Epithelial-to-Mesenchymal Transition Enhances Cancer Cell Sensitivity to Cytotoxic Effects of Cold Atmospheric Plasmas in Breast and Bladder Cancer Systems
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. PAM Generation
2.3. Cell Culture
2.4. EMT Score Analysis
2.5. Live and Dead Cell Viability
2.6. ROS Detection
2.7. Spheroid Generation
2.8. Spheroid Viability Assays and Growth Kinetics
2.9. RNA Extraction, cDNA Synthesis, and Realtime Quantitative PCR (RT-qPCR)
2.10. Statistics
3. Results
3.1. Mesenchymal Breast and Bladder Cell Lines Are More Sensitive to PAM Than Their Epithelial Counterparts in 2D Culture
3.2. ROS Level Increase in Mesenchymal Cell Lines Is Higher Than in Epithalial Counterparts Following PAM Treatment
3.3. Transcriptomally Derived EMT Scores Correlate with PAM Response
3.4. Serum-Containing Media Counteracts the Inhibition of Cell Viability Caused by PAM in BREASt and Bladder Cancer Cell Lines
3.5. PAM Effects on EMT Marker Expression Required the Presence of FBS in MDA-MB-231 Cells
3.6. The 3D Bladder Spheroid Model Confirms the Association of the Mesenchymal State and Cell Sensitivity to PAM
3.7. The 3D Bladder Spheroid Model Confirms the Association of the Mesenchymal State and Cell ROS Level
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Keidar, M.; Shashurin, A.; Volotskova, O.; Stepp, M.A.; Srinivasan, P.; Sandler, A.D.; Trink, B. Cold atmospheric plasma in cancer therapy. Phys. Plasmas 2013, 20, 057101. [Google Scholar] [CrossRef]
- Kim, C.; Gao, R.; Sei, E.; Brandt, R.; Hartman, J.; Hatschek, T.; Crosetto, N.; Foukakis, T.; Navin, N.E. Chemoresistance Evolution in Triple-Negative Breast Cancer Delineated by Single-Cell Sequencing. Cell 2018, 173, 879–893.e13. [Google Scholar] [CrossRef]
- Dai, X.; Bazaka, K.; Richard, D.J.; Thompson, E.R.W.; Ostrikov, K.K. The Emerging Role of Gas Plasma in Oncotherapy. Trends Biotechnol. 2018, 36, 1183–1198. [Google Scholar] [CrossRef]
- Xiang, L.; Xu, X.; Zhang, S.; Cai, D.; Dai, X. Cold atmospheric plasma conveys selectivity on triple negative breast cancer cells both in vitro and in vivo. Free Radic. Biol. Med. 2018, 124, 205–213. [Google Scholar] [CrossRef] [PubMed]
- Zhou, R.; Zhou, R.; Wang, P.; Luan, B.; Zhang, X.; Fang, Z.; Xian, Y.; Lu, X.; Ostrikov, K.K.; Bazaka, K. Microplasma Bubbles: Reactive Vehicles for Biofilm Dispersal. ACS Appl. Mater. Interfaces 2019, 11, 20660–20669. [Google Scholar] [CrossRef] [PubMed]
- Zhou, R.; Zhou, R.; Wang, P.; Xian, Y.; Mai-Prochnow, A.; Lu, X.P.; Cullen, P.J.; Ostrikov, K.K.; Bazaka, K. Plasma-activated water: Generation, origin of reactive species and biological applications. J. Phys. D Appl. Phys. 2020, 53, 303001. [Google Scholar] [CrossRef]
- Chen, Z.; Lin, L.; Zheng, Q.; Sherman, J.H.; Canady, J.; Trink, B.; Keidar, M. Micro-Sized Cold Atmospheric Plasma Source for Brain and Breast Cancer Treatment. Plasma Med. 2018, 8, 203–215. [Google Scholar] [CrossRef]
- Tavares-da-Silva, E.; Pereira, E.; Pires, A.S.; Neves, A.R.; Braz-Guilherme, C.; Marques, I.A.; Abrantes, A.M.; Gonçalves, A.C.; Caramelo, F.; Silva-Teixeira, R. Cold Atmospheric Plasma, a Novel Approach against Bladder Cancer, with Higher Sensitivity for the High-Grade Cell Line. Biology 2021, 10, 41. [Google Scholar] [CrossRef]
- Lee, J.; Moon, H.; Ku, B.; Lee, K.; Hwang, C.-Y.; Baek, S.J. Anticancer Effects of Cold Atmospheric Plasma in Canine Osteo-sarcoma Cells. Int. J. Mol. Sci. 2020, 21, 4556. [Google Scholar] [CrossRef]
- Gay-Mimbrera, J.; García, M.C.; Isla-Tejera, B.; Rodero, A.; García-Nieto, A.V.; Ruano, J. Clinical and Biological Principles of Cold Atmospheric Plasma Application in Skin Cancer. Adv. Ther. 2016, 33, 894–909. [Google Scholar] [CrossRef]
- Yang, J.; Antin, P.; Berx, G.; Blanpain, C.; Brabletz, T.; Bronner, M.; Campbell, K.; Cano, A.; Casanova, J.; Christofori, G.; et al. Guidelines and definitions for research on epithelial–mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2020, 21, 341–352. [Google Scholar] [CrossRef]
- Yang, J.; Weinberg, R.A. Epithelial-Mesenchymal Transition: At the Crossroads of Development and Tumor Metastasis. Dev. Cell 2008, 14, 818–829. [Google Scholar] [CrossRef] [PubMed]
- Williams, E.D.; Gao, D.; Redfern, A.; Thompson, E.W. Controversies around epithelial–mesenchymal plasticity in cancer metastasis. Nat. Rev. Cancer 2019, 19, 716–732. [Google Scholar] [CrossRef]
- Neve, R.M.; Chin, K.; Fridlyand, J.; Yeh, J.; Baehner, F.L.; Fevr, T.; Clark, L.; Bayani, N.; Coppe, J.P.; Tong, F.; et al. A collec-tion of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell 2006, 10, 515–527. [Google Scholar] [CrossRef]
- Blick, T.; Widodo, E.; Hugo, H.; Waltham, M.; Lenburg, M.E.; Neve, R.M.; Thompson, E.W. Epithelial mesenchymal transition traits in human breast cancer cell lines. Clin. Exp. Metastasis 2008, 25, 629–642. [Google Scholar] [CrossRef] [PubMed]
- Blick, T.; Hugo, H.; Widodo, E.; Waltham, M.; Pinto, C.; Mani, S.; Weinberg, R.; Neve, R.; Lenburg, M.; Thompson, E. Epithe-lial Mesenchymal Transition Traits in Human Breast Cancer Cell Lines Parallel the CD44hi/CD24lo/- Stem Cell Phenotype in Human Breast Cancer. J. Mammary Gland Biol. Neoplasia 2010, 15, 235–252. [Google Scholar] [CrossRef] [PubMed]
- Foroutan, M.; Bhuva, D.D.; Lyu, R.; Horan, K.; Cursons, J.; Davis, M.J. Single sample scoring of molecular phenotypes. BMC Bioinform. 2018, 19, 404. [Google Scholar] [CrossRef]
- Lehmann, B.; Bauer, J.A.; Chen, X.; Sanders, M.E.; Chakravarthy, A.B.; Shyr, Y.; Pietenpol, J.A. Identification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapies. J. Clin. Investig. 2011, 121, 2750–2767. [Google Scholar] [CrossRef]
- Lehmann, B.D.; Jovanović, B.; Chen, X.; Estrada, M.V.; Johnson, K.N.; Shyr, Y.; Moses, H.L.; Sanders, M.E.; Pietenpol, J.A. Refinement of Triple-Negative Breast Cancer Molecular Subtypes: Implications for Neoadjuvant Chemotherapy Selection. PLoS ONE 2016, 11, e0157368. [Google Scholar] [CrossRef]
- Fougner, C.; Bergholtz, H.; Norum, J.H.; Sørlie, T. Re-definition of claudin-low as a breast cancer phenotype. Nat. Commun. 2020, 11, 1–11. [Google Scholar] [CrossRef]
- Ackland, M.; Michalczyk, A.; Whitehead, R. PMC42, A Novel Model for the Differentiated Human Breast. Exp. Cell Res. 2001, 263, 14–22. [Google Scholar] [CrossRef] [PubMed]
- Ackland, M.L.; Newgreen, D.F.; Fridman, M.; Waltham, M.C.; Arvanitis, A.; Minichiello, J.; Price, J.T.; Thompson, E.W. Epi-dermal growth factor-induced epithelio-mesenchymal transition in human breast carcinoma cells. Lab. Investig. J. Tech. Methods Pathol. 2003, 83, 435–448. [Google Scholar] [CrossRef]
- Hugo, H.J.; Kokkinos, M.I.; Blick, T.; Ackland, M.L.; Thompson, E.W.; Newgreen, D.F. Defining the E-Cadherin Repressor Interactome in Epithelial-Mesenchymal Transition: The PMC42 Model as a Case Study. Cells Tissues Organs 2011, 193, 23–40. [Google Scholar] [CrossRef] [PubMed]
- Bhatia, S.; Monkman, J.; Blick, T.; Duijf, P.H.; Nagaraj, S.H.; Thompson, E.W. Multi-omics characterization of the spontane-ous mesenchymal–epithelial transition in the PMC42 breast cancer cell lines. J. Clin. Med. 2019, 8, 1253. [Google Scholar] [CrossRef] [PubMed]
- Warrick, J.I.; Walter, V.; Yamashita, H.; Chung, E.; Shuman, L.; Amponsa, V.O.; Zheng, Z.; Chan, W.; Whitcomb, T.L.; Yue, F. FOXA1, GATA3 and PPARɣ cooperate to drive luminal subtype in bladder cancer: A molecular analysis of established hu-man cell lines. Sci. Rep. 2016, 6, 1–15. [Google Scholar] [CrossRef]
- Chaffer, C.L.; Brennan, J.P.; Slavin, J.L.; Blick, T.; Thompson, E.W.; Williams, E.D. Mesenchymal-to-epithelial transition fa-cilitates bladder cancer metastasis: Role of fibroblast growth factor receptor-2. Cancer Res. 2006, 66, 11271–11278. [Google Scholar] [CrossRef]
- Chaffer, C.L.; Dopheide, B.; Savagner, P.; Thompson, E.W.; Williams, E.D. Aberrant fibroblast growth factor receptor sig-naling in bladder and other cancers. Differentiation 2007, 75, 831–842. [Google Scholar] [CrossRef]
- Reuter, S.; Von Woedtke, T.; Weltmann, K.-D. The kINPen—A review on physics and chemistry of the atmospheric pressure plasma jet and its applications. J. Phys. D Appl. Phys. 2018, 51, 233001. [Google Scholar] [CrossRef]
- Tan, T.Z.; Miow, Q.H.; Miki, Y.; Noda, T.; Mori, S.; Huang, R.Y.-J.; Thiery, J.P. Epithelial-mesenchymal transition spectrum quantification and its efficacy in deciphering survival and drug responses of cancer patients. EMBO Mol. Med. 2014, 6, 1279–1293. [Google Scholar] [CrossRef]
- George, J.T.; Jolly, M.K.; Xu, S.; Somarelli, J.A.; Levine, H. Survival Outcomes in Cancer Patients Predicted by a Partial EMT Gene Expression Scoring Metric. Cancer Res. 2017, 77, 6415–6428. [Google Scholar] [CrossRef]
- Byers, L.A.; Diao, L.; Wang, J.; Saintigny, P.; Girard, L.; Peyton, M.; Shen, L.; Fan, Y.; Giri, U.; Tumula, P.K.; et al. An Epithelial–Mesenchymal Transition Gene Signature Predicts Resistance to EGFR and PI3K Inhibitors and Identifies Axl as a Therapeutic Target for Overcoming EGFR Inhibitor Resistance. Clin. Cancer Res. 2013, 19, 279–290. [Google Scholar] [CrossRef]
- Chakraborty, P.; George, J.T.; Tripathi, S.; Levine, H.; Jolly, M.K. Comparative study of transcriptomics-based scoring met-rics for the epithelial-hybrid-mesenchymal spectrum. Front. Bioeng. Biotechnol. 2020, 8, 220. [Google Scholar] [CrossRef]
- Barretina, J.; Caponigro, G.; Stransky, N.; Venkatesan, K.; Margolin, A.A.; Kim, S.; Wilson, C.J.; Lehár, J.; Kryukov, G.V.; Sonkin, D. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 2012, 483, 603–607. [Google Scholar] [CrossRef] [PubMed]
- Scherf, U.; Ross, D.T.; Waltham, M.; Smith, L.H.; Lee, J.K.; Tanabe, L.; Kohn, K.W.; Reinhold, W.; Myers, T.G.; Andrews, D.T.; et al. A gene expression database for the molecular pharmacology of cancer. Nat. Genet. 2000, 24, 236–244. [Google Scholar] [CrossRef]
- Cursons, J.; Leuchowius, K.-J.; Waltham, M.; Tomaskovic-Crook, E.; Foroutan, M.; Bracken, C.P.; Redfern, A.; Crampin, E.J.; Street, I.; Davis, M.J.; et al. Stimulus-dependent differences in signalling regulate epithelial-mesenchymal plasticity and change the effects of drugs in breast cancer cell lines. Cell Commun. Signal. 2015, 13, 1–21. [Google Scholar] [CrossRef]
- Apak, R.; Güçlü, K.; Özyürek, M.; Karademir, S.E.; Altun, M. Total antioxidant capacity assay of human serum using copper (II)-neocuproine as chromogenic oxidant: The CUPRAC method. Free Radic. Res. 2005, 39, 949–961. [Google Scholar] [CrossRef]
- Yan, D.; Sherman, J.H.; Cheng, X.; Ratovitski, E.; Canady, J.; Keidar, M. Controlling plasma stimulated media in cancer treatment application. Appl. Phys. Lett. 2014, 105, 224101. [Google Scholar] [CrossRef]
- Moloney, J.N.; Cotter, T.G. ROS signalling in the biology of cancer. Semin. Cell Dev. Biol. 2018, 80, 50–64. [Google Scholar] [CrossRef]
- Kirtonia, A.; Sethi, G.; Garg, M. The multifaceted role of reactive oxygen species in tumorigenesis. Cell. Mol. Life Sci. 2020, 77, 4459–4483. [Google Scholar] [CrossRef] [PubMed]
- Bauer, G.; Sersenová, D.; Graves, D.B.; Machala, Z. Cold Atmospheric Plasma and Plasma-Activated Medium Trigger RONS-Based Tumor Cell Apoptosis. Sci. Rep. 2019, 9, 1–28. [Google Scholar] [CrossRef] [PubMed]
- Angelova, P.R.; Barilani, M.; Lovejoy, C.; Dossena, M.; Viganò, M.; Seresini, A.; Piga, D.; Gandhi, S.; Pezzoli, G.; Abramov, A.Y.; et al. Mitochondrial dysfunction in Parkinsonian mesenchymal stem cells impairs differentiation. Redox Biol. 2018, 14, 474–484. [Google Scholar] [CrossRef]
- Schieber, M.S.; Chandel, N.S. ROS Links Glucose Metabolism to Breast Cancer Stem Cell and EMT Phenotype. Cancer Cell 2013, 23, 265–267. [Google Scholar] [CrossRef] [PubMed]
- Shibue, T.; Weinberg, T.S.R.A. EMT, CSCs, and drug resistance: The mechanistic link and clinical implications. Nat. Rev. Clin. Oncol. 2017, 14, 611–629. [Google Scholar] [CrossRef] [PubMed]
- Bhatia, S.; Monkman, J.; Toh, A.K.L.; Nagaraj, S.H.; Thompson, E.W. Targeting epithelial–mesenchymal plasticity in cancer: Clinical and preclinical advances in therapy and monitoring. Biochem. J. 2017, 474, 3269–3306. [Google Scholar] [CrossRef]
- Redfern, A.D.; Spalding, L.J.; Thompson, E.W. The Kraken Wakes: Induced EMT as a driver of tumour aggression and poor outcome. Clin. Exp. Metastasis 2018, 35, 285–308. [Google Scholar] [CrossRef]
- Jolly, M.K.; Murphy, R.J.; Bhatia, S.; Whitfield, H.J.; Davis, M.J.; Thompson, E.W. Measuring and Modelling the Ep-ithelial Mesenchymal Hybrid State in Cancer: Clinical Implications. Preprints 2020. [Google Scholar] [CrossRef]
- Wang, M.; Holmes, B.; Cheng, X.; Zhu, W.; Keidar, M.; Zhang, L.G. Cold atmospheric plasma for selectively ablating meta-static breast cancer cells. PLoS ONE 2013, 8, e73741. [Google Scholar]
- Tanaka, H.; Bekeschus, S.; Yan, D.; Hori, M.; Keidar, M.; Laroussi, M. Plasma-Treated Solutions (PTS) in Cancer Therapy. Cancers 2021, 13, 1737. [Google Scholar] [CrossRef] [PubMed]
- Hugo, H.J.; Gunasinghe, N.P.A.D.; Hollier, B.G.; Tanaka, T.; Blick, T.; Toh, A.; Hill, P.; Gilles, C.; Waltham, M.; Thompson, E.W. Epithelial requirement for in vitro proliferation and xenograft growth and metastasis of MDA-MB-468 human breast cancer cells: Oncogenic rather than tumor-suppressive role of E-cadherin. Breast Cancer Res. 2017, 19, 1–25. [Google Scholar] [CrossRef]
- Tachtsidis, A.; Le, A.V.-P.; Blick, T.; Gunasinghe, D.; De Sousa, E.; Waltham, M.; Dobrovic, A.; Thompson, E.W. Human-specific RNA analysis shows uncoupled epithelial-mesenchymal plasticity in circulating and disseminated tumour cells from human breast cancer xenografts. Clin. Exp. Metastasis 2019, 36, 393–409. [Google Scholar] [CrossRef]
- Adhikari, M.; Kaushik, N.; Ghimire, B.; Adhikari, B.; Baboota, S.; Al-Khedhairy, A.A.; Wahab, R.; Lee, S.-J.; Kaushik, N.K.; Choi, E.H. Cold atmospheric plasma and silymarin nanoemulsion synergistically inhibits human melanoma tumorigenesis via targeting HGF/c-MET downstream pathway. Cell Commun. Signal. 2019, 17, 1–14. [Google Scholar] [CrossRef]
- Bhatia, S.; Wang, P.; Toh, A.; Thompson, E.W. New Insights Into the Role of Phenotypic Plasticity and EMT in Driving Cancer Progression. Front. Mol. Biosci. 2020, 7, 71. [Google Scholar] [CrossRef] [PubMed]
- Vlachogiannis, G.; Hedayat, S.; Vatsiou, A.; Jamin, Y.; Fernández-Mateos, J.; Khan, K.; Lampis, A.; Eason, K.; Huntingford, I.; Burke, R.; et al. Patient-derived organoids model treatment response of metastatic gastrointestinal cancers. Science 2018, 359, 920–926. [Google Scholar] [CrossRef]
- Drost, J.; Clevers, H. Organoids in cancer research. Nat. Rev. Cancer 2018, 18, 407–418. [Google Scholar] [CrossRef] [PubMed]
- Privat-Maldonado, A.; Gorbanev, Y.; Dewilde, S.; Smits, E.; Bogaerts, A. Reduction of Human Glioblastoma Spheroids Using Cold Atmospheric Plasma: The Combined Effect of Short- and Long-Lived Reactive Species. Cancers 2018, 10, 394. [Google Scholar] [CrossRef]
- Semmler, M.L.; Bekeschus, S.; Schäfer, M.; Bernhardt, T.; Fischer, T.; Witzke, K.; Seebauer, C.; Rebl, H.; Grambow, E.; Vollmar, B.; et al. Molecular Mechanisms of the Efficacy of Cold Atmospheric Pressure Plasma (CAP) in Cancer Treatment. Cancers 2020, 12, 269. [Google Scholar] [CrossRef] [PubMed]
- Dubuc, A.; Monsarrat, P.; Virard, F.; Merbahi, N.; Sarrette, J.-P.; Laurencin-Dalicieux, S.; Cousty, S. Use of cold-atmospheric plasma in oncology: A concise systematic review. Ther. Adv. Med. Oncol. 2018, 10. [Google Scholar] [CrossRef]
- Yadav, D.K.; Adhikari, M.; Kumar, S.; Ghimire, B.; Han, I.; Kim, M.-H.; Choi, E.-H. Cold atmospheric plasma generated re-active species aided inhibitory effects on human melanoma cells: An in vitro and in silico study. Sci. Rep. 2020, 10, 1–15. [Google Scholar]
- Guerrero-Preston, R.; Ogawa, T.; Uemura, M.; Shumulinsky, G.; Valle, B.L.; Pirini, F.; Ravi, R.; Sidransky, D.; Keidar, M.; Trink, B. Cold atmospheric plasma treatment selectively targets head and neck squamous cell carcinoma cells. Int. J. Mol. Med. 2014, 34, 941–946. [Google Scholar] [CrossRef]
- Von Woedtke, T.; Metelmann, H.-R.; Weltmann, K.-D. Clinical Plasma Medicine: State and Perspectives ofin VivoApplication of Cold Atmospheric Plasma. Contrib. Plasma Phys. 2014, 54, 104–117. [Google Scholar] [CrossRef]
- Mani, S.A.; Guo, W.; Liao, M.J.; Eaton, E.N.; Ayyanan, A.; Zhou, A.Y.; Brooks, M.; Reinhard, F.; Zhang, C.C.; Shipitsin, M.; et al. The Epithelial-Mesenchymal Transition Generates Cells with Properties of Stem Cells. Cell 2008, 133, 704–715. [Google Scholar] [CrossRef]
- Raviraj, V.; Zhang, H.; Chien, H.-Y.; Cole, L.; Thompson, E.W.; Soon, L. Dormant but migratory tumour cells in desmoplastic stroma of invasive ductal carcinomas. Clin. Exp. Metastasis 2012, 29, 273–292. [Google Scholar] [CrossRef]
- Zhou, X.; Cai, D.; Xiao, S.; Ning, M.; Zhou, R.; Zhang, S.; Chen, X.; Ostrikov, K.; Dai, X. InvivoPen: A novel plasma source for in vivo cancer treatment. J. Cancer 2020, 11, 2273–2282. [Google Scholar] [CrossRef]
- Xu, X.; Dai, X.; Xiang, L.; Cai, D.; Xiao, S.; Ostrikov, K. Quantitative assessment of cold atmospheric plasma anti-cancer efficacy in triple-negative breast cancers. Plasma Processes Polym. 2018, 15, 1800052. [Google Scholar] [CrossRef]
- Bloom, A.C.; Bender, L.H.; Tiwary, S.; Pasquet, L.; Clark, K.; Jiang, T.; Xia, Z.; Morales-Kastresana, A.; Jones, J.C.; Walters, I.; et al. Intratumorally delivered formulation, INT230-6, containing potent anticancer agents induces protective T cell immunity and memory. OncoImmunology 2019, 8, e1625687. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Atkinson, V.G.; Menzies, A.M. Intratumoural immunotherapies in oncology. Eur. J. Cancer 2020, 127, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Ye, Y.; Hochu, G.M.; Sadeghifar, H.; Gu, Z. Enhanced cancer immunotherapy by microneedle patch-assisted de-livery of anti-PD1 antibody. Nano Lett. 2016, 16, 2334–2340. [Google Scholar] [CrossRef] [PubMed]
- Demand, V.O.; Leaders, T.; Newswire, P. QBiotics Receives First Registration for Tigilanol Tiglate with European Medicines Agency Approval of Stelfonta (R). The Leaders. 2020. Available online: https://theleaders-online.com/qbiotics-receives-first-registration-for-tigilanol-tiglate-with-european-medicines-agency-approval-of-stelfontar/ (accessed on 15 April 2021).
- Van Loenhout, J.; Flieswasser, T.; Freire Boullosa, L.; De Waele, J.; Van Audenaerde, J.; Marcq, E.; Jacobs, J.; Lin, A.; Lion, E.; Dewitte, H. Cold atmospheric plasma-treated PBS eliminates immunosuppressive pancreatic stellate cells and induces im-munogenic cell death of pancreatic cancer cells. Cancers 2019, 11, 1597. [Google Scholar] [CrossRef]









| Gene Symbol | Forward Primer Sequence | Reverse Primer Sequence |
|---|---|---|
| EpCAM | CTCGCGTTCGGGCTTCTGCTT | CAACTGAAGTACACTGGCATTGACGATTATT |
| SNAI2 | CTGATGGCTAGATTGAGAGAATAAAAGACAGTAA | CACAGCAGCCAGATTCCTCATGTTT |
| SNAI1 | CACATCCTTCTCACTGCCATGGAATT | CGCCTGGCACTGGTACTTCTT |
| VIM | CTAGAGATGGACAGGTTATCAACGAA | CCGTGAGGTCAGGCTTGGAAA |
| ZEB1 | GTTACCAGGGAGGAGCAGTGAAA | GACAGCAGTGTCTTGTTGTTGTAGAAA |
| TWIST1 | CTAGAGACTCTGGAGCTGGATAACTAAAAA | AAAGCTATTGATGGGCATGG |
| L32 | CAGGGTTCGTAGAAGATTCAAGGG | CTTGGAGGAAACATTGTGAGCGATC |
| CD24 | CTGTTCTCTTGGGAACTGAACTCACTTT | GTTGCCTCTC CTTCATCTTG TACATGAAA |
| CD44 | GGTATCTCCTTTCTGAGGCTCCTACTAAAA | CTTCGACTGTTGACTGCAATGCAAA |
| CDH1 | CTGTGCCCAGCCTCCATGTTTT | CAAGATGTGGCCAGACAAAGACACAAA |
| CDH2 | CAGTAAAATTGAGCCTGAAGCCAACCTTA | AATGAAGATACCAGTTGGAGGCTGGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, P.; Zhou, R.; Thomas, P.; Zhao, L.; Zhou, R.; Mandal, S.; Jolly, M.K.; Richard, D.J.; Rehm, B.H.A.; Ostrikov, K.; et al. Epithelial-to-Mesenchymal Transition Enhances Cancer Cell Sensitivity to Cytotoxic Effects of Cold Atmospheric Plasmas in Breast and Bladder Cancer Systems. Cancers 2021, 13, 2889. https://doi.org/10.3390/cancers13122889
Wang P, Zhou R, Thomas P, Zhao L, Zhou R, Mandal S, Jolly MK, Richard DJ, Rehm BHA, Ostrikov K, et al. Epithelial-to-Mesenchymal Transition Enhances Cancer Cell Sensitivity to Cytotoxic Effects of Cold Atmospheric Plasmas in Breast and Bladder Cancer Systems. Cancers. 2021; 13(12):2889. https://doi.org/10.3390/cancers13122889
Chicago/Turabian StyleWang, Peiyu, Renwu Zhou, Patrick Thomas, Liqian Zhao, Rusen Zhou, Susmita Mandal, Mohit Kumar Jolly, Derek J. Richard, Bernd H. A. Rehm, Kostya (Ken) Ostrikov, and et al. 2021. "Epithelial-to-Mesenchymal Transition Enhances Cancer Cell Sensitivity to Cytotoxic Effects of Cold Atmospheric Plasmas in Breast and Bladder Cancer Systems" Cancers 13, no. 12: 2889. https://doi.org/10.3390/cancers13122889
APA StyleWang, P., Zhou, R., Thomas, P., Zhao, L., Zhou, R., Mandal, S., Jolly, M. K., Richard, D. J., Rehm, B. H. A., Ostrikov, K., Dai, X., Williams, E. D., & Thompson, E. W. (2021). Epithelial-to-Mesenchymal Transition Enhances Cancer Cell Sensitivity to Cytotoxic Effects of Cold Atmospheric Plasmas in Breast and Bladder Cancer Systems. Cancers, 13(12), 2889. https://doi.org/10.3390/cancers13122889

