The authors wish to make the following correction to their paper [1]. The sequences of actin primers used in qRT-PCR presented in Table 1 are wrong. The corrected sequences are:
- Actin forward primer: 5′ ACCGCGAGAAGATGACCCAG 3′
- Actin reverse primer: 5′ AGGTCCAGACGCAGGATGG 3′
The authors would like to apologize for any inconvenience caused. The change does not affect the scientific results. The manuscript will be updated and the original will remain online on the article webpage.
Conflicts of Interest
The authors declare no conflict of interest.
Reference
- Roche, J.; Nasarre, P.; Gemmill, R.; Baldys, A.; Pontis, J.; Korch, C.; Guilhot, J.; Ait-Si-Ali, S.; Drabkin, H. Global decrease of histone H3K27 acetylation in ZEB1-induced epithelial to mesenchymal transition in lung cancer cells. Cancers 2013, 5, 334–356. [Google Scholar] [CrossRef] [PubMed]
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).