from 12 to 18 days, MDA levels in the MT-treated group began to decline, while they continued to rise in the CK group. After 18 days, the MDA content in the MT-treated group was significantly lower than that in the CK group (p < 0.05). By 30 days, the MDA content of the CK group and MT group increased to 96.64 nmol/g and 73.75 nmol/g, respectively, and the MDA levels in the MT-treated group were 23.7% lower than those in the CK group.

3.5. Effects of MT on SOD, CAT, and APX Activities in Blueberry

SOD activity (Figure 2H) in blueberry fruit exhibited an initial increase followed by a decrease. Both the CK- and MT-treated groups reached their peak SOD activity at 12 days of storage, with 39.92 U/min·mg Pro and 56.84 U/min·mg Pro, respectively. Between 12 and 30 days, the SOD activity in the MT-treated group remained significantly higher than the CK group (p < 0.05).
Similarly, CAT activity (Figure 2I) followed a general trend of rising and then declining over the storage period. During the first 12 days, CAT activity in the CK group was higher than that in the MT-treated group. However, between 18 and 30 days, the CAT activity of the MT-treated group exceeded that of the CK group. The CAT activity of CK group was the highest at 12 d, with 524.85 U/min·mg Pro. The CAT activity of the MT group reached the highest at 18 d, with 561.75 U/min·mg Pro.
The APX activity (Figure 2J) exhibited a pattern comparable to that of SOD activity, with a gradual increase during storage, peaking at 12 days (the APX activity of the CK group and MT group was 492.21 U/min·mg−1 FW and 551.73 U/min·mg−1 FW, respectively), and subsequently declining. Throughout the storage period, the MT-treated group maintained relatively higher APX activity levels compared to the CK group.

3.6. Transcriptome Results

3.6.1. Screening Results of DEGs

In this experiment, two comparisons were made: CK30 vs. CK0 (Figure 3A) and MT30 vs. CK30 (Figure 3B). CK0 was the control group stored for 0 days, CK30 was the control group stored for 30 days, and MT30 was the treatment group stored for 30 days. After 30 days of cold storage, 5157 genes were upregulated and 5088 genes were downregulated in blueberry fruits compared to CK. The MT treatment group showed 338 upregulated genes and 56 downregulated genes after 30 days of cold storage, relative to CK30.

3.6.2. GO Pathway Enrichment Analysis

GO enrichment analysis of the top 20 pathways for the differential genes in the two comparison groups, CK30 vs. CK0 (Figure 4A) and MT30 vs. CK30 (Figure 4B), revealed that in the CK30 vs. CK0 group, differential genes were significantly enriched in processes related to responses to oxidative compounds, toxic substances, stimuli, and organic and inorganic compounds. In contrast, the differential genes in the MT30 vs. CK30 comparison were predominantly enriched in pathways associated with responses to oxidative compounds, lipids, and hormones. Notably, in the MT-treated group, four differential genes were upregulated in the polygalacturonase inhibitor pathway, out of nine background genes, while no such enrichment was observed in the CK30 vs. CK0 group. This suggests that MT treatment promotes polygalacturonase inhibitor activity, thereby delaying cell wall degradation. The enrichment of pathways related to cell wall and plant-type cell wall components in the MT30 vs. CK30 group further supports this finding. These processes may contribute to the regulation of ROS metabolism and delay fruit senescence.

3.6.3. KEGG Pathway Enrichment Analysis

KEGG pathway enrichment analysis of the top 20 pathways in the comparison between CK30 vs. CK0 and MT30 vs. CK30 revealed significant differences. In the CK30 vs. CK0 group, genes involved in the mTOR signaling pathway, insulin signaling pathway, drug metabolism-cytochrome P450, steroid hormone biosynthesis, plant hormone signal transduction, protein kinase synthesis, cytochrome P450-mediated metabolism of xenobiotics, cortisol synthesis and secretion, Mitogen-Activated Protein Kinase (MAPK) signaling pathway-plant, and cytochrome P450 were upregulated (Figure 5A). In contrast, genes involved in phenylalanine, tyrosine, and tryptophan biosynthesis, aldehyde acid and dicarboxylate metabolism, fatty acid elongation, propionate metabolism, lipid biosynthesis, flavonoid biosynthesis, ether lipid metabolism, glycine, serine, and threonine metabolism, glycerophospholipid metabolism, oxidative phosphorylation, steroid biosynthesis, and methane metabolism were downregulated (Figure 5B).
In the MT30 vs. CK30 group, genes associated with calcium signaling, the phosphoinositide signaling system, plant hormone signal transduction, and glutathione γ-glutamylcysteine transferase synthesis were upregulated (Figure 5C). Conversely, genes involved in carbohydrate metabolism, phenylpropanoid biosynthesis, and cellular senescence were downregulated (Figure 5D). Notably, the MAPK signaling pathway, a key mechanism for plant responses to environmental stress [42], was enriched and upregulated in the CK30 vs. CK0 group, whereas it was downregulated in the MT30 vs. CK30 group. This suggests that the CK group is more susceptible to ROS production, while the MT group appears to suppress the activation of this signaling pathway.

3.7. RT-qPCR Gene Expression Analysis

Five genes (Vcev1_p0.Chr03.06495, Vcev1_p0.Chr12.32833, Vcev1_p0.Chr06.16320, Vcev1_p0.C139.66919, and Vcev1_p0.Chr04.10852) were randomly selected from the transcriptome for RT-qPCR validation (Figure 6). The expression profiles of these genes were consistent with the trends observed in the RNA-Seq data. This indicates that the RNA-Seq data accurately reflect the transcriptional levels of genes in blueberry fruits, demonstrating high reproducibility and reliability.

3.8. Correlation Analysis Between Physiological Parameters and Gene Expression in Blueberry Under MT Treatment

To investigate the physiological and molecular responses of blueberry fruits under exogenous MT treatment during storage, a correlation analysis was performed on 14 indicators, including physiological parameters and gene expression levels, for both the CK and MT treatment groups (Figure 7). The results indicated that during storage, fruit firmness, TSS, and AsA content were significantly negatively correlated with decay rate, O2−, H2O2, and MDA content; significantly positively correlated with SOD and APX activities; and negatively correlated with CAT activity. SOD activity was significantly positively correlated with the expression of VcSOD1 and VcSOD2. APX activity showed a significant positive correlation with VcAPX3 expression, while CAT activity was significantly negatively correlated with VcCAT1 expression.

4. Discussion

Blueberry fruit is challenging to store postharvest, with decay and senescence being key factors affecting fruit quality. These phenomena are typically associated with the loss of nutrients and decline in fruit quality. In this study, a treatment with 300 μmol·L−1 MT during the pink fruit color stage significantly reduced the decay rate during postharvest storage. These findings are consistent with previous studies by Daniel et al. [43] in Early Sweet Cherry fruit and ref. [25] in plum fruit, suggesting that MT may help enhance fruit firmness, TSS, and AsA content, thereby mitigating the occurrence of soft rot diseases.
Postharvest fruit senescence is an extremely complex physiological and biochemical process, during which the weakening of ROS scavenging capacity leads to the accumulation of ROS, such as O2− and H2O2, resulting in oxidative damage and tissue senescence [44]. In this study, the levels of O2−, H2O2, and MDA in blueberry fruit showed a general increasing trend during storage (Figure 4). This suggests that MT can influence the levels of ROS radicals, including O2−, H2O2, and MDA, within the fruit, leading to changes in the unsaturated fatty acid content and the generation of highly oxidative hydroxyl radicals (·OH), which in turn directly promote lipid peroxidation reactions [5]. Moreover, the correlation analysis heatmap (Figure 7) showed a significant positive correlation between fruit rot rate and the contents of O2−, H2O2, and MDA, indicating that the intensification of senescence and decay is closely associated with the accumulation of these ROS species.
The ROS scavenging system in plants consists of enzymatic and non-enzymatic antioxidants. Non-enzymatic antioxidants are particularly crucial in the process of aging, as they play a vital role in mitigating oxidative stress induced by ROS and delaying cellular aging [45]. In this study, treatment with 300 μmol·L−1 MT during the pink fruit stage reduced the accumulation of H2O2, MDA, and O2− in blueberries during storage, while increasing the AsA levels. These results are consistent with previous studies on MT in fruits such as lychee [46] and cantaloupe [47]. The ascorbate–glutathione (AsA-GSH) cycle, as the most important non-enzymatic antioxidant system, directly scavenges H2O2 produced within the fruit [48]. Therefore, exogenous MT treatment may enhance the ROS-scavenging capacity of blueberries by inhibiting AsA degradation or promoting its biosynthesis. This may be one of the key reasons for the observed increase in AsA levels. Furthermore, the correlation analysis revealed a significant negative correlation between AsA content and ROS levels, which supports this conclusion.
SOD, CAT, and APX are key antioxidant enzymes involved in delaying fruit senescence. As enzymatic antioxidants, they efficiently scavenge ROS in plant cells. Specifically, SOD catalyzes the conversion of O2− to H2O2 and O2, after which CAT and APX catalyze the reduction of H2O2 to H2O and O2 [49,50]. A study by Cuypers et al. [51] found that CAT and APX, as two distinct antioxidant enzymes, exhibit different affinities for H2O2 during storage. In this study, the activities of SOD and APX in the MT-treated group increased rapidly during the first 0–12 days of storage, reaching their highest levels on day 12, indicating that the defense system in blueberry fruit was activated to eliminate the H2O2 and O2− generated early in storage. From days 12 to 18, both treatment groups exhibited a decrease in SOD and APX activity, while CAT activity rose sharply to clear the continuously produced H2O2. Throughout the entire storage period, SOD, CAT, and APX played crucial roles in maintaining ROS at relatively low levels within the fruit. Transcriptomic data indicated that MT treatment upregulated the expression of VcSOD1, VcSOD2, and VcAPX3, which may be the primary reason for the activation and enhancement of SOD and APX activities. Previous studies have shown that MT treatment upregulates the genes encoding Cu/Zn-SOD, Mn-SOD, APX, and CAT in two sweet cherry cultivars, thereby improving fruit quality during refrigeration [52]. In this study, the 300 μmol·L−1 MT treatment during the pink fruit stage enhanced the activities of SOD, CAT, and APX during storage, effectively maintaining fruit quality and antioxidant capacity, while reducing the degree of fruit decay. Furthermore, the AsA content in the fruit under exogenous MT treatment was positively correlated with SOD and APX activity, as well as the expression levels of the genes VcSOD1, VcSOD2, and VcAPX3 (Figure 7). This result further corroborates the synergistic regulation of enzymatic and non-enzymatic antioxidants in maintaining the ROS metabolic balance during fruit storage [53]. Notably, in this study, the transcription levels of the VcCAT1 gene showed inconsistent results with changes in enzyme activity, which might be due to a delay in gene expression changes relative to physiological changes. Gene expression regulation involves complex processes such as transcription, translation, and post-translational modifications, which typically require a certain amount of time to reflect changes in physiological states [54].
Mitochondria are the primary sites of ROS production, and mitochondrial uncoupling proteins regulate the mitochondrial proton gradient, maintaining the intracellular ROS balance and reducing the accumulation of excess ROS, thereby preventing oxidative damage in fruits. This concept is further supported by studies from Peng et al. and Gleason et al. [55,56]. Based on the KEGG pathway enrichment results, the regulation of mitochondrial uncoupling protein synthesis pathways was significantly enriched under exogenous MT treatment, and the expression of the PUMP5 gene was upregulated. This suggests that the 300 μmol·L−1 MT treatment during the pink fruit stage may modulate mitochondrial respiration by promoting the biosynthesis of uncoupling proteins, which in turn positively impacts ROS production and clearance.
In addition, pathways such as calcium signaling and phosphoinositide signaling were significantly enriched, suggesting that these processes may play an important role in modulating ROS metabolism. The accumulation of calcium ions plays a crucial role in cellular energy metabolism and helps mitigate oxidative damage to the plasma membrane [57]. The phosphatidylinositol signaling system, through phosphatidylinositol 3-phosphate (PIP3) and other phosphorylated forms of lipids, regulates the fluidity and stability of the cell membrane, thereby influencing the activity of enzymes associated with ROS production, such as NADPH oxidase [58,59]. By modulating the activity of these enzymes, the phosphatidylinositol signaling system may slow down ROS generation. Moreover, activation of the PI signaling pathway can promote the synthesis of enzymes related to antioxidation, such as peroxidase (POX), SOD, and CAT, which effectively eliminate ROS from the cell [60]. The results of this study revealed that genes associated with carbohydrate metabolism, cellular senescence, and other processes were significantly downregulated in the MT30 vs. CK30 comparison group, indicating that MT treatment inhibits these processes during storage. This effect may be attributed to the ability of MT to effectively slow down respiration, sugar consumption, and starch degradation during storage, thereby helping to maintain fruit quality and extend shelf life. Additionally, MT treatment also alleviated age-related processes, such as membrane damage and cell wall degradation, further regulating fruit senescence through multiple mechanisms. Therefore, we propose that the 300 μmol·L−1 MT treatment during the fruit color transition stage may delay postharvest senescence in blueberry fruits through the direct or indirect modulation of various response processes, metabolic pathways, and enzyme synthesis, though the underlying complex mechanisms warrant further investigation.

5. Conclusions

Treatment with 300 μmol·L−1 MT during the pink fruit stage effectively delayed the decay of blueberry fruits stored at 4 °C postharvest, while also maintaining the fruit firmness, TSS, and AsA content during storage. It reduced the accumulation of harmful substances, such as H2O2, O2−, and MDA, and increased the activity of antioxidant enzymes including SOD, CAT, and APX. These findings suggest that MT treatment positively contributes to enhancing the antioxidant capacity of postharvest blueberries, alleviating ROS-induced cellular damage, and delaying fruit senescence. Furthermore, transcriptome analysis revealed that, under a 300 μmol·L−1 MT treatment at the pink fruit stage, genes related to fruit antioxidant activity, including VcAPX3, VcSOD1, and VcSOD2, were upregulated. Additionally, multiple response pathways significantly enriched in calcium signaling, mitochondrial uncoupling protein synthesis, phosphatidylinositol signaling, carbohydrate metabolism, and cellular senescence were found to be involved in fruit aging. Genes such as PUMP5, potentially influencing ROS metabolism, also exhibited an upregulation trend. These results provide a deeper and more comprehensive understanding of ROS metabolism and fruit decay during storage, laying the foundation for future research into the regulatory mechanisms of MT in postharvest fruit aging. Notably, exogenous MT application during the growth and development stages of blueberries may enhance the synthesis of endogenous MT, thus promoting the signaling of antioxidant pathways and delaying postharvest fruit senescence, although the specific regulatory mechanisms still require further investigation.

Author Contributions

Conceptualization, L.W. and Y.W.; methodology, J.L. (Jie Li) and J.L. (Jinying Li); software, J.L. (Jie Li) and C.L.; validation, J.L. (Jinying Li); formal analysis, J.L. (Jie Li), Y.L. and C.L.; investigation, Y.L. and Z.H.; resources, H.L. and L.W.; data curation, J.L. (Jie Li), C.L. and Z.H.; writing—original draft preparation, J.L. (Jie Li) and L.W.; writing—review and editing, L.W.; visualization, Y.L., Z.H. and H.L.; supervision, J.L. (Jinying Li) and H.L.; project administration, Y.W.; funding acquisition, Y.W. and L.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research received funding from the Natural Science Foundation of Jilin Province (20240101209JC), the National College Students’ innovation and entrepreneurship training program (202310193007), the Jilin Provincial College Students’ innovation and entrepreneurship training program (S202410193142), the National College Students’ Innovation and Entrepreneurship Training Program Research on morphological changes and physiological response mechanism of blueberry plants under chlorine stress, the Jilin Province Forestry and Grassland Bureau project (JLT2022-01), and the Jingyu County Science and Technology Development Plan Project (XBJ202016).

Data Availability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Agronomy 15 00428 g0a1
Figure A1. Decay rate of blueberry fruits under different treatments after 30 days of storage. Among them, 100, 200, 300, and 400 represent different concentrations of melatonin solutions (μmol·L−1), with CK as the control. The decay rate of fruits treated with 300 μmol·L−1 MT at the pink fruit stage was significantly lower than that of the CK group (p < 0.05), demonstrating the best storage efficacy. Different letters indicate significant differences between different treatments (p < 0.05).
Figure A1. Decay rate of blueberry fruits under different treatments after 30 days of storage. Among them, 100, 200, 300, and 400 represent different concentrations of melatonin solutions (μmol·L−1), with CK as the control. The decay rate of fruits treated with 300 μmol·L−1 MT at the pink fruit stage was significantly lower than that of the CK group (p < 0.05), demonstrating the best storage efficacy. Different letters indicate significant differences between different treatments (p < 0.05).
Agronomy 15 00428 g0a1
Table A1. Raw and filtered reads, total base pairs, percentage of bases with a Phred score greater than 20, percentage of bases with a Phred score greater than 30, and the percentage of G and C bases in the filtered reads for each sample.
Table A1. Raw and filtered reads, total base pairs, percentage of bases with a Phred score greater than 20, percentage of bases with a Phred score greater than 30, and the percentage of G and C bases in the filtered reads for each sample.
SampleRaw Data ReadsRaw Data BasesRaw Data q20%Raw Data q30%Clean Data ReadsClean Data BasesClean Data q20%Clean Data q30%GC%
CK0 1447970906.72G98.73%96.28%436791906.53G99.16%97.14%48.11%
CK0 2481650527.22G98.81%96.50%471369947.05G99.19%97.26%47.87%
CK0 3416175646.24G98.61%95.90%398417185.96G99.18%97.18%48.18%
CK30 1481522627.22G97.63%93.22%473227287.06G98.07%94.00%47.80%
CK30 2411637246.17G97.4392.79%399502665.96G98.01%93.82%47.78%
CK30 3386130965.79G97.43%92.8%369615585.51G98.10%94.08%47.84%
MT0 1413047546.20G98.61%95.97%398933125.97G99.12%97.04%48.11%
MT0 2420005806.30G98.62%96.00%408536626.11G99.10%96.95%49.00%
MT0 3479478067.19G98.67%96.13%465361606.96G99.14%97.11%47.58%
MT30 1464887326.97G97.48%92.92%452694106.74G98.05%93.96%48.06%
MT30 2436624486.55G97.52%92.99%426859986.35G98.03%93.89%48.17%
MT30 3454540546.82G97.52%93.02%426859986.67G98.00%93.83%47.94%
Table A2. Names and primer sequences of reference genes and differentially expressed genes.
Table A2. Names and primer sequences of reference genes and differentially expressed genes.
GenePrimersSequence (5′ → 3′)
GAPDHFCGGCTACTTACGAGCAAATCAA
RTTCAGTGTAGCCCAAAATTCCTTT
Vcev1_p0.Chr03.06495FCCGATGATACCACAGGCAAT
RAGATCCCTCTTTCAGGACCACATTC
Vcev1_p0.Chr12.32833FATTGCTAATGCTGATGGTAAGGTG
RCCAGTCGTAAGGCTAAGTTCGTG
Vcev1_p0.Chr06.16320FTCTCAAACCCTAACAACAACCC
RGTAACGACGCCTTCAACGGA
Vcev1_p0.C139.66919FGTGAAGTTTTACACCAGGGAGG
RCTTGGGGTTAGGTTTAAGAGCA
Vcev1_p0.Chr04.10852FTCTCATCTGCGTGATGTTTTCTAC
RAACCACTGCGTTCTGGTCTG

References

  1. Duan, Y.; Tarafdar, A.; Chaurasia, D.; Singh, A.; Bhargava, P.C.; Yang, J.; Li, Z.; Ni, X.; Tian, Y.; Li, H.; et al. Blueberry fruit valorization and valuable constituents: A review. Int. J. Food Microbiol. 2022, 381, 109890. [Google Scholar] [CrossRef]
  2. Sater, H.; Ferrão, L.F.V.; Olmstead, J.; Munoz, P.R.; Bai, J.; Hopf, A.; Plotto, A. Exploring environmental and storage factors affecting sensory, physical and chemical attributes of six southern highbush blueberry cultivars. Sci. Hortic. 2021, 289, 110468. [Google Scholar] [CrossRef]
  3. Dong, M.; Tian, Y.; Dong, K.; Li, Y.; Sun, H. Isolation and Identification of Root-Associated Symbiotic Fungi of Lowbush Blueberry ’Meidong’. J. Jilin Agric. Univ. 2019, 41, 419–425. [Google Scholar] [CrossRef]
  4. Han, P.; Zhang, B.; Feng, X.; Huang, X.; Li, M.; Yang, F. Nutritional and Health Benefits of Blueberry and Its Development and Utilization. Food Ind. Technol. 2015, 6, 370–375+379. [Google Scholar] [CrossRef]
  5. Wang, C.; Gao, Y.; Tao, Y.; Wu, X.; Zhibo, C. Influence of γ-irradiation on the reactive-oxygen metabolism of blueberry fruit during cold storage. Innov. Food Sci. Emerg. Technol. 2017, 41, 397–403. [Google Scholar] [CrossRef]
  6. Mannozzi, C.; Tylewicz, U.; Chinnici, F.; Siroli, L.; Rocculi, P.; Dalla Rosa, M.; Romani, S. Effects of chitosan based coatings enriched with procyanidin by-product on quality of fresh blueberries during storage. Food Chem. 2018, 251, 18–24. [Google Scholar] [CrossRef]
  7. Kurniawan, O.; Wilson, K.; Mohamed, R.; Avis, T.J. Bacillus and Pseudomonas spp. provide antifungal activity against gray mold and Alternaria rot on blueberry fruit. Biol. Control 2018, 126, 136–141. [Google Scholar] [CrossRef]
  8. Chiabrando, V.; Giacalone, G. Shelf-life extension of highbush blueberry using 1-methylcyclopropene stored under air and controlled atmosphere. Food Chem. 2011, 126, 1812–1816. [Google Scholar] [CrossRef]
  9. Rivera, S.; Kerckhoffs, H.; Sofkova-Bobcheva, S.; Hutchins, D.; East, A. Influence of harvest maturity and storage technology on mechanical properties of blueberries. Postharvest Biol. Technol. 2022, 191, 111961. [Google Scholar] [CrossRef]
  10. Chea, S.; Yu, D.J.; Park, J.; Oh, H.D.; Chung, S.W.; Lee, H.J. Preharvest β-aminobutyric acid treatment alleviates postharvest deterioration of ‘Bluecrop’ highbush blueberry fruit during refrigerated storage. Sci. Hortic. 2019, 246, 95–103. [Google Scholar] [CrossRef]
  11. Debnath, B.; Islam, W.; Li, M.; Sun, Y.; Lu, X.; Mitra, S.; Hussain, M.; Liu, S.; Qiu, D. Melatonin Mediates Enhancement of Stress Tolerance in Plants. Int. J. Mol. Sci. 2019, 20, 1040. [Google Scholar] [CrossRef] [PubMed]
  12. Mauriz, J.L.; Collado, P.S.; Veneroso, C.; Reiter, R.J.; González-Gallego, J. A review of the molecular aspects of melatonin’s anti-inflammatory actions: Recent insights and new perspectives. J. Pineal Res. 2013, 54, 1–14. [Google Scholar] [CrossRef] [PubMed]
  13. Ramakrishna, A.; Giridhar, P.; Sankar, K.U.; Ravishankar, G.A. Melatonin and serotonin profiles in beans of Coffea species. J. Pineal Res. 2012, 52, 470–476. [Google Scholar] [CrossRef] [PubMed]
  14. Sae-Teaw, M.; Johns, J.; Johns, N.P.; Subongkot, S. Serum melatonin levels and antioxidant capacities after consumption of pineapple, orange, or banana by healthy male volunteers. J. Pineal Res. 2013, 55, 58–64. [Google Scholar] [CrossRef] [PubMed]
  15. Arnao, M.B.; Hernández-Ruiz, J. The Potential of Phytomelatonin as a Nutraceutical. Molecules 2018, 23, 238. [Google Scholar] [CrossRef]
  16. Rastegar, S.; Hassanzadeh Khankahdani, H.; Rahimzadeh, M. Effects of melatonin treatment on the biochemical changes and antioxidant enzyme activity of mango fruit during storage. Sci. Hortic. 2020, 259, 108835. [Google Scholar] [CrossRef]
  17. Shekari, A.; Hassani, R.N.; Aghdam, M.S.; Rezaee, M.; Jannatizadeh, A. The effects of melatonin treatment on cap browning and biochemical attributes of Agaricus bisporus during low temperature storage. Food Chem. 2021, 348, 129074. [Google Scholar] [CrossRef]
  18. Nawaz, M.A.; Huang, Y.; Bie, Z.; Ahmed, W.; Reiter, R.J.; Niu, M.; Hameed, S. Melatonin: Current Status and Future Perspectives in Plant Science. Front. Plant Sci. 2016, 6, 1230. [Google Scholar] [CrossRef]
  19. Guillén, F.; Medina-Santamarina, J.; García-Pastor, M.E.; Chen, N.J.; Uruu, G.; Paull, R.E. Postharvest melatonin treatment delays senescence and increases chilling tolerance in pineapple. LWT 2022, 169, 113989. [Google Scholar] [CrossRef]
  20. Fekry, W.M.E.; Rashad, Y.M.; Alaraidh, I.A.; Mehany, T. Exogenous Application of Melatonin and Methyl Jasmonate as a Pre-Harvest Treatment Enhances Growth of Barhi Date Palm Trees, Prolongs Storability, and Maintains Quality of Their Fruits under Storage Conditions. Plants 2022, 11, 96. [Google Scholar] [CrossRef]
  21. Waszczak, C.; Carmody, M.; Kangasjärvi, J. Reactive Oxygen Species in Plant Signaling. Annu. Rev. Plant Biol. 2018, 69, 209–236. [Google Scholar] [CrossRef] [PubMed]
  22. Rabiei, V.; Kakavand, F.; Zaare-Nahandi, F.; Razavi, F.; Aghdam, M.S. Nitric oxide and γ-aminobutyric acid treatments delay senescence of cornelian cherry fruits during postharvest cold storage by enhancing antioxidant system activity. Sci. Hortic. 2019, 243, 268–273. [Google Scholar] [CrossRef]
  23. Akram, N.A.; Shafiq, F.; Ashraf, M. Ascorbic Acid-A Potential Oxidant Scavenger and Its Role in Plant Development and Abiotic Stress Tolerance. Front. Plant Sci. 2017, 8, 613. [Google Scholar] [CrossRef] [PubMed]
  24. Charoenphun, N.; Pham, N.H.; Rattanawut, J.; Venkatachalam, K. Exogenous Application of Melatonin on the Preservation of Physicochemical and Enzymatic Qualities of Pepper Fruit from Chilling Injury. Horticulturae 2024, 10, 550. [Google Scholar] [CrossRef]
  25. Bal, E. Physicochemical changes in ‘Santa Rosa’ plum fruit treated with melatonin during cold storage. J. Food Meas. Charact. 2019, 13, 1713–1720. [Google Scholar] [CrossRef]
  26. Menaka, M.; Asrey, R.; Meena, N.K.; Vargheese, E.; Sethi, S.; Ahamad, S.; Goswami, A.K. Effect of melatonin on biochemical changes, antioxidant system and oxidative membrane damage of Indian guava (cv. Barafkhana) during cold storage. S. Afr. J. Bot. 2024, 169, 95–108. [Google Scholar] [CrossRef]
  27. Mohd Yusof, F.A.; Azman, E.M.; Mohd Adzahan, N.; Yusof, N.L. Effect of vacuum impregnation with melatonin, γ-aminobutyric acid, and oxalic acid on chilling injury and quality of carambola. Int. J. Food Sci. Technol. 2023, 58, 6432–6444. [Google Scholar] [CrossRef]
  28. Promyou, S.; Raruang, Y.; Chen, Z.-Y. Melatonin Treatment of Strawberry Fruit during Storage Extends Its Post-Harvest Quality and Reduces Infection Caused by Botrytis cinerea. Foods 2023, 12, 1445. [Google Scholar] [CrossRef] [PubMed]
  29. Bal, E.; Torçuk, A.İ.; Özer, C. Influence of Melatonin Treatments on Fruit Quality and Storage Life of Sweet Cherry cv. ‘Sweetheart’. Erwerbs-Obstbau 2022, 64, 127–133. [Google Scholar] [CrossRef]
  30. Kakaei, S.; Koushesh Saba, M.; Mansouri, S.; Darvishi, H. Melatonin postharvest spray influence on white mulberry browning, storage life, and biochemical changes. Postharvest Biol. Technol. 2024, 213, 112947. [Google Scholar] [CrossRef]
  31. Zhai, R.; Liu, J.; Liu, F.; Zhao, Y.; Liu, L.; Fang, C.; Wang, H.; Li, X.; Wang, Z.; Ma, F.; et al. Melatonin limited ethylene production, softening and reduced physiology disorder in pear (Pyrus communis L.) fruit during senescence. Postharvest Biol. Technol. 2018, 139, 38–46. [Google Scholar] [CrossRef]
  32. Xu, R.; Wang, L.; Li, K.; Cao, J.; Zhao, Z. Integrative transcriptomic and metabolomic alterations unravel the effect of melatonin on mitigating postharvest chilling injury upon plum (cv.Friar) fruit. Postharvest Biol. Technol. 2022, 186, 111819. [Google Scholar] [CrossRef]
  33. Belay, Z.A.; James Caleb, O. Role of integrated omics in unravelling fruit stress and defence responses during postharvest: A review. Food Chem. Mol. Sci. 2022, 5, 100118. [Google Scholar] [CrossRef]
  34. Li, J.; Lu, C.; Wu, L.; Li, J.; Li, Y.; Wang, Y. Effects of Exogenous Melatonin Treatment on Postharvest Quality and Storage Tolerance of Blueberry. J. Jilin Agric. Univ. 2025, 1–14. [Google Scholar] [CrossRef]
  35. Wang, Y.; Gao, L.; Wang, Q.; Zuo, J. Low temperature conditioning combined with methyl jasmonate can reduce chilling injury in bell pepper. Sci. Hortic. 2019, 243, 434–439. [Google Scholar] [CrossRef]
  36. Yang, W.; Liu, Y.; Sang, Y.; Ma, Y.; Guo, M.; Bai, G.; Cheng, S.; Chen, G. Influences of ice-temperature storage on cell wall metabolism and reactive oxygen metabolism in Xinjiang (Diaogan) apricot. Postharvest Biol. Technol. 2021, 180, 111614. [Google Scholar] [CrossRef]
  37. Liu, C.; Zheng, H.; Sheng, K.; Liu, W.; Zheng, L. Effects of melatonin treatment on the postharvest quality of strawberry fruit. Postharvest Biol. Technol. 2018, 139, 47–55. [Google Scholar] [CrossRef]
  38. Zhao, H.; Lv, W.; Fan, Y.; Li, H. Gibberellic acid enhances postharvest toon sprout tolerance to chilling stress by increasing the antioxidant capacity during the short-term cold storage. Sci. Hortic. 2018, 237, 184–191. [Google Scholar] [CrossRef]
  39. Chen, H.; Gao, H.; Fang, X.; Ye, L.; Zhou, Y.; Yang, H. Effects of allyl isothiocyanate treatment on postharvest quality and the activities of antioxidant enzymes of mulberry fruit. Postharvest Biol. Technol. 2015, 108, 61–67. [Google Scholar] [CrossRef]
  40. Hu, Q.D.L. Biochemical Experiments; Chemical Industry Publishing House: Beijing, China, 2007. [Google Scholar]
  41. Cao, J.K.; Jiang, W.B.; Zhao, Y.M. Postharvest Physiological and Biochemical Experiments of Fruits and Vegetables; China Light Industry Press: Beijing, China, 2007. [Google Scholar]
  42. Zhang, M.; Zhang, Q.; Tian, C.; Liu, G.; Pan, Y.; Xu, X.; Shi, X.; Zhang, Z.; Meng, L. Physiological and Transcriptome Analyses of CaCl2 Treatment to Alleviate Chilling Injury in Pineapple. Plants 2022, 11, 2215. [Google Scholar] [CrossRef]
  43. Cortés-Montaña, D.; Bernalte-García, M.J.; Velardo-Micharet, B.; Serrano, M.; Serradilla, M.J. Impact of Pre-Storage Melatonin Application on the Standard, Sensory, and Bioactive Quality of Early Sweet Cherry. Foods 2023, 12, 1723. [Google Scholar] [CrossRef]
  44. Xie, J.; Qin, Z.; Pan, J.; Li, J.; Li, X.; Khoo, H.E.; Dong, X. Melatonin treatment improves postharvest quality and regulates reactive oxygen species metabolism in “Feizixiao” litchi based on principal component analysis. Front. Plant Sci. 2022, 13, 965345. [Google Scholar] [CrossRef] [PubMed]
  45. Ahmad, P.; Jaleel, C.A.; Salem, M.A.; Nabi, G.; Sharma, S. Roles of enzymatic and nonenzymatic antioxidants in plants during abiotic stress. Crit. Rev. Biotechnol. 2010, 30, 161–175. [Google Scholar] [CrossRef] [PubMed]
  46. Marak, K.A.; Mir, H.; Singh, P.; Siddiqui, M.W.; Ranjan, T.; Singh, D.R.; Siddiqui, M.H.; Irfan, M. Exogenous melatonin delays oxidative browning and improves postharvest quality of litchi fruits. Sci. Hortic. 2023, 322, 112408. [Google Scholar] [CrossRef]
  47. Wang, Y.; Guo, M.; Zhang, W.; Gao, Y.; Ma, X.; Cheng, S.; Chen, G. Exogenous melatonin activates the antioxidant system and maintains postharvest organoleptic quality in Hami melon (Cucumis. melo var. inodorus Jacq.). Front. Plant Sci. 2023, 14, 1274939. [Google Scholar] [CrossRef] [PubMed]
  48. Sang, Y.; Liu, Y.; Tang, Y.; Yang, W.; Guo, M.; Chen, G. Transcriptome sequencing reveals mechanism of improved antioxidant capacity and maintained postharvest quality of winter jujube during cold storage after salicylic acid treatment. Postharvest Biol. Technol. 2022, 189, 111929. [Google Scholar] [CrossRef]
  49. Larrigaudière, C.; Vilaplana, R.; Soria, Y.; Recasens, I. Oxidative behaviour of Blanquilla pears treated with 1-methylcyclopropene during cold storage. J. Sci. Food Agric. 2004, 84, 1871–1877. [Google Scholar] [CrossRef]
  50. Gao, H.; Zhang, Z.K.; Chai, H.K.; Cheng, N.; Yang, Y.; Wang, D.N.; Yang, T.; Cao, W. Melatonin treatment delays postharvest senescence and regulates reactive oxygen species metabolism in peach fruit. Postharvest Biol. Technol. 2016, 118, 103–110. [Google Scholar] [CrossRef]
  51. Cuypers, A.; Karen, S.; Jos, R.; Kelly, O.; Els, K.; Tony, R.; Nele, H.; Nathalie, V.; Suzy, V.S.; Frank, V.B.; et al. The cellular redox state as a modulator in cadmium and copper responses in Arabidopsis thaliana seedlings. J. Plant Physiol. 2011, 168, 309–316. [Google Scholar] [CrossRef] [PubMed]
  52. Miranda, S.; Vilches, P.; Suazo, M.; Pavez, L.; García, K.; Méndez, M.A.; González, M.; Meisel, L.A.; Defilippi, B.G.; del Pozo, T. Melatonin triggers metabolic and gene expression changes leading to improved quality traits of two sweet cherry cultivars during cold storage. Food Chem. 2020, 319, 126360. [Google Scholar] [CrossRef]
  53. Dong, Y.; Zhi, H.H.; Xu, J.; Zhang, L.H.; Liu, M.P.; Zong, W. Effect of methyl jasmonate on reactive oxygen species, antioxidant systems, and microstructure of Chinese winter jujube at two major ripening stages during shelf life. J. Hortic. Sci. Biotechnol. 2016, 91, 316–323. [Google Scholar] [CrossRef]
  54. Zhang, L.; Kou, X.; Huang, X.; Li, G.; Liu, J.; Ye, J. Peach-gum: A promising alternative for retarding the ripening and senescence in postharvest peach fruit. Postharvest Biol. Technol. 2020, 161, 111088. [Google Scholar] [CrossRef]
  55. Peng, Z.; Fu, D. Effects of 1-methylcyclopropene treatment on the quality of red ‘Fuji’ apples fruit during short-term storage. Food Qual. Saf. 2023, 7, fyac074. [Google Scholar] [CrossRef]
  56. Gleason, C.; Huang, S.; Thatcher, L.F.; Foley, R.C.; Anderson, C.R.; Carroll, A.J.; Millar, A.H.; Singh, K.B. Mitochondrial complex II has a key role in mitochondrial-derived reactive oxygen species influence on plant stress gene regulation and defense. Proc. Natl. Acad. Sci. USA 2011, 108, 10768–10773. [Google Scholar] [CrossRef] [PubMed]
  57. Luo, D.; Huang, T.; Kou, X.; Zhang, Y.; Ba, L.; Wang, X.; Cao, S. MeJA enhances antioxidant activity and reduces membrane lipid degradation by maintaining energy charge levels in crystal grapes. Postharvest Biol. Technol. 2024, 216, 113078. [Google Scholar] [CrossRef]
  58. Leshem, Y.; Seri, L.; Levine, A. Induction of phosphatidylinositol 3-kinase-mediated endocytosis by salt stress leads to intracellular production of reactive oxygen species and salt tolerance. Plant J. 2007, 51, 185–197. [Google Scholar] [CrossRef] [PubMed]
  59. Oikawa, K.; Goto-Yamada, S.; Hayashi, Y.; Takahashi, D.; Kimori, Y.; Shibata, M.; Yoshimoto, K.; Takemiya, A.; Kondo, M.; Hikino, K.; et al. Pexophagy suppresses ROS-induced damage in leaf cells under high-intensity light. Nat. Commun. 2022, 13, 7493. [Google Scholar] [CrossRef] [PubMed]
  60. Yang, W.; Li, L.; Liu, Y.; Zhang, W.; Guo, M.; Chen, G. MeJA and MeSA alleviate black rot in winter jujube caused by Alternaria tenuissima by regulating membrane lipid and reactive oxygen metabolism. Postharvest Biol. Technol. 2025, 219, 113275. [Google Scholar] [CrossRef]
Agronomy 15 00428 g001
Figure 1. Appearance changes of blueberry under CK and MT treatments during storage at 0, 6, 12, 18, 24, and 30 days.
Figure 1. Appearance changes of blueberry under CK and MT treatments during storage at 0, 6, 12, 18, 24, and 30 days.
Agronomy 15 00428 g001
Agronomy 15 00428 g002aAgronomy 15 00428 g002b
Figure 2. Changes in decay rate (A), firmness (B), TSS (C), AsA (D), H2O2 (E), O2− (F), MDA (G) content, and the activities of SOD (H), CAT (I), and APX (J) in blueberry fruits during storage after treatment with sterile water (CK) and MT (MT). Asterisks * and ** indicate significant differences between the control and treatment groups (*: p < 0.05; **: p < 0.01).
Figure 2. Changes in decay rate (A), firmness (B), TSS (C), AsA (D), H2O2 (E), O2− (F), MDA (G) content, and the activities of SOD (H), CAT (I), and APX (J) in blueberry fruits during storage after treatment with sterile water (CK) and MT (MT). Asterisks * and ** indicate significant differences between the control and treatment groups (*: p < 0.05; **: p < 0.01).
Agronomy 15 00428 g002aAgronomy 15 00428 g002b
Agronomy 15 00428 g003
Figure 3. Volcano plot of differential gene expression for CK30 vs. CK0 (A) and MT30 vs. CK30 (B).
Figure 3. Volcano plot of differential gene expression for CK30 vs. CK0 (A) and MT30 vs. CK30 (B).
Agronomy 15 00428 g003
Agronomy 15 00428 g004
Figure 4. GO enrichment circle plot for the CK30 vs. CK0 group (A) and the MT30 vs. CK30 group (B).
Figure 4. GO enrichment circle plot for the CK30 vs. CK0 group (A) and the MT30 vs. CK30 group (B).
Agronomy 15 00428 g004
Agronomy 15 00428 g005
Figure 5. Upregulated (A) and downregulated (B) KEGG pathways in the top 20 for the CK30 vs. CK0 group, and upregulated (C) and downregulated (D) KEGG pathways in the top 20 for the MT30 vs. CK30 group.
Figure 5. Upregulated (A) and downregulated (B) KEGG pathways in the top 20 for the CK30 vs. CK0 group, and upregulated (C) and downregulated (D) KEGG pathways in the top 20 for the MT30 vs. CK30 group.
Agronomy 15 00428 g005
Agronomy 15 00428 g006
Figure 6. RT-qPCR validation results. The white bars represent RT-qPCR expression levels, while the gray bars represent RNA-Seq expression levels.
Figure 6. RT-qPCR validation results. The white bars represent RT-qPCR expression levels, while the gray bars represent RNA-Seq expression levels.
Agronomy 15 00428 g006
Agronomy 15 00428 g007
Figure 7. Correlation heatmap between physiological parameters and gene expression in blueberry under MT treatment (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001).
Figure 7. Correlation heatmap between physiological parameters and gene expression in blueberry under MT treatment (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001).
Agronomy 15 00428 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Wang, Y.; Li, J.; Li, Y.; Lu, C.; Hou, Z.; Liu, H.; Wu, L. Exogenous Melatonin Application Delays Senescence and Improves Postharvest Antioxidant Capacity in Blueberries. Agronomy 2025, 15, 428. https://doi.org/10.3390/agronomy15020428

AMA Style

Li J, Wang Y, Li J, Li Y, Lu C, Hou Z, Liu H, Wu L. Exogenous Melatonin Application Delays Senescence and Improves Postharvest Antioxidant Capacity in Blueberries. Agronomy. 2025; 15(2):428. https://doi.org/10.3390/agronomy15020428

Chicago/Turabian Style

Li, Jie, Ying Wang, Jinying Li, Yanan Li, Chunze Lu, Zihuan Hou, Haiguang Liu, and Lin Wu. 2025. "Exogenous Melatonin Application Delays Senescence and Improves Postharvest Antioxidant Capacity in Blueberries" Agronomy 15, no. 2: 428. https://doi.org/10.3390/agronomy15020428

APA Style

Li, J., Wang, Y., Li, J., Li, Y., Lu, C., Hou, Z., Liu, H., & Wu, L. (2025). Exogenous Melatonin Application Delays Senescence and Improves Postharvest Antioxidant Capacity in Blueberries. Agronomy, 15(2), 428. https://doi.org/10.3390/agronomy15020428

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop