Improvement of Late-Onset Hypogonadism Symptoms of Fermented Morinda citrifolia Extract in TM3 Leydig and TM4 Sertoli Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Fermented Morinda citrifolia Extract (FME) and Testofen
2.2. Cell Culture
2.3. Cell Viability Assay
2.4. Measurement of Testosterone Level
2.5. Quantitative Real-Time PCR(qRT-PCR) Analysis
2.6. Western Blot Analysis
2.7. Measurement of 3β-HSD2, 17β-HSD3, 5α-Reductase, and Aromatase Levels
2.8. Statistical Analysis
3. Results
3.1. Effect of FME, Testofen, and H2O2 on the Viability of TM3 and TM4 Cells
3.2. FME Enhances Testosterone Production in H2O2-Treated TM3 Cells
3.3. FME Modulates the mRNA Expression of Genes Involved in the Synthesis and Degradation of Testosterone
3.4. Effect of FME on Protein Expression of Testosterone Synthesis or Degradation Biomarkers
3.5. FME Regulates the Expression Levels of AR and FSHR in Sertoli Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khodamoradi, A.; Hassanipour, S.; DaryabeigiKhotbesara, R.; Ahmadi, B. The trend of population aging and planning of health services for the elderly: A review study. J. Torbat Heydariyeh Univ. Med. Sci. 2018, 6, 81–95. [Google Scholar]
- Jin, K.; Simpkins, J.W.; Ji, X.; Leis, M.; Stambler, I. The critical need to promote research of aging and aging-related diseases to improve health and longevity of the elderly population. Aging Disease 2015, 6, 1. [Google Scholar] [CrossRef] [PubMed]
- Saalu, L.C.; Osinubi, A.A. Andropause (male menopause): Valid concepts, fables and controversies. J. Basic Med. Sci. 2022, 1, 1. [Google Scholar]
- Werner, A.A. The male climacteric. JAMA 1939, 112, 1441–1443. [Google Scholar] [CrossRef]
- Saad, F.; Gooren, L.J. Late onset hypogonadism of men is not equivalent to the menopause. Maturitas 2014, 79, 52–57. [Google Scholar] [CrossRef]
- Vermeulen, A. Andropause. Maturitas 2000, 34, 5–15. [Google Scholar] [CrossRef]
- Singh, P. Andropause: Current concepts. Indian J. Endocrinol. Metab. 2013, 17, S621–S629. [Google Scholar] [CrossRef]
- Comhaire, F.H. Andropause: Hormone replacement therapy in the ageing male. Eur. Urol. 2000, 200038, 655–662. [Google Scholar] [CrossRef]
- Martelli, M.; Zingaretti, L.; Salvio, G.; Bracci, M.; Santarelli, L. Influence of work on andropause and menopause: A systematic review. Int. J. Environ. Res. Public Health 2021, 18, 10074. [Google Scholar] [CrossRef]
- Cunningham, G.R. Andropause or male menopause? Rationale for testosterone replacement therapy in older men with low testosterone levels. Endocr. Pract. 2013, 19, 847–852. [Google Scholar] [CrossRef]
- Haider, S.G. Cell biology of Leydig cells in the testis. Int. Rev. Cytol. 2004, 233, 181–241. [Google Scholar] [PubMed]
- Widhiantara, I.G.; Permatasari, A.A.A.P.; Rosiana, I.W.; Wiradana, P.A.; Satriyasa, B. Steroidogenesis mechanism, disruption factor, gene function, and role in male fertility: A mini review. Indian J. Forensic Med. Toxicol. 2021, 15, 1456–1468. [Google Scholar] [CrossRef]
- Jefferi, N.E.S.; Shamhari, A.A.; Hamid, Z.A.; Budin, S.B.; Zulkifly, A.M.Z.; Roslan, F.N.; Taib, I.S. Knowledge gap in understanding the steroidogenic acute regulatory protein regulation in steroidogenesis following exposure to bisphenol A and its analogues. Biomedicines 2022, 10, 1281. [Google Scholar] [CrossRef] [PubMed]
- Strushkevich, N.; MacKenzie, F.; Cherkesova, T.; Grabovec, I.; Usanov, S.; Park, H.W. Structural basis for pregnenolone biosynthesis by the mitochondrial monooxygenase system. Proc. Natl. Acad. Sci. USA 2011, 108, 10139–10143. [Google Scholar] [CrossRef] [PubMed]
- Morel, Y.; Roucher, F.; Plotton, I.; Simard, J.; Coll, M. 3β-hydroxysteroid dehydrogenase deficiency. In Genetic Steroid Disorders; Academic Press: Cambridge, MA, USA, 2014; pp. 99–110. [Google Scholar]
- Andersson, S.; Geissler, W.M.; Wu, L.; Davis, D.L.; Grumbach, M.M.; New, M.I.; Schwarz, H.P.; Blethen, S.L.; Bloise, W.; Witchel, S.F.; et al. Molecular genetics and pathophysiology of 17 beta-hydroxysteroid dehydrogenase 3 deficiency. J. Clin. Endocrinol. Metab. 1996, 81, 130–136. [Google Scholar]
- Simpson, E.R. Role of aromatase in sex steroid action. J. Mol. Endocrinol. 2000, 25, 149–156. [Google Scholar] [CrossRef]
- Geller, J. Effect of finasteride, a 5 alpha-reductase inhibitor on prostate tissue androgens and prostate-specific antigen. J. Clin. Endocrinol. Metab. 1990, 71, 1552–1555. [Google Scholar] [CrossRef]
- LUO, L.; Chen, H.; Zirkin, B.R. Are Leydig cell steroidogenic enzymes differentially regulated with aging? J. Androl. 1996, 17, 509–515. [Google Scholar] [CrossRef]
- Barone, B.; Napolitano, L.; Abate, M.; Cirillo, L.; Reccia, P.; Passaro, F.; Turco, C.; Morra, S.; Mastrangelo, F.; Scarpato, A.; et al. The role of testosterone in the elderly: What do we know? Int. J. Mol. Sci. 2022, 23, 3535. [Google Scholar] [CrossRef]
- Walker, W.H. Testosterone signaling and the regulation of spermatogenesis. Spermatogenes 2011, 1, 116–120. [Google Scholar] [CrossRef]
- Sharpe, R.M.; McKinnell, C.; Kivlin, C.; Fisher, J.S. Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reprod.-Camb. 2003, 125, 769–784. [Google Scholar] [CrossRef] [PubMed]
- Walker, W.H.; Cheng, J. FSH and testosterone signaling in Sertoli cells. Reprod.-Camb. 2005, 130, 15–28. [Google Scholar] [CrossRef] [PubMed]
- Johnson, L.; Zane, R.S.; Petty, C.S.; Neaves, W.B. Quantification of the human Sertoli cell population: Its distribution, relation to germ cell numbers, and age-related decline. Biol. Reprod. 1984, 31, 785–795. [Google Scholar] [CrossRef] [PubMed]
- Haji, M.; Tanaka, S.; Nishi, Y.; Yanase, T.; Takayanagi, R.; Hasegawa, Y.; Sasamoto, S.; Nawata, H. Sertoli cell function declines earlier than Leydig cell function in aging Japanese men. Maturitas 1994, 18, 143–153. [Google Scholar] [CrossRef]
- Petersen, P.M.; Seierøe, K.; Pakkenberg, B. The total number of Leydig and Sertoli cells in the testes of men across various age groups–a stereological study. J. Anat. 2015, 226, 175–179. [Google Scholar] [CrossRef]
- Lund, B.C.; Bever-Stille, K.A.; Perry, P.J. Testosterone and andropause: The feasibility of testosterone replacement therapy in elderly men. Pharmacotherapy 1999, 19, 951–956. [Google Scholar] [CrossRef]
- Sternbach, H. Age-associated testosterone decline in men: Clinical issues for psychiatry. Am. J. Psychiatry 1998, 155, 1310–1318. [Google Scholar] [CrossRef] [PubMed]
- Kofler, T.; Yueksel, F.; Dirnhofer, S.; Donath, M.Y.; Trendelenburg, M. Abdominal pain and hypertension in a 55-year-old male patient. Der. Internist. 2017, 58, 397–401. [Google Scholar] [CrossRef]
- Lo, E.M.; Rodriguez, K.M.; Pastuszak, A.W.; Khera, M. Alternatives to testosterone therapy: A review. Sex. Med. Rev. 2018, 6, 106–113. [Google Scholar] [CrossRef] [PubMed]
- Matsumoto, A.M. Andropause: Clinical implications of the decline in serum testosterone levels with aging in men. J. Gerontol. A Biol. Sci. Med. Sci. 2002, 57, M76–M99. [Google Scholar] [CrossRef]
- Klotz, L. Testosterone therapy and prostate cancer—Safety concerns are well founded. Nat. Rev. Urol. 2015, 12, 48–54. [Google Scholar] [CrossRef] [PubMed]
- Noh, Y.H.; Kim, D.H.; Kim, J.Y.; Park, J.; Kim, O.H.; Han, D.; Kim, W.Y.; Kim, S.S.; Lee, M.Y.; Heo, S.H.; et al. Improvement of andropause symptoms by dandelion and rooibos extract complex CRS-10 in aging male. Nutr. Res. Pract. 2012, 6, 505–512. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.Y.; Kim, S.H.; Yang, W.K.; Lee, G.J. Effect of Tetragonia tetragonoides (Pall.) Kuntze extract on andropause symptoms. Nutrients 2022, 14, 4572. [Google Scholar] [CrossRef] [PubMed]
- Byun, J.H.; Choung, S.Y. Effects of Lespedeza cuneate extracts on andropause symptoms and testosterone metabolism in aged rats. Yakhak Hoeji 2019, 63, 359–366. [Google Scholar] [CrossRef]
- Chan-Blanco, Y.; Vaillant, F.; Perez, A.M.; Reynes, M.; Brillouet, J.M.; Brat, P. The noni fruit (Morinda citrifolia L.): A review of agricultural research, nutritional and therapeutic properties. J. Food Compos. Anal. 2006, 19, 645–654. [Google Scholar] [CrossRef]
- Moht, N.W.M. Pharmacognostic Study of Morinda citrifolia L. Leaf. In Proceedings of the 3rd Myanmar Korea Conference, Yangon, Myanmar, 24 May 2020. [Google Scholar]
- Krishnaiah, D.; Rajesh, N.; Rosalam, S. Phytochemical constituents and activities of Morinda citrifolia L. In Phytochemicals—A Global Perspective of Their Role in Nutrition and Health; Rao, V., Ed.; InTech: Rijeka, Croatia, 2012; pp. 127–150. [Google Scholar]
- Kamiya, K.; Tanaka, Y.; Endang, H.; Umar, M.; Satake, T. Chemical constituents of Morinda citrifolia fruits inhibit copper-induced low-density lipoprotein oxidation. J. Agric. Food Chem. 2004, 52, 5843–5848. [Google Scholar] [CrossRef]
- Kamiya, K.; Tanaka, Y.; Endang, H.; Umar, M.; Satake, T. New anthraquinone and iridoid from the fruits of Morinda citrifolia. Chem. Pharm. Bull. 2005, 53, 1597–1599. [Google Scholar] [CrossRef]
- Singh, D.; Singh, S.; Banu, V. Changes in antioxidants and minerals in noni (Morinda citrifolia L.) fruits during development process. Br. J. Pharm. Res. 2016, 10, 1–11. [Google Scholar] [CrossRef]
- Ali, M.; Mruthunjaya, K.; Santhepete, N. Health benefits of Morinda citrifolia (Noni): A review. Phcog. J. 2016, 8, 321–334. [Google Scholar] [CrossRef]
- Vuanghao, L.; Laghari, M.H. Morinda citrifolia (Noni): A comprehensive review on its industrial uses, pharmacological activities, and clinical trials. Arab. J. Chem. 2017, 10, 691–707. [Google Scholar]
- Almeida, É.S.; de Oliveira, D.; Hotza, D. Properties and applications of Morinda citrifolia (noni): A review. Compr. Rev. Food. Sci. Food Saf. 2019, 18, 883–909. [Google Scholar] [CrossRef] [PubMed]
- Ofeimun, J.O.; Odoh, J.O.; Eze, G.I.; Benjamin, G.; Ayinde, B.A. Comparative effects of fresh and fermented fruit juice of Morinda citrifolia (Rubiaceae) on reproductive parameters in adult male rats. AJHSE 2023, 4, 01–10. [Google Scholar] [CrossRef]
- Ariani, M.; Febriana, A.; Sari, F.D.; Khairunisa; Atifah, Y.; Rahmatika, H. Effect of Noni Extract (Morinda citrifolia L.) on Spermatozoa Quality of Mice (Mus musculus L.) Pengaruh Pemberian Ekstrak Mengkudu (Morinda citrifolia L.) terhadap Kualitas Spermatozoa Mencit (Mus musculus L.). J. Natur. Indonesia 2023, 21, 87–92. [Google Scholar] [CrossRef]
- YİĞİT, F.; Eİ, İ.A.; OBB, E.; MB, U.; AKTAŞ, A. Protective Effect of Morinda citrifolia (Noni) on 3-methyl-4-nitrophenol-induced Injury in Rat Testes. Kafkas Univ. Vet. Fak. Derg. 2016, 22, 605–611. [Google Scholar]
- Choi, S.I.; Kwon, H.Y.; La, I.J.; Jo, Y.H.; Han, X.; Men, X.; LEE, S.J.; Kim, Y.D.; Seong, G.S.; Lee, O.H. Development and validation of an analytical method for deacetylasperulosidic acid, asperulosidic acid, scopolin, asperuloside and scopoletin in fermented Morinda citrifolia L.(Noni). Separations 2021, 8, 80. [Google Scholar] [CrossRef]
- Yadav, N.P.; Dixit, V.K. Recent approaches in herbal drug standardization. Int. J. Integr. Biol. 2008, 2, 195–203. [Google Scholar]
- Ong, E.S. Extraction methods and chemical standardization of botanicals and herbal preparations. J. Chromatogr. B 2004, 812, 23–33. [Google Scholar] [CrossRef]
- Kim, S.H.; Seong, G.S.; Choung, S.Y. Fermented Morinda citrifolia (Noni) alleviates DNCB-induced atopic dermatitis in NC/Nga mice through modulating immune balance and skin barrier function. Nutrients 2020, 12, 249. [Google Scholar] [CrossRef]
- Kim, H.K.; Cha, K.M.; Kim, D.H.; Kim, H.J.; Koo, N.Y.; Oh, S.H. Ameliorating Effect of Trigonella foenum-graecum Seed Extract on Andropause Symptoms via Increased Testosterone. J. Korea Soc. Food Sci. Nutr. 2019, 48, 161–169. [Google Scholar] [CrossRef]
- Rao, A.; Steels, E.; Inder, W.J.; Abraham, S.; Vitetta, L. Testofen, a specialised Trigonella foenum-graecum seed extract reduces age-related symptoms of androgen decrease, increases testosterone levels and improves sexual function in healthy aging males in a double-blind randomised clinical study. Aging Male 2016, 19, 134–142. [Google Scholar] [CrossRef]
- Ko, J.S.; Chang, B.Y.; Choi, Y.J.; Choi, J.S.; Kwon, H.Y.; Lee, J.Y.; Kim, S.Y.; Choung, S.Y. Ashwagandha Ethanol Extract Attenuates Sarcopenia-Related Muscle Atrophy in Aged Mice. Nutrients 2024, 16, 157. [Google Scholar] [CrossRef] [PubMed]
- Jakiel, G.; Makara-Studzińska, M.; Ciebiera, M.; Słabuszewska-Jóźwiak, A. Andropause–state of the art 2015 and review of selected aspects. Prz. Menopauzalny 2015, 14, 1–6. [Google Scholar] [PubMed]
- Monageng, E.; Offor, U.; Takalani, N.B.; Mohlala, K.; Opuwari, C.S. A review on the impact of oxidative stress and medicinal plants on Leydig cells. Antioxidants 2023, 12, 1559. [Google Scholar] [CrossRef] [PubMed]
- Beattie, M.C.; Chen, H.; Fan, J.; Papadopoulos, V.; Miller, P.; Zirkin, B.R. Aging and luteinizing hormone effects on reactive oxygen species production and DNA damage in rat Leydig cells. Biol. Reprod. 2013, 88, 100–101. [Google Scholar] [CrossRef] [PubMed]
- Junqueira, V.B.; Barros, S.B.; Chan, S.S.; Rodrigues, L.; Giavarotti, L.; Abud, R.L.; Deucher, G.P. Aging and oxidative stress. Mol. Asp. Med. 2004, 25, 5–16. [Google Scholar] [CrossRef]
- Gassman, N.R. Induction of oxidative stress by bisphenol A and its pleiotropic effects. Environ. Mol. Mutagen 2017, 58, 60–71. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, Y.; Wang, J.; Huang, F.; Du, P.; Wu, L.; Guo, F.; Song, Y.; Qin, G. LncRNA FENDRR promotes apoptosis of Leydig cells in late-onset hypogonadism by facilitating the degradation of Nrf2. Cell Tissue Res. 2021, 386, 379–389. [Google Scholar] [CrossRef]
- Jung, M.A.; Oh, K.N.; Choi, E.J.; Oh, D.R.; Kim, Y.J.; Bae, D.; Hong, J.A.; Pan, S.; Kim, K.M.; Kim, D.W.; et al. In vitro and in vivo androgen regulation of Dendropanax morbiferus leaf extract on late-onset hypogonadism. Cell Mol. Biol. 2018, 64, 20–27. [Google Scholar] [CrossRef]
- Gautam, D.K.; Misro, M.M.; Chaki, S.P.; Sehgal, N. H2O2 at physiological concentrations modulates Leydig cell function inducing oxidative stress and apoptosis. Apoptosis 2006, 11, 39–46. [Google Scholar] [CrossRef]
- Wang, S.; Ren, X.; Hu, X.; Zhou, L.; Zhang, C.; Zhang, M. Cadmium-induced apoptosis through reactive oxygen species-mediated mitochondrial oxidative stress and the JNK signaling pathway in TM3 cells, a model of mouse Leydig cells. Toxicol. Appl. Pharmacol. 2019, 368, 37–48. [Google Scholar] [CrossRef]
- Wang, J.; Yang, Y.; Xu, Y.; Xu, Z.; Zhao, X.; Jia, R.; Dai, Y. Long noncoding RNA XIST inhibition promotes Leydig cell apoptosis by acting as a competing endogenous RNA for microRNA-145a-5p that targets SIRT1 in late-onset hypogonadism. Cell Tissue Res. 2024, 395, 285–297. [Google Scholar] [CrossRef] [PubMed]
- Chung, H.J.; Noh, Y.; Kim, M.S.; Jang, A.; Lee, C.E.; Myung, S.C. Steroidogenic effects of Taraxacum officinale extract on the levels of steroidogenic enzymes in mouse Leydig cells. Anim. Cells Syst. 2018, 22, 407–414. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.Y.; Lee, Y.J.; Chou, M.C.; Chang, R.; Chiu, C.H.; Liang, Y.J.; Wu, L.S. Astaxanthin protects steroidogenesis from hydrogen peroxide-induced oxidative stress in mouse Leydig cells. Mar. Drugs 2015, 13, 1375–1388. [Google Scholar] [CrossRef] [PubMed]
- Branzoi, I.V.; Iordoc, M.; Branzoi, F.; Vasilescu-Mirea, R.; Sbarcea, G. Influence of diamond-like carbon coating on the corrosion resistance of the NITINOL shape memory alloy. Surf. Interface Anal. 2010, 42, 502–509. [Google Scholar] [CrossRef]
- Adin, C.A. Bilirubin as a therapeutic molecule: Challenges and opportunities. Antioxidants 2021, 10, 1536. [Google Scholar] [CrossRef]
- Stocker, R.; Yamamoto, Y.; McDonagh, A.F.; Glazer, A.N.; Ames, B.N. Bilirubin is an antioxidant of possible physiological importance. Science 1987, 235, 1043–1046. [Google Scholar] [CrossRef]
- Roche, M.; Rondeau, P.; Singh, N.R.; Tarnus, E.; Bourdon, E. The antioxidant properties of serum albumin. FEBS Lett. 2008, 582, 1783–1787. [Google Scholar] [CrossRef]
- Nagumo, K.; Tanaka, M.; Chuang, V.T.G.; Setoyama, H.; Watanabe, H.; Yamada, N.; Kubota, K.; Tanaka, M.; Matsushita, K.; Yoshida, A.; et al. Cys34-cysteinylated human serum albumin is a sensitive plasma marker in oxidative stress-related chronic diseases. PLoS ONE 2014, 9, e85216. [Google Scholar] [CrossRef]
- Taverna, M.; Marie, A.L.; Mira, J.P.; Guidet, B. Specific antioxidant properties of human serum albumin. Ann. Intensive Care 2013, 3, 4. [Google Scholar] [CrossRef]
- Park, S.E.; Lee, H.J.; Jeong, I.S.; Kim, S. Effects of elephant garlic (Allium ampeloprasum) extract on testosterone synthesis in TM3 Leydig cells. Korean J. Food Preserv. 2022, 29, 790–799. [Google Scholar] [CrossRef]
- Kim, G.Y.; Hong, G.L.; Eun, J.K. Effects of extracts from Oja on testosterone synthesis in Leydig cells. J. Physiol. Pathol. Korean Med. 2015, 29, 403–408. [Google Scholar] [CrossRef]
- Ruhomally, Z.; Somanah, J.; Bahorun, T.; Neergheen-Bhujun, V.S. Morinda citrifolia L. fruit extracts modulates H2O2-induced oxidative stress in human liposarcoma SW872 cells. J. Tradit. Complement. Med. 2016, 6, 299–304. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhang, B.; Li, L.; Li, X.; Zhang, J.; Chen, G. Fermented noni (Morinda citrifolia L.) fruit juice improved oxidative stress and insulin resistance under the synergistic effect of Nrf2/ARE pathway and gut flora in db/db mice and HepG2 cells. Food Funct. 2022, 13, 8254–8273. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Zhai, L.; Liu, Z.; Wu, S.; Xu, L. Leptin level and oxidative stress contribute to obesity-induced low testosterone in murine testicular tissue. Oxid. Med. Cell Longev. 2014, 2014, 190945. [Google Scholar] [CrossRef] [PubMed]
- Jung, J.I.; Eun, S.; Lee, J.K.; Seo, Y.H.; Bae, M.H.; Kim, R.; Kim, E.J. Effect of Eurycoma longifolia extract on testosterone synthesis in TM3 leydig cells under oxidative stress. J. Korean Soc. Food Sci. Nutr. 2022, 51, 640–650. [Google Scholar] [CrossRef]
- Jin, H.; Yan, M.; Pan, C.; Liu, Z.; Sha, X.; Jiang, C.; Li, L.; Pan, M.; Li, D.; Han, X.; et al. Chronic exposure to polystyrene microplastics induced male reproductive toxicity and decreased testosterone levels via the LH-mediated LHR/cAMP/PKA/StAR pathway. Part. Fibre Toxicol. 2022, 19, 13. [Google Scholar] [CrossRef]
- Yilmaz, B.O.; Korkut, A.; Erkan, M. Sodium fluoride disrupts testosterone biosynthesis by affecting the steroidogenic pathway in TM3 Leydig cells. Chemosphere 2018, 212, 447–455. [Google Scholar] [CrossRef]
- Miranda, G.H.N.; Gomes, B.A.Q.; Bittencourt, L.O.; Aragão, W.A.B.; Nogueira, L.S.; Dionizio, A.S.; Buzalaf, M.A.R.; Nogueira, L.S.; Lima, R.R. Chronic exposure to sodium fluoride triggers oxidative biochemistry misbalance in mice: Effects on peripheral blood circulation. Oxid. Med. Cell Longev. 2018, 2018, 8379123. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Li, H.; Mo, J.; Chen, X.; Wu, K.; Ge, F.; Ma, L.; Li, X.; Guo, X.; Zhao, J.; et al. Perfluorododecanoic acid blocks rat Leydig cell development during prepuberty. Chem. Res. Toxicol. 2018, 32, 146–155. [Google Scholar] [CrossRef]
- Xu, M.; Zhang, T.; Lv, C.; Niu, Q.; Zong, W.; Tang, J.; Liu, R. Perfluorodecanoic acid-induced oxidative stress and DNA damage investigated at the cellular and molecular levels. Ecotoxicol. Environ. Saf. 2019, 185, 109699. [Google Scholar] [CrossRef]
- Chien, Y.; Rosal, K.; Chung, B.C. Function of CYP11A1 in the mitochondria. Mol. Cell Endocrinol. 2017, 441, 55–61. [Google Scholar] [CrossRef] [PubMed]
- Jeong, B.S.; Kim, S.H.; Kim, H.P. Effect of fermented Cirsium japonicum extract on testosterone deficiency syndrome. J. Korea Soc. Food Sci. Nutr. 2017, 46, 790–800. [Google Scholar]
- Deslypere, J.P.; Young, M.; Wilson, J.D.; McPhaul, M.J. Testosterone and 5α-dihydrotestosterone interact differently with the androgen receptor to enhance transcription of the MMTV-CAT reporter gene. Mol. Cell Endocrinol. 1992, 88, 15–22. [Google Scholar] [CrossRef] [PubMed]
- Kovacs, W.J.; Griffin, J.E.; Weaver, D.D.; Carlson, B.R.; Wilson, J.D. A mutation that causes lability of the androgen receptor under conditions that normally promote transformation to the DNA-binding state. J. Clin. Investig. 1984, 73, 1095–1104. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.X.; Lane, M.V.; Kemppainen, J.A.; French, F.S.; Wilson, E.M. Specificity of ligand-dependent androgen receptor stabilization: Receptor domain interactions influence ligand dissociation and receptor stability. Mol. Endocrinol. 1995, 9, 208–218. [Google Scholar] [PubMed]
- Chen, H.; Chandrashekar, V.; Zirkin, B.R. Can spermatogenesis be maintained quantitatively in intact adult rats with exogenously administered dihydrotestosterone? J. Androl. 1994, 15, 132–138. [Google Scholar] [CrossRef]
- Kash, N.; Leavitt, M.; Leavitt, A.; Hawkins, S.D.; Roopani, R.B. Clinical patterns of hair loss in men: Is dihydrotestosterone the only culprit? Dermatol. Clin. 2021, 39, 361–370. [Google Scholar] [CrossRef]
- Andriole, G.; Bruchovsky, N.; Chung, L.W.; Matsumoto, A.M.; Rittmaster, R.; Roehrborn, C.; Tindall, D. Dihydrotestosterone and the prostate: The scientific rationale for 5α-reductase inhibitors in the treatment of benign prostatic hyperplasia. Urol. J. 2004, 172, 1399–1403. [Google Scholar] [CrossRef]
- Russell, N.; Grossmann, M. Mechanisms in endocrinology: Estradiol as a male hormone. Eur. J. Endocrinol. 2019, 181, R23–R43. [Google Scholar] [CrossRef]
- van den Beld, A.W.; de Jong, F.H.; Grobbee, D.E.; Pols, H.A.; Lamberts, S.W. Measures of bioavailable serum testosterone and estradiol and their relationships with muscle strength, bone density, and body composition in elderly men. J. Clin. Endocrinol. Metab. 2000, 85, 3276–3282. [Google Scholar]
- Gill-Sharma, M.K.; D’souza, S.; Padwal, V.; Balasinor, N.; Aleem, M.; Parte, P.; Juneja, H.S. Antifertility effects of estradiol in adult male rats. J. Endocrinol. Investig. 2001, 24, 598–607. [Google Scholar] [CrossRef] [PubMed]
- Tivesten, Å.; Mellström, D.; Jutberger, H.; Fagerberg, B.; Lernfelt, B.; Orwoll, E.; Karlsson, M.K.; Ljunggren, O.; Ohlsson, C. Low serum testosterone and high serum estradiol associate with lower extremity peripheral arterial disease in elderly men: The MrOS study in Sweden. J. Am. Coll. Cardiol. 2007, 50, 1070–1076. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Oduwole, O.O.; Peltoketo, H.; Huhtaniemi, I.T. Role of follicle-stimulating hormone in spermatogenesis. Front. Endocrinol. 2018, 9, 763. [Google Scholar] [CrossRef]
- Oduwole, O.O.; Peltoketo, H.; Poliandri, A.; Vengadabady, L.; Chrusciel, M.; Doroszko, M.; Samanta, L.; Owen, L.; Keevil, B.; Huhtaniemi, I.T. Constitutively active follicle-stimulating hormone receptor enables androgen-independent spermatogenesis. J. Clin. Investig. 2018, 128, 1787–1792. [Google Scholar] [CrossRef] [PubMed]
- Dierich, A.; Sairam, M.R.; Monaco, L.; Fimia, G.M.; Gansmuller, A.; LeMeur, M.; Sassone-Corsi, P. Impairing follicle-stimulating hormone (FSH) signaling in vivo: Targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc. Natl. Acad. Sci. USA 1998, 95, 13612–13617. [Google Scholar] [CrossRef]
- Wang, R.S.; Yeh, S.; Tzeng, C.R.; Chang, C. Androgen receptor roles in spermatogenesis and fertility: Lessons from testicular cell-specific androgen receptor knockout mice. Endocr. Rev. 2009, 30, 119–132. [Google Scholar] [CrossRef]
- De Gendt, K.; Swinnen, J.V.; Saunders, P.T.; Schoonjans, L.; Dewerchin, M.; Devos, A.; Tan, K.; Atanassova, N.; Claessens, F.; Lecureuil, C. A Sertoli cell-selective knockout of the androgen receptor causes spermatogenic arrest in meiosis. Proc. Natl. Acad. Sci. USA 2004, 101, 1327–1332. [Google Scholar] [CrossRef]
- Johnston, D.S.; Russell, L.D.; Friel, P.J.; Griswold, M.D. Murine germ cells do not require functional androgen receptors to complete spermatogenesis following spermatogonial stem cell transplantation. Endocrinology 2001, 142, 2405–2408. [Google Scholar] [CrossRef]
- Notini, A.J.; Davey, R.A.; McManus, J.F.; Bate, K.L.; Zajac, J.D. Genomic actions of the androgen receptor are required for normal male sexual differentiation in a mouse model. J. Mol. Endocrinol. 2005, 35, 547–555. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Zhang, H.; Cui, J.G.; Wang, J.X.; Chen, M.S.; Wang, H.R.; Li, X.N.; Li, J.L. Ferroptosis is critical for phthalates driving the blood-testis barrier dysfunction via targeting transferrin receptor. Redox Biol. 2023, 59, 102584. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.J.; Park, S.B.; Han, M. Di-(2-ethylhexyl)-phthalate induces oxidative stress in human endometrial stromal cells in vitro. Mol. Cell Endocrinol. 2015, 407, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Rul, F.; Béra-Maillet, C.; Champomier-Vergès, M.C.; El-Mecherfi, K.E.; Foligne, B.; Michalski, M.C.; Milenkovic, D.; Savary-Auzeloux, I. Underlying evidence for the health benefits of fermented foods in humans. Food Funct. 2022, 13, 4804–4824. [Google Scholar] [CrossRef] [PubMed]
Target Gene | GenBank Accession No. | Primer Sequences | Product Size (bp) |
---|---|---|---|
LHR | NM_013582.3 | F: GATGCACAGTGGCACCTTC R: TCAGCGTGGCAACCAGTAG | 185 |
StAR | NM_011485.5 | F: GGAAGTCCCTCCAAGACTAAAC R: AGTCCTAGTGTCTCCTGACTAC | 280 |
CYP11A1 | NM_019779.4 | F: GGGGCAACAAGCTGCCCTTCAA R: TGCAGGGTCATGGAGGTCGTGT | 88 |
3β-HSD2 | NM_153193.3 | F: AGCAAAAAGATGGCTGAGAA R: GCACAAGTTTGCAAAGTGCC | 80 |
17,20 desmolase | NM007809.3 | F: AGAGTTTGCCATCCCGAAG R: AACTGGGTGTGGGTGTAATG | 149 |
17β-HSD3 | NM_008291.3 | F: AATATGTCACGATCGGAGCTG R: GAAGGGATCCGGTTCAGAAT | 78 |
5α-reductase | NM_053188.3 | F: GCAAGCCTATTACCTGGTT R: AGAAGACACCGACGCTAA | 79 |
aromatase | NM_007810.4 | F: TGGACGAAAGTGCTATTGTGAA R: TCTTTCAAGTCCTTGACGGAT | 136 |
AR | NM_013476.4 | F: TTATGAAGCAGGGATGACTCTG R: GCTGCCAGCATTGGAGTT | 93 |
FSHR | NM_013523.3 | F: AGCAAGTTTGGCTGTTATGAGG R: GTTCTGGACTGAATGATTTAGAGG | 155 |
GAPDH | NM_001001303.1 | F: TCAACGGCACAGTCAAGG R: ACTCCACGACATACTCAGC | 125 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kwon, H.-Y.; Lee, H.; Choi, J.-S.; Lim, S.H.; Kim, T.; Bae, K.; Jang, Y.A.; Lee, J.-Y.; Choung, S.-Y.; Min, D.S. Improvement of Late-Onset Hypogonadism Symptoms of Fermented Morinda citrifolia Extract in TM3 Leydig and TM4 Sertoli Cells. Nutrients 2024, 16, 4159. https://doi.org/10.3390/nu16234159
Kwon H-Y, Lee H, Choi J-S, Lim SH, Kim T, Bae K, Jang YA, Lee J-Y, Choung S-Y, Min DS. Improvement of Late-Onset Hypogonadism Symptoms of Fermented Morinda citrifolia Extract in TM3 Leydig and TM4 Sertoli Cells. Nutrients. 2024; 16(23):4159. https://doi.org/10.3390/nu16234159
Chicago/Turabian StyleKwon, Hee-Yeon, Hyesung Lee, Ji-Soo Choi, Seong Hun Lim, Taehyun Kim, Kyeongseok Bae, Yoon A Jang, Jae-Yeon Lee, Se-Young Choung, and Do Sik Min. 2024. "Improvement of Late-Onset Hypogonadism Symptoms of Fermented Morinda citrifolia Extract in TM3 Leydig and TM4 Sertoli Cells" Nutrients 16, no. 23: 4159. https://doi.org/10.3390/nu16234159
APA StyleKwon, H.-Y., Lee, H., Choi, J.-S., Lim, S. H., Kim, T., Bae, K., Jang, Y. A., Lee, J.-Y., Choung, S.-Y., & Min, D. S. (2024). Improvement of Late-Onset Hypogonadism Symptoms of Fermented Morinda citrifolia Extract in TM3 Leydig and TM4 Sertoli Cells. Nutrients, 16(23), 4159. https://doi.org/10.3390/nu16234159