You are currently viewing a new version of our website. To view the old version click .
Cancers
  • Erratum
  • Open Access

15 December 2016

Erratum: Roche, J. et al. Global Decrease of Histone H3K27 Acetylation in ZEB1-Induced Epithelial to Mesenchymal Transition in Lung Cancer Cells. Cancers, 2013, 5, 334–356

,
,
,
,
,
,
,
and
1
Department of Medicine, Hematology Oncology Division, MUSC, 96 Jonathan Lucas St., Charleston, SC 29425, USA
2
CNRS FRE 3511, University of Poitiers, 1 rue Georges Bonnet, F-86022 Poitiers Cédex, France
3
Department of Medicine, Nephrology Division, MUSC, Ralph H. Johnson Veterans Affairs Medical Center, Charleston, SC 29425, USA
4
Epigénétique & Destin Cellulaire, CNRS UMR 7216, University of Paris Diderot, Sorbonne Paris Cité, F-75013 Paris, France
The authors wish to make the following correction to their paper [1]. The sequences of actin primers used in qRT-PCR presented in Table 1 are wrong. The corrected sequences are:
  • Actin forward primer: 5′ ACCGCGAGAAGATGACCCAG 3′
  • Actin reverse primer: 5′ AGGTCCAGACGCAGGATGG 3′
The authors would like to apologize for any inconvenience caused. The change does not affect the scientific results. The manuscript will be updated and the original will remain online on the article webpage.

Conflicts of Interest

The authors declare no conflict of interest.

Reference

  1. Roche, J.; Nasarre, P.; Gemmill, R.; Baldys, A.; Pontis, J.; Korch, C.; Guilhot, J.; Ait-Si-Ali, S.; Drabkin, H. Global decrease of histone H3K27 acetylation in ZEB1-induced epithelial to mesenchymal transition in lung cancer cells. Cancers 2013, 5, 334–356. [Google Scholar] [CrossRef] [PubMed]

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.