You are currently viewing a new version of our website. To view the old version click .
Agronomy
  • Article
  • Open Access

18 December 2024

Major QTL Mapping and Candidate Gene Analysis of Branching Number Habits in Cucumis melo

,
,
,
,
and
1
Horticulture and Landscape Department, Heilongjiang Bayi Agriculture University, Daqing 163000, China
2
Daqing Branch of Heilongjiang Academy of Agricultural Sciences, Daqing 163000, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
This article belongs to the Section Crop Breeding and Genetics

Abstract

Branching number (BN) is a crucial architectural trait in Cucumis melo. Because of its multiple branch habits, much more labour costs are needed in melon production. However, the genetic mechanism of branching numbers in melon is not clear. Here, a genetic population from multiple branching material S8 (only two branching number in the first node) as the female line and S7 (multiple branching numbers in each node; more than nine branch numbers) as the male parent is used to make a cross F2:3 generation. By performing QTL mapping based on bulked segregate analysis (BSA) after two years, a candidate QTL region of the BN was located on chromosome 3. For further QTL mapping, a genetic linkage map, which contained 16 SSR markers with a total length of 2.27 Mb, was constructed. One major QTL locus bnDQ-2022-3.1 was detected between CmSSR9556 and CmSSR9580, with a LOD threshold of 11.37 and a contribution rate of 49.11% in the spring of 2022 in Daqing City. Then, a consistent QTL bnSY-2022-3.1 was also investigated in Sanya, Hainan Province, in the autumn of 2022, with a LOD threshold of 10.85 and a contribution rate of 45.01%. Nine genes were investigated within the interval of the candidate region located in chromosome 3 between 22,723,436 and 22,807,889 of the melon’s physical position within the 85.45 kb length region. Gene expression analysis showed significant differences between MELO3C019872.2.1, MELO3C030060.2.1, and MELO3C019871.2.1 in different development stages. Gene sequence different analysis revealed a “C”-to-“T” mutation in the 1280 bp site of MELO3C030060.2.1 in parental lines. Heterologous transformation of MELO3C030060.2.1 into cucumber revealed that overexpression of MELO3C030060.2.1 resulted in more and denser branches in cucumber plants, and the growth rate of lateral branches was significantly faster than that of the wild type. Transferring to antisense of MELO3C030060.2.1 had the opposite effect. To sum up, MELO3C030060.2.1 is related to melon branching initial habits. This study could provide a new insight into melon branching habits and provide a theoretical base for melon breeding.

1. Introduction

Melon (Cucumis melo L.) is an economically significant crop of the Cucurbitaceae family with a wide area of cultivation. Melon plants exhibit strong branching habits, and substantial labour is necessary to prune these branches to increase melon yield and quality. However, excessive branching depletes nutrients and increases the occurrence of disease and pest infestation due to limited space [1]. With advances in agriculture, traditional methods of melon production no longer adequately meet market demands; thus, agricultural mechanization is emerging as a trend for the future.
Plant cultivation and production are labour intensive, and because this industry is characterized by low levels of mechanization, substantial and high-intensity labour is always needed. It is difficult to ensure the quality of work that is completed with manual labour, and manual labour fails to meet the demands of large-scale production. In particular, as the issues of “labour shortages” and “expensive labour” are becoming increasingly prominent in agriculture, the economic benefits of muskmelon production continue to decrease, limiting the development of the muskmelon industry. New germplasms used for reducing costs, improving quality, and increasing efficiency in muskmelon production are more important. However, the mechanism of melon branching habits is not clear. The exploration of genes related to melon branching traits has become the key for overcoming the critical issues described above [2,3,4].
Branch growth and development are complex biological processes and are key determinants of plant type (height, branching, and growth habits) [5]. In crop species, many branching-related genes have been discovered [6]. The heterologous transformation of apple MdIAA3 into Arabidopsis can significantly increase the growth, pod number, and branch number [7]. Branches, as carriers of siliques, are closely related to rapeseed yield; BnERF114.A1 can promote plant branching and increase yield by regulating auxin synthesis and transport [8]. On the basis of their differential expression and branching-associated biological functions, ten chickpea genes and seven lentil genes have been classified as the main players involved in the differential regulation of plant branching between contrasting cultivars [9]. Heterologous overexpression of the tea tree CsBRC1 and CsBRC2 genes in rice increased the tiller number [10]. Compared with the wild type, the heterologous expression of cotton ghr-miR164 in Arabidopsis resulted in a significant increase in branching [11]. Research by Dou et al. revealed that the low-branching trait in watermelon is a monogenic recessive trait, and the candidate gene that regulates this trait, namely, ClTFL1, a homologue of TERMINAL FLOWER 1 (TFL1), encodes a protein that is significantly down regulated in the axillary buds, apices, and branches of low-branching lines. Down regulation of this gene may inhibit axillary bud growth. Ectopic expression of ClTFL1 in Arabidopsis results in an increase in the number of lateral branches [12,13]. These findings have increased our understanding of the molecular mechanisms regulating plant lateral branch development.
Research on the branching traits of melons is still in the early stages. Previous studies have indicated that the short-branching trait of melons is regulated by single recessive or incomplete dominant alleles and that this trait is influenced by both genetic and environmental factors [14,15]. Qi et al. conducted a genetic analysis of the plant formation traits of melons and reported that the branching length and internode length traits are regulated mainly by several genes that play dominant roles in melon genetics and have a decisive impact on the expression of these two traits. Owing to the presence of these genes, the genetic strength of branching length and internode length appears to be quite high, indicating a high level of stability and predictability in the genetic transmission of these two traits in melon [16]. Recently, the CmSVPc gene was shown to participate in the development of lateral branches, and the overexpression of CmSVPc in Arabidopsis resulted in increased numbers of lateral branches and delayed flowering [17,18,19]. In conclusion, the branching-related traits of melons are complex. Although progress has been made in identifying and analysing the mechanisms that regulate branching traits, further research is needed to explore candidate genes and validate their functions to fully elucidate the genetic basis and regulatory mechanisms of these traits.
The breeding of new melon varieties with few or no branches and the exploration of simplified cultivation models will greatly contribute to the industrialization and scaling of melon production. Additionally, analysing the genetic basis of branch formation and development, as well as exploring relevant genes and regulating their expression, are crucial foundations and prerequisites for the breeding of low-branched germplasm. In this study, bulked segregant analysis coupled with next-generation sequencing (BSA-seq) was used to identify candidate intervals for key genes controlling low branching in Cucumis melo. Within these intervals, 100 SSR markers were designed to screen for polymorphisms via the parents. The candidate intervals were narrowed down and analysed using IciMapping 4.2 software. One main QTL with low branching was detected in the candidate interval. The accuracy of the main QTL was verified through years of multipoint experiments. qRT-PCR was used to identify the candidate gene MELO3C030060.2.1 (CmPK1) that is involved in regulating branching habits, and its function was validated. The results may provide more precise and efficient strategies for the breeding and improvement of melons that are suitable for mechanized harvesting and production.

2. Materials and Methods

2.1. Plant Materials

In this study, the thin-skinned melon line S8, which has a low number of branches (1–2 at the first node per plant) on the main stem and the first node bears one axillary bud, was selected as the female parent. Line S7, with multiple branches and an average of 9 branches per plant, was selected as the male parent, and its lateral branches even give rise to tertiary branches, with each node producing 1 to 4 axillary buds (Figure 1). The F1 plants were crossed with these two lines, self-pollination was performed to generate the F2 population and F2:3 families, and the F6 generation was obtained through continuous self-pollination via the single-seed descent method.
Figure 1. Parent and F1 of the test materials used in this experiment. S8 was the female parent with a lower branching number, and S7 was the male parent with multiple branching numbers; F1 was the cross between S8 and S7 with the branching number between parents.
In 2021, the parental lines, the F1 generation, and the F2 and F2:3 families (130 families with 10 plants each) were planted at the experimental station of Heilongjiang Bayi Agriculture University in Heilongjiang Province, and the plant material was subjected to BSA analysis to detect associate regions. In addition, a total of 94 F6 recombination inbred lines were planted in 2022 in Datong District, Daqing city (latitude 46.58° N, longitude 125.03° E, in spring and summer), and in Hainan (latitude 18.09° N, longitude 108° E, in autumn and winter) for mapping the candidate genes regulating the number of branches in melon.

2.2. Cytological Observation of Axillary Buds

Two parental axillary buds from the 10th internode were chosen for paraffin section observation. The size of the axillary bud was 0.7 mm [20] (5 axillary buds of each size were observed), and the buds were fixed in FAA fixative for 24 h and observed via a SU8100 scanning electron microscope (Hitachi, Tokyo, Japan).

2.3. Branching Number Investigation

To investigate the effects of different pruning methods on the branching traits, three treatments were applied to the parents and the F1 generation (no pruning, single vine pruning, and double vine pruning); 15 plants of each parent and the F1 generation received each treatment, and three replicates were conducted. The number of branches was recorded after the plants reached the 15th internode. Additionally, 10 individuals from each F2:3 family were selected to obtain average values to represent the phenotypes of F2 individual plants, and the number of branches in the recombinant inbred lines without pruning was studied for fine mapping.

2.4. BSA-Seq and Association Region Detection

From the F2 segregating population that resulted from the cross combination S8 × S7, with a branch number ≤ 3 being defined as a small branch number and a pool number ≥ 8 being defined as a pool with many branches, 30 plants with the phenotype of each pool were selected to establish pools. They were then sent to Beijing Biomarker Biotechnology Co., Ltd. (Beijing, China), for BSA sequencing. On the basis of the mapping results of the clean reads in the reference genome, redundant reads were filtered via SAMtools (v1.9), SNP and InDel variations were detected via GATK’s HaplotypeCaller algorithm, and the final set of variant sites was obtained, preliminarily mapping the candidate chromosome and candidate interval for the regulation of low-branching QTLs in melon. The data obtained from the genetic linkage map were input into QTL IciMapping 4.2 software for analysis [21]. According to the software’s usage requirements, a corresponding conversion of fertility codes is needed: A = 2, B = 0, H = 1. A new project was created for the population and the file format was converted to “*.bip”. After the population was imported, the relevant parameters were set: scan step size (cM) = 1.0000, LOD proximity value = 2.5, ICIM-ADD method, and obtain the genetic map distance between the genetic map and the marker. The QTLs were named with the following convention: “place + year + chromosome”. Silent mutation: this mutation occurs in the coding region, changing the triplet codon but still encoding the same amino acid. Nonsynonymous mutation: this mutation also occurs in the coding region but changes the triplet codon, resulting in a change in the encoded amino acid.

2.5. Fine Mapping of Candidate Genes

We obtained candidate intervals for controlling the low branching of sweet melon through BSA sequencing correlation analysis and designed 100 pairs of SSR primers in this interval (Table S1). They were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. (Shanghai, China). Ninety-four recombinant inbred lines (F2:3 isolated populations) with stable amplification and significant differences were selected as materials for PCR amplification. The unique band types of S8 are labelled as “A”, the unique band types of S7 are labelled as “B”, and if both band types are present, they are labelled as “H”. The blank is labelled as “-”. The SSR primer PCR reaction system and program are as follows (Table S2). Finally, 16 pairs of primers were selected within the fine positioning candidate interval (Table 1).
Table 1. Primer sequence information used for candidate gene mapping in chromosome 3 based on the BSA sequence.
The selected primers were combined with phenotype and genotype data from 94 F2:3 families in two locations and input into a genetic linkage map constructed using JoinMap 4.0 software. We input the data obtained from the genetic linkage map into QTL IciMapping 4.2 software for analysis. According to the software’s usage requirements, corresponding conversion of fertility codes is required: A = 2, B = 0, H = 1, data missing = −1. We opened New Project to create a new project, imported the drawing population into the project, and converted the file format to “*.bip”. After importing the drawing population, we set the relevant parameters: scan step size step (cM) = 1.0000, LOD proximity value = 2.5, select method ICIM-ADD, and selected Start to start running, and obtained the genetic map distance between the genetic map and the marker.

2.6. Prediction of Candidate Genes and Gene Expression Analysis

Combining the predicted location of the candidate interval from fine mapping, all the annotated genes in the candidate segment were searched in the Cucurbitaceae database (http://cucurbitgenomics.org/, (accessed on 15 March 2023)). Primers were designed via NCBI (https://www.ncbi.nlm.nih.gov/, (accessed on 16 March 2023)) on the basis of the full-length sequences of the genes (Table 2). The 10th lateral growth point from both parents was extracted for candidate gene expression identification. Total RNA was extracted from the tissue using TRIzol® Reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The RNA quality was subsequently determined via a 5300 Bioanalyzer (Agilent, Santa Clara, CA, USA), and the RNA integrity number (RIN) was determined using an ND-2000 (NanoDrop Technology, Wilmington, DE, USA). The RNA was reverse transcribed into complementary cDNA via the ReverTra Ace® qPCR RT kit (Vazyme, Nanjing, China), and the cDNA was then used for PCR amplification of the target gene with specific primers. Three biological replicates and three technical replicates were established, and the relative expression levels of the target genes were calculated via the 2−ΔΔCt method [22].
Table 2. Candidate gene annotation and qRT-PCR primer information for gene expression detection.

2.7. Cloning of CmPK1 (Cucumis Phytol Kinase 1)

Primer Premier 5.0 software was used to design primers to clone the full-length coding region of the gene, and the primer sequences were as follows: CmPK1-F: 5′-CTTATTGCATTATCTACTTCGC-3′; CmPK1-R: 5′-ATTCGCGTCATATAGGCCTTTTC-3′. PCR amplification was carried out using S8 cDNA as a template. The amplification program was as follows: 94 °C for 5 min; 35 cycles of 94 °C for 30 s, 56.5 °C for 30 s, and 72 °C for 30 s; and 72 °C for 10 min. After the bands were verified by agarose gel electrophoresis of the PCR products, the desired bands were recovered via the Gel Recovery Kit (Qiagen, Beijing, China). The recovered fragments were ligated into the T3 vector and then transformed into Escherichia coli competent DH5α cells via heat shock transformation. The transformed cells were cultured overnight on LB agar plates supplemented with X-Gal, IPTG, and Amp at 37 °C. White colonies were individually selected, cultured separately, and sent to QIAGEN Biotech Co., Ltd. (Shanghai, China) for sequencing.

2.8. Analysis of CmPK1 Expression Patterns

The primers used were designed with online software (https://www.genscript.com/tools/real-time-pcr-tagman-primer-design-tool, (accessed on 6 April 2023)), and the sequences of the primers used were as follows: qCmPK1-F: GGTGACATAGAGCCATGGATGAT and qCmPK1-R: GACATCTCGCAGTAATTGAAGGC (Table S1). The reference gene was CsEF1α (GenBank Accession Number: XM_004138916). Relative expression levels were calculated via the 2−ΔΔCT method for quantitative analysis, and Student’s t test was used to compare expression levels between two samples.

2.9. Genetic Transformation of Cucumber

The target gene was amplified from the pEASY-T3-CmPK1 primer via PCR with full-length cloning primers, and the pBWA(V)BS vector was digested with BamHI. T4 ligase was used to ligate the target fragment into the vector, and then, the vector was transformed into Escherichia coli. The pBWA(V)BS-CmPK1 positive and negative expression vectors were identified via bacterial PCR and sequencing. The primers used for the expression vector were pBWA(V)BS-F: 5′-ACTATCCTTCGCAAGACCG-3′, and pBWA(V)BS-R: 5′-CCAGACTGAATGCCCACA-3′. The expression vectors were subsequently transferred into Agrobacterium tumefaciens LBA4404 via the freeze-thaw method, after which the cucumber cotyledon nodes were infected. The transformation of Agrobacterium and infection methods are detailed in Supplementary File S1. The genetic transformation of cucumber was performed in MS medium supplemented with 100 mg/L glyphosate for selection, and then, differentiation was performed via culture on differentiation medium. After approximately 20 days, the differentiated buds began to grow; when the buds grew larger, they were cut and transferred to rooting medium. After both primary and lateral roots had grown, they were transplanted and placed in a culture chamber for acclimatization; this yielded T0 generation transgenic cucumbers. DNA was extracted from the transgenic cucumbers via the CTAB method, primers were designed on the basis of the sequence of the vector A, and PCR and qPCR techniques were used for the molecular identification of the transgenic plants.

2.10. Statistical Analysis

In this study, data related to parental and F2 population branching traits were analysed with the SAS® 9.4 program [23]. The normal distribution of branching traits was analysed via Origin 2019 [24]. Mean, standard deviation, and correlation analyses of parental and F2/F2:3 branching habits were conducted with SPSS 19.0 [25].
Comparative analysis of differentially expressed genes and the identification of functional gene sequences in multiple species was carried out with DNAMAN 6.0 software [26], and evolutionary tree analysis was conducted via the ClustalW (https://www.genome.jp/tools-bin/clustalw, (accessed on 23 December 2023)) multiple sequence alignment method.

3. Results

3.1. Cytological Observation of Axillary Bud Differentiation

In this study, axillary buds from the 10th internode of the two parents were selected for paraffin section observation. When the size of the axillary bud reached 0.7 mm, S8 presented an average of one lateral meristem and one apical meristem in the field of view, with a relatively low number of axillary meristems. In contrast, S7 had significantly more lateral meristems, more than eight, and no apical meristem. The cells transitioned from a tightly arranged state to the elongation phase (Figure 2).
Figure 2. Cytological observation of paraffin section at axillary bud ≈ 0.7 mm size stage for both the female and male parents with samples from the 10th node. Note: the scale bar for the paraffin sections is 50 μm; AM means axillary meristem; S8 is the maternal parent and S7 is the paternal parent.

3.2. Effect of Different Pruning Methods on the Number of Branches

There are two commonly used pruning methods in melon production, which are single vine pruning and double vine pruning. To investigate the effects of different pruning methods on the number of branches in melon, we set no pruning as a control, and single vine pruning and double vine pruning were used to prune melon seedlings (Figure 3), and the results are shown in Table 3. There was no significant difference in the number of branches between S8, S7, and F1 under different pruning methods, indicating that the number of branches is mainly influenced by genetic factors. And observing the error values in each set of data, it can be found that the error value of double vine pruning is the smallest, indicating that after double vine pruning, the branching numbers of S8, S7, and F1 are more stable. Therefore, the double vine pruning method was selected for further mapping.
Figure 3. Performance of different pruning methods on melon branching. Note: (a): no pruning; (b): single stem pruning; (c): double stem pruning.
Table 3. Phenotypic analysis of branching quantity traits between melon parents and F1.

3.3. Phenotypic Evaluation and Preliminary QTL Mapping of the Number of Branches

Phenotypic evaluation revealed a significant difference in the number of branches between the female parent S8 and the male parent S7, with mean values of 3 and 7, respectively. The mean number of branches in the F1, F2, and F2:3 families fell between the number of branches in S8 and S7 (Table 4).
Table 4. Phenotypic analysis of fewer branching traits in sweet melons.
The branching numbers of 740 F2 plants planted in Daqing in 2021 and 130 F2:3 families planted in Sanya in autumn 2022 were statistically analysed, as shown in Figure 4. The number of branches in the F2:3 population of both regions shows a continuous distribution, and both exhibit superphilicity, showing a tendency towards normal distribution, the correlation across 2 years is 0.57, indicating that the number of branches in sweet melon belongs to a typical quantitative trait and conforms to Mendelian inheritance laws. This indicates that the branch quantity data of sweet melons in Daqing and Sanya are suitable for QTL analysis.
Figure 4. The frequency of melon branching traits in two places over two years. (a): The distribution of the branching number of F2 individuals which were planted in Heilongjiang Province in 2021; (b) the recombined inbred lines of F6 which were planted in Heilongjiang Province in spring of 2022; (c) F6 which were planted in autumn in Hainan Province.
The BSA sequencing results are detailed in Table S3. SNP detection identified 1,774,316 SNP loci between the parents, including 35,674 nonsynonymous SNP mutations, and 418,350 SNPs were detected between the progeny pools. The number of common SNPs between the parents and the progeny pools was 321,880. On the basis of the BSA-seq results, SNP-associated region analysis, and preliminary mapping, the main QTL site thought to contain the gene that regulates the low-branching trait in melons was located in two intervals on the 3rd chromosome, with initial positions between 4,270,000 and 4,770,000 and between 22,690,000 and 25,350,000, with candidate interval sizes of 0.50 Mb and 2.66 Mb. (Figure 5).
Figure 5. The candidate region identified by BSA-sequencing and QTL analysis for branch number in two seasons by RILs. (A) The candidate region investigated for branching number from the F2 population in 2021 using BSA sequencing; and (B) was QTL mapped based on the candidate chromosome 3 region using SSR maker scanning for RIL6 individuals for two seasons. The red line represents the results of RILs planted in Daqing City in spring 2022, and the green line represents the results of RILs planted in Hainan City in autumn 2022, with LOD values of more than 10. Sixteen pairs of molecular markers were used to reduce the candidate interval, and the candidate genes were located between CmSSR9556 and CmSSR9580. (C) Nine genes within the candidate interval were selected and (D) is the candidate gene sequence with a difference among the S8, S7, and reference genomes.

3.4. Fine Mapping of Candidate Intervals

Considering chromosome 3 as the candidate interval region, 100 pairs of SSR markers were designed along this chromosome. Among them, 32 pairs of SSR primers showed polymorphism between parents, with a polymorphic primer ratio of 32%. Using polymorphic primers to amplify and detect 94 stable and significantly different markers in the F2:3 generation of separated populations, the candidate interval is finally reduced to 16 pairs of SSR markers located between chromosome 22,655,225 and 24,927,638 on chromosome 3, with a length of 2.27 Mb (Table 1). QTL analysis was conducted on 94 F6 recombinant inbred lines over two years, and we obtained a genetic linkage map containing 16 pairs of SSR markers, with a length of 85.45 kb and an average genetic distance of 5.34 kb. IciMapping 4.2 analysis of this genetic linkage map detected one main QTL locus with few branches, located in the interval between markers CmSSR9556 and CmSSR9580, which is the main QTL region. In Daqing City (bnDQ-2022-3.1), the LOD value is 11.37, with a contribution rate of 49.11%, and the genetic distance from the two linkage markers is 1.46 cM and 2.49 cM, respectively. In Sanya (bnSY-2022-3.1), the LOD value is 10.85, with a contribution rate of 45.01%, and the genetic distance from both linkage markers is 1.98 cM (Table 5). Due to the fact that the two-year major QTL loci are located within one interval, the candidate interval has been reduced to 85.45 kb, located between chromosome 22,723,436 and 22,807,889 on the third chromosome of the melon genome. There is a total of nine genes in the interval.
Table 5. BSA sequencing and candidate region investigated by RILs in two seasons.

3.5. Candidate Gene Expression Patterns and Sequence Analysis

Expression patterns and sequence analysis were carried out on the nine candidate genes (Table 2), including the plant myo-inositol synthase, pyruvate dehydrogenase complex, chloroplast outer membrane 24 kDa protein, and pectin esterase inhibitor-like genes, along with three genes of unknown function, MELO3C030074.2.1, MELO3C030061.2.1, and MELO3C030274.2.1. The expression of these genes in axillary bud samples from the parents was analysed, and the results revealed that the expression levels of MELO3C019873.2.1, MELO3C019874.2.1, and MELO3C030075.2.1 did not differ between the parents, whereas the remaining three genes presented significant differences. MELO3C019872.2.1 and MELO3C030060.2.1 expression was upregulated in the low-branching phenotype S8, whereas MELO3C019871.2.1 expression was upregulated in the high-branching phenotype S7.
The sequences of the three differentially expressed genes were compared in the melon database, revealing structural differences. A nonsynonymous mutation was found at position 1280 in the gene sequence of MELO3C030060.2.1 between the low-branching S8 and the normal-branching S7. Gene sequence analysis across different species in the Cucurbitaceae family revealed that the gene MELO3C030060.2.1 had the closest relationship with homologues in Chinese pumpkin and zucchini, suggesting potential involvement in branching. The gene MELO3C030060.2.1 was annotated as Cucumis melo Phytol kinase 1 and named CmPK1 (Figure 6).
Figure 6. Phylogenetic tree of CmPK1. The amino sequences were subjected to phylogenetic analysis using the neighbour joining method in MEGA 7.0 software, with 1000 bootstrap replicates.

3.6. Preliminary Validation of Gene Function via CmPk1 Cloning and Sequence Analysis

The CDS of CmPk1 was obtained from the Cucurbitaceae genome database, and the sequence was confirmed via PCR amplification. The full-length CDS of CmPK1 is 348 bp (Figure 7A) and encodes a total of 115 amino acids (Figure 7B). The target gene was successfully obtained. The analysis of CmPk1 expression in different melon parts revealed significantly greater CmPk1 expression in S8 than in S7 in all organs except the roots, and the highest CmPk1 expression was observed in the stems and leaves. Compared with those in the control group, the expression levels of CmPk1 in the roots and fruits were not significantly different, indicating that CmPk1 exhibited tissue-specific expression patterns (Figure 7C).
Figure 7. Cloning and expression analysis of CmPk1; (A) gel electrophoresis of PCR products. M: DNA marker 2K; a. b. c: PCR products. (B) The corresponding amino acid sequence of CmPk1. (C) The expression patterns of CmPk1 in different parts of the melon. The “**” shows that the value is extremely significant at the 0.01 level based on the Student’s t test.
PlantCARE [27] (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, (accessed on 1 July 2023))was used to analyse the 2000 bp sequence upstream of the CmPK1 CDS, and the results revealed that the gene promoter not only contains common functional elements, such as the intrinsic promoter and enhancer regions of eukaryotic promoters and the light responsive element I-box, but also includes one CGTCA motif MeJA responsive cis-acting element, one ABRE abscisic acid binding site, four auxin binding sites, one MYB binding site, one MYC binding site, and one cis-acting element that is involved in defence and stress responses (Table S1). Thus, the expression of CmPK1 may be regulated by several hormones and stress-related factors.

3.7. Construction of the CmPk1 Expression Vector and Genetic Transformation of Cucumber

Using the hypocotyl nodes of S8 and S7 as explants, the target gene was introduced via Agrobacterium-mediated infection to generate T0 generation transgenic cucumber plants (Figure 8A). After the transgenic seedlings were acclimatized, they were planted in a greenhouse for consistent management.
Figure 8. Genetic transformation and validation of cucumbers. (A) The genetic transformation process of cucumbers. (B) PCR identification of plants overexpressing S8 and S7. (C) Identification of qRT-PCR for overexpressing plants S8 and S7. The “*” shows that the value is significant at the 0.05 level based on the Student’s t test; the “**” shows that the value is extremely significant at the 0.01 level based on the Student’s t test.
Leaf DNA was extracted from the transgenic plants for use as a template, and PCR amplification was carried out with primers designed based on the pBWA(V)BS vector. The pBWA(V)BS-CmPk1 plasmid served as the positive control, and water served as the negative control. The results revealed a distinct band at approximately 400 bp, corresponding to the target gene fragment, in the positive experimental plants and the positive control (Figure 8B), whereas no such band was observed in the negative control; these results indicated the successful integration of the pBWA(V)BS-CmPk1 plasmid into the cucumber genome. To eliminate false positives in the transgenic plants and ensure the integrity and accuracy of the experiment, RNA was re-extracted for qRT-PCR analysis. In S8, after the introduction of CmPk1 (+) (OE1, OE10, and OE19), CmPk1 expression was significantly upregulated 11.38-fold compared with that of the wild-type sample; after the introduction of CmPk1 (−) (OE1, OE2, and OE4), CmPk1 expression was decreased to 0.53 relative to that of the wild-type sample; in S7, after the introduction of CmPk1 (+) (OE3, OE5, and OE6), CmPk1 expression was significantly upregulated 7.66-fold compared with that of the wild-type sample; and after the introduction of CmPk1 (−) (OE1, OE11, and OE12), CmPk1 expression decreased to 0.69 relative to that of the wild-type sample (Figure 8C).

3.8. Analysis of Branching in CmPk1-Overexpressing Plants

The branching of T0 generation CmPk1-positive plants was analysed, as shown in Figure 9. The CmPk1-overexpressing plants grew well. The CmPk1 (+)-OE-positive S8 plants presented no branching, and the CmPk1 (−)-AS-positive S8 plants presented significantly more branches than did the CmPk1 (+)-OE positive plants; each node presented at least 2 branches. The CmPk1 (+)-OE-positive S7 plants had no branches, and the CmPk1 (−)-AS-positive S7 plants had at least 2 or 3 branches in each node.
Figure 9. Number of branches in CmPK1 transgenic-positive plants in the S7 and S8 lines.

4. Discussion

Canopy modification has become a major goal for the breeding of many horticultural crop species, including melons. Branching is an important component of plant canopy architecture [28]. For cucurbit crops, short-branching varieties exhibit improved ventilation and light transmission, increased plant density, and reduced costs associated with the labour that is needed for frequent pruning. The trend towards mechanization and smart agriculture in agricultural production has increased the demand for the branching characteristics of fruit crops. Short-branching varieties are more likely to adapt to this trend [29]. Genetic studies on branching traits in vegetable crops have been reported, including studies that involved observations about branching traits, genetic regulation, and QTL localization, with a particular focus on several fruit crops, such as tomato (Solanum lycopersicum) [30], Arabidopsis thaliana [31], and watermelon (Citrullus lanatus) [32]. New branching types have been generated through gene editing technologies.
Different pruning methods can have a certain impact on the number of branches. Three different pruning methods were used to prune the branches of the two parents and F1, and there were significant differences in their branch numbers. After each of the treatments, S8 consistently exhibited approximately 3 branches, and S7 consistently exhibited approximately 9.2 branches, and no significant differences were observed among the treatment groups. The average branch number of the F1 generation was 6.4 branches, indicating stable performance. These findings suggest that pruning methods do not significantly affect branching number characteristics, which are influenced primarily by genetic factors.
This study detected major-effect QTL in F6 populations in different locations, indicating that this QTL locus is a truly major-effect locus. In the F6 population, the effects of the two QTLs were relatively similar (R2 = 45.1–49.11%), showing a certain degree of stability. Therefore, we can infer that this consistent major-effect QTL may have relatively stable and significant impacts on phenotypic variation in different populations, which also demonstrates their importance in genetic regulation. The results of this study showed that QTL contribution of bnSY-2022-3.1/bnqDQ2022-3.1 may significantly affect phenotypic variation in different populations, revealing their importance in genetic regulation. Thus, exploring the candidate genes contained in major-effect QTL loci and their interactions with environmental factors will help to deeply understand the mechanisms of plant trait formation, providing important references and guidance for plant breeding and genetic improvement.
The results of this study, in conjunction with the qRT-PCR results, identified candidate genes and excluded unannotated functional genes and genes that did not differ between the two parents. The expression patterns of the remaining three genes were significantly different, indicating their involvement in branching regulation. Sequence alignment in the melon database revealed nucleotide sequence differences between the short-branching S8 parent and the normal-branching S7 parent in the MELO3C030060.2.1 gene sequence, with a C-to-T mutation at base 1280. The gene MELO3C030060.2.1, which is related to branching in rice and tomato, is speculated to be a candidate gene that regulates melon branching; this gene was named CmPk1.
Analysing gene expression patterns is crucial for understanding gene function. CmPk1 is constitutively expressed, with notable differences in expression among varieties and tissues, particularly in stems and leaves. The genetic transformation of cucumber with CmPk1 promoted lateral branch formation and growth, resulting in denser branching with altered leaf morphology.
Evolutionary analysis revealed that CmPk1 is most closely related to watermelon Cla018392. This protein is highly conserved among different species and highly similar within the same botanical genus, indicating a high degree of conservation during the evolutionary process. Cla018392 has been confirmed to control lateral branching in watermelon, suggesting that CmPk1 may play a role in regulating lateral branching in melons. Analysis of the 2000 bp promoter region upstream of the CmPk1 CDS revealed the presence of MYB and MYC binding sites. Transcription factors in the MYB family play crucial roles in various aspects of plant growth and hormone signalling (Table S1). Additionally, four auxin-responsive elements were identified. Numerous studies have shown that auxins that are secreted by plant apical buds effectively inhibit lateral branch and lateral bud differentiation. CmPk1 can effectively suppress lateral branching in melons, possibly through its overexpression; CmPk1 overexpression induces the secretion of large amounts of auxin in plants, thereby inhibiting the growth of lateral branches below. The growth of axillary buds is usually inhibited by apical buds, and this phenomenon is known as “apical dominance”. Removal of the apex releases apical dominance, causing sugars to rapidly redistribute throughout the entire plant and accumulate in lateral buds [33,34,35,36]. Previous studies have shown that auxin plays a crucial role in the regulation of branching. In many plant species, the further development of axillary buds into branches is inhibited by the main stem. The mechanism by which auxin inhibits axillary bud growth is not fully understood, particularly because auxin seems to act indirectly, as it primarily moves within the main stem rather than entering the axillary bud [37,38,39,40,41]. A recent study revealed that in the initial stages, the elongation of topping and cytokinin-induced buds occurs independently of auxin flow in the bud [42]. Therefore, CmPk1 may inhibit the lateral branching of melon by regulating the secretion of auxin in plants. This discovery provides a new perspective on the regulatory mechanism of plant growth hormones and is worthy of further in-depth research. Exploring the specific regulatory mechanisms and interactions of CmPk1 in melon branching is necessary. Future studies will confirm the functions of candidate genes through transgenic technology and metabolic pathway analysis.
This experiment identified a molecular marker that can verify the low branching of melon, assist with selection breeding to reduce melon production costs, accelerate the melon breeding process, and have important theoretical significance and practical application value for genetic improvement of the melon. Additionally, this experiment verified the function of the key gene CmPK1, laying the foundation for further analysis of the mechanism of low branching in sweet melon and providing theoretical reference for solving branching problems in other crops.

5. Conclusions

On the basis of BSA sequencing, the candidate interval controlling the gene that regulates branching number in melon was mapped to the third chromosome. Trait investigations were conducted across multiple seasons via a recombinant inbred line population. Fine mapping revealed two loci within a region between the markers CmSSR9556 and CmSSR9580, with a main-effect QTL controlling the low-branching trait. This QTL had an average contribution rate exceeding 45.01% and a LOD value greater than 10. The candidate interval of the main-effect QTL on chromosome 3 of the melon genome spans positions 22,723,436 to 22,807,889, including 85.45 kb and containing nine genes. Functional analysis and expression level validation revealed a mutation from C to T at base position 1280 in the candidate gene MELO3C030060.2.1, which was named CmPK1, this mutation resulted in significant differences in expression levels between the parents. Genetic transformation in cucumber resulted in increased branching in positive plants, indicating the involvement of CmPK1 in regulating branching.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy14123012/s1, Table S1: Distribution and function of cis-acting elements in CmPK1; Table S2: SSR primer PCR amplification program; Table S3: BSA-seq details; File S1: Methods for genetic transformation of cucumber.

Author Contributions

Y.S. designed this experiment and edited the manuscript, L.W. investigated all the data in the yield and wrote the manuscript, L.Y. conducted the experiment in the lab with genetic map construction and QTL analysis, D.D. collected and analysed the data, F.Z. conducted the gene function experiment and prepared tables and figures, and D.W. provided resources. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the National Natural Science Foundation of China (31772330), the Natural Science Foundation of the Heilongjiang Province, China (LH2022C065), and the Programme of Heilongjiang Bayi Agriculture University Innovative research projects for graduate students (YJSCX2022-Y74).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Confraria, A.; Muñoz-Gasca, A.; Ferreira, L.; Baena-González, E.; Cubas, P. Shoot branching phenotyping in Arabidopsis and tomato. In Environmental Responses in Plants; Duque, P., Szakonyi, D., Eds.; Springer: New York, NY, USA, 2022; pp. 47–59. [Google Scholar]
  2. Zhang, L.; Yang, Y.; Song, L. The Current Status and High Quality Development Strategies of Watermelon and Melon Industry in Beijing. China Agric. Sci. Technol. Guide 2023, 25, 20–27. [Google Scholar]
  3. Liu, W.; Xu, X.; Pan, X.; Zhang, Q.; Wang, J.; He, H.; Sun, J.; Cheng, Z.; Zhang, X.; Zhou, H. Analysis and recommendation of commercial watermelon and melon pro-duction in the old course of the Yellow River. Chin. Melon Veg. 2022, 35, 1–11. [Google Scholar]
  4. Cozzolino, E.; Di Mola, I.; Ottaiano, L.; Bilotto, M.; Petriccione, M.; Ferrara, E.; Mori, M.; Morra, L. Assessing yield and quality of melon (Cucumis melo L.) improved by biodegradable mulching film. Plants 2023, 12, 219. [Google Scholar] [CrossRef] [PubMed]
  5. Pang, C.; Yu, J.; Zhang, L.; Tang, M.; Liu, H.; Cai, Y.; Chen, F.; Zhang, J. BnaC03.BIN2 regulates plant height by affecting the main inflorescence length and first effective branch height in Brassica napus L. Crop J. 2024, 8, 1102–1111. [Google Scholar] [CrossRef]
  6. Li, L.; Li, W.; Liu, B.; Liu, Y.; Bai, B.; Cui, F.; Wan, S.; Li, W. Research progress on the formation of plant branches and the main factors affecting branch number. J. Plant Genet. Resour. 2024, 10, 11. [Google Scholar]
  7. Zhang, H.Q.; Zhang, H.; Gao, Q.M.; Yao, J.L.; Wang, Y.R.; Liu, Z.Z. Transcriptome analysis screening key genes regulating apple branching ability. Agric. Sci. China 2024, 57, 1995–2009. [Google Scholar]
  8. Zhao, X.Y.; Li, S.Q.; Zhang, Z.F.; Zhang, W.; Li, X.; Li, B. Progress in Mapping and Cloning of Genes Related to Branch Number in Rapeseed. Life Sci. 2024. [Google Scholar] [CrossRef]
  9. Marcos, F.B.; Giacomo, G.; Chiara, V.; Matteo, B.; Federeco, M. Genome-wide transcript expression analysis reveals major chickpea and lentil genes associated with plant branching. Front. Plant Sci. 2024, 15, 1384237. [Google Scholar]
  10. Sheng, Q. Functional Analysis of CsBRC Gene. Master’s Thesis, Guizhou University, Guiyang, China, 2024. [Google Scholar]
  11. Zhan, J.J.; Chu, Y.; Wang, Y.; Diao, Y.; Zhao, Y.; Liu, L.; Wei, X.; Meng, Y.; Li, F.; Ge, X. Functional analysis and mechanism study of GhCUC2 gene regulating cotton plant type. Plant Biotechnol. J. 2021, 19, 1839–1851. [Google Scholar] [CrossRef]
  12. Dou, J.; Kang, Q.; Li, T.; Umer, M.J.; Alharthi, B.; Liu, D.; Yang, S.; Niu, H.; Ma, C.; Zhu, H.; et al. Construction and application of a new watermelon germplasm with the phenotype of dwarf and branchless. Funct. Integr. Genom. 2023, 23, 310. [Google Scholar] [CrossRef]
  13. Dou, J.; Yang, H.; Sun, D.; Yang, S.; Sun, S.; Zhao, S.; Lu, X.; Zhu, H.; Liu, D.; Ma, C.; et al. The branchless gene Clbl in watermelon encoding a TERMINAL FLOWER 1 protein regulates the number of lateral branches. Theor. Appl. Genet. 2022, 135, 65–79. [Google Scholar] [CrossRef] [PubMed]
  14. Ohara, T.; Wako, T.; Kojima, A.; Yoshida, T.; Ishiuchi, D. Breeding of suppressed-branching melon line ‘Melon chukanbohon nou 4′ (‘Melon parental line 4′) and its characteristics. Acta Hortic. 2001, 588, 227–231. [Google Scholar] [CrossRef]
  15. Zalapa, J.E.; Staub, J.E.; Mccreight, J. Variance component analysis of plant architectural traits and fruit yield in melon. Euphytica 2008, 162, 129–143. [Google Scholar] [CrossRef]
  16. Qi, Z.Y.; Li, J.X.; Zou, X.X.; Cao, L.W.; Rao, L.L.; Yu, J.L.; Chen, L.P. Genetic analysis of plant type traits in sweet melon. J. Agric. Biotechnol. 2015, 23, 302–310. [Google Scholar]
  17. Fang, S.; Zhao, J.; Guo, K.; Duan, Y.; Wang, F.; Nie, L.; Zhao, W. Identification of SHORT VEGETATIVE PHASE (SVP)-like genes and necessary responsibility of CmSVPc for the development of lateral branches in melon (Cucumis melo L.). Sci. Hortic. 2023, 312, 111845. [Google Scholar] [CrossRef]
  18. Borner, R.; Kampmann, G.; Chandler, J.; Gleißner, R.; Wisman, E.; Apel, K.; Melzer, S. A MADS domain gene involved in the transition to flowering in Arabidopsis. Plant J. 2000, 24, 591–599. [Google Scholar] [CrossRef]
  19. Cheng, Z.; Zhuo, S.; Liu, X.; Che, G.; Wang, Z.; Gu, R.; Shen, J.; Song, W.; Zhou, Z.; Han, D.; et al. The MADS-box gene CsSHP participates in fruit maturation and floral organ development in cucumber. Front. Plant Sci. 2020, 10, 1781. [Google Scholar] [CrossRef]
  20. Wang, B.; Smith, S.M.; Li, J. Genetic regulation of shoot architecture. Annu. Rev. Plant Biol. 2018, 69, 437–468. [Google Scholar] [CrossRef]
  21. Meng, L.; Li, H.; Zhang, L.; Wang, J. QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J. 2015, 3, 269–283. [Google Scholar] [CrossRef]
  22. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  23. Wang, Y.; Zhu, W.; Tao, J. Exploration of the Application of SAS Software in the Teaching of “Biostatistics”. Educ. Teach. Forum 2023, 31, 145–148. [Google Scholar]
  24. Guo, J.; Tang, Y.L.; Lei, L.M.; Xu, D.L. Application of Origin software in microbiology experimental teaching—Taking the measurement experiment of bacterial growth curve as an example. Educ. Teach. Forum 2024, 11, 21–24. [Google Scholar]
  25. Yu, G.; Long, F.L.; Zhang, Y.; Liu, J.J. Microsatellite data processing of polyploid plants of Bashan bamboo based on R software package (Polysat). For. Surv. Plan. 2023, 48, 33–38. [Google Scholar]
  26. Wang, X.G. Application of Biological Software in Nucleic Acid Sequence Alignment and Phylogenetic Analysis. Mod. Agric. Technol. 2015, 12, 347–348. [Google Scholar]
  27. Lescot, M.; Déhais, P.; Thijs, G. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  28. Jiang, J.J.; Su, H.D.; Hong, D.F.; Yang, G.Q.; Yan, L.; Xu, Y.; Zhang, Y.; Zhang, L.X.; Han, F.P.; Jin, S.X.; et al. Progress in plant biotechnology research. Plant Physiol. J. 2023, 59, 1436–1462. [Google Scholar]
  29. Finlayson, S.A. Arabidopsis TEOSINTE BRANCHED1-LIKE 1 regulates axillary bud outgrowth and is homologous to monocot TEOSINTE BRANCHED1. Plant Cell Physiol. 2007, 48, 667–677. [Google Scholar] [CrossRef]
  30. Barraj Barraj, R.; Segado, P.; Moreno-González, R.; Heredia, A.; Fernández-Muñoz, R.; Domínguez, E. Genome-wide QTL analysis of tomato fruit cuticle deposition and composition. Hortic. Res. 2021, 8, 113. [Google Scholar] [CrossRef]
  31. Lauss, K.; Keurentjes, J.J. QTL epi Mapping in Arabidopsis thaliana. In Plant Chromatin Dynamics: Methods and Protocols; Bemer, M., Baroux, C., Eds.; Springer: Berlin/Heidelberg, Germany, 2018; pp. 373–394. [Google Scholar]
  32. Hong, J.E.; Hossain, M.R.; Jung, H.J.; Nou, I.S. QTL associated with Gummy Stem Blight (GSB) resistance in watermelon. BMC Genom. 2022, 23, 632. [Google Scholar] [CrossRef]
  33. Huang, K.L.; Tian, J.; Wang, H.; Fu, Y.F.; Li, Y.; Zheng, Y.; Li, X.B. Fatty acid export protein BnFAX6 functions in lipid synthesis and axillary bud growth in Brassica napus. Plant Physiol. 2021, 186, 2064–2077. [Google Scholar] [CrossRef]
  34. Zou, J.; Zhang, S.; Zhang, W.; Li, G.; Chen, Z.; Zhai, W.; Zhao, X.; Pan, X.; Xie, Q.; Zhu, L. The rice HIGH-TILLERING DWARF1 encoding an ortholog of Arabidopsis MAX3 is required for negative regulation of the outgrowth of axillary buds. Plant J. 2006, 48, 687–698. [Google Scholar] [CrossRef] [PubMed]
  35. Lin, H.; Wang, R.; Qian, Q.; Yan, M.; Meng, X.; Fu, Z.; Yan, C.; Jiang, B.; Su, Z.; Li, J.; et al. DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth. Plant Cell 2009, 21, 1512–1525. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, S.; Wang, K.; Li, Z.; Li, Y.; He, J.; Li, H.; Wang, B.; Xin, T.; Tian, H.; Tian, J.; et al. Architecture design of cucurbit crops for enhanced productivity by a natural allele. Nat. Plants 2022, 8, 1394–1407. [Google Scholar] [CrossRef] [PubMed]
  37. Dong, F.Y.; Song, J.H.; Zhang, H.D.; Zhang, J.R.; Chen, Y.F.; Zhou, X.; Li, Y. TaSPL6B, a member of the Squamosa promoter binding protein-like family, regulates shoot branching and florescence in Arabidopsis thaliana. BMC Plant Biol. 2024, 1, 708–718. [Google Scholar] [CrossRef]
  38. Huh, Y.J.; Han, B.H.; Park, S.K.; Lee, S.Y.; Kil, M.J.; Pak, C.H. Inhibition of chrysanthemum axillary buds via transformation with the antisense tomato lateral suppressor gene is season dependent. Hortic. Environ. Biotechnol. 2013, 3, 280–287. [Google Scholar] [CrossRef]
  39. Xing, W.J.; Ma, Q.L.; Liu, Z.B. Research progress on plant branching development. Mol. Plant Breed. 2024, 5, 06. [Google Scholar]
  40. Chen, F.Q.; Zhang, H.J.; MA, H.L. Research progress on hormone regulation of plant branching/tillering. Acta Prataculturae Sin. 2024, 33, 212–225. [Google Scholar]
  41. Chen, L.; Sun, B.; Xu, L.; Liu, W. Wound signaling: The missing link in plant regeneration. Plant Signal. Behav. 2016, 11, 4273–4284. [Google Scholar] [CrossRef]
  42. Luo, Z.; Janssen, B.J.; Snowden, K.C. The molecular and genetic regulation of shoot branching. Plant Physiol. 2021, 187, 1033–1044. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.