Effects of Pea (Pisum sativum) Prebiotics on Intestinal Iron-Related Proteins and Microbial Populations In Vivo (Gallus gallus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plants Materials—University of Saskatchewan Pea Varieties
Growing Conditions and Post-Harvest Handling
2.2. Extract Preparation
2.3. Polyphenols and Carbohydrate Analysis
2.3.1. Pea Cotyledon and Seed Coat Preparation
2.3.2. Polyphenol Analysis
2.4. Study Design and Assessment
2.5. Isolation of Total RNA from Chicken Duodenum
2.6. Real-Time Polymerase Chain Reaction (RT-PCR)
2.7. RT-PCR Design
2.8. Microbial Sample and Intestinal Content DNA Isolation
2.9. Primer Design and PCR Amplification of Bacterial 16S rRNA
2.10. Statistical Analysis
3. Results
3.1. Polyphenol Analysis
3.2. Body Weight and Cecum-to-Body-Weight Ratio
3.3. Gene Expression of BBM Proteins
3.4. Effects of Soluble Pea Extract on the Abundance of Intestinal Bacterial Populations
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jing, L.; Yuwei, L.; Qian, H. Impact of Heat Processing on the Bioavailability of Zinc and Iron from Cereals and Pulses. Int. Food Res. J. 2017, 24, 1980–1985. [Google Scholar]
- Piskin, E.; Cianciosi, D.; Gulec, S.; Tomas, M.; Capanoglu, E. Iron Absorption: Factors, Limitations, and Improvement Methods. ACS Omega 2022, 7, 20441–20456. [Google Scholar] [CrossRef] [PubMed]
- Gharibzahedi, S.M.T.; Jafari, S.M. The Importance of Minerals in Human Nutrition: Bioavailability, Food Fortification, Processing Effects and Nanoencapsulation Elsevier Enhanced Reader. Trends Food Sci. Technol. 2017, 62, 119–132. [Google Scholar] [CrossRef]
- Jha, A.B.; Warkentin, T.D. Biofortification of Pulse Crops: Status and Future Perspectives. Plants 2020, 9, 73. [Google Scholar] [CrossRef] [PubMed]
- Miller, D. Fennema’s Food Chemistry, 5th ed.; Minerals (Book Chapter); Taylor & Francis: Abingdon, UK, 2017; pp. 627–679. [Google Scholar] [CrossRef]
- Ghosal, J.; Bal, M.; Ranjit, M.; Das, A.; Behera, M.R.; Satpathy, S.K.; Dutta, A.; Pati, S. To What Extent Classic Socio-Economic Determinants Explain Trends of Anaemia in Tribal and Non-Tribal Women of Reproductive Age in India? Findings from Four National Family Heath Surveys (1998–2021). BMC Public Health 2023, 23, 856. [Google Scholar] [CrossRef] [PubMed]
- Ritchie, H.; Roser, M. Micronutrient Deficiency—Our World in Data. 2017. Available online: https://OurWorldInData.org (accessed on 20 June 2023).
- Scott, S.P.; Chen-Edinboro, L.P.; Caulfield, L.E.; Murray-Kolb, L.E. The Impact of Anemia on Child Mortality: An Updated Review. Nutrients 2014, 6, 5915–5932. [Google Scholar] [CrossRef]
- Murray-Kolb, L.E.; Beard, J.L. Iron Treatment Normalizes Cognitive Functioning in Young Women. Am. J. Clin. Nutr. 2007, 85, 778–787. [Google Scholar] [CrossRef] [PubMed]
- Beard, J.L.; Hendricks, M.K.; Perez, E.M.; Murray-Kolb, L.E.; Berg, A.; Vernon-Feagans, L.; Irlam, J.; Isaacs, W.; Sive, A.; Tomlinson, M. Nutritional Epidemiology Maternal Iron Deficiency Anemia Affects Postpartum Emotions and Cognition. J. Nutr. 2005, 135, 267–272. [Google Scholar] [CrossRef]
- Ems, T.; St, K.; Martin, L.; Affiliations, R.H. Biochemistry, Iron Absorption; StatPearls Publishing: Treasure Island, FL, USA, 2022. [Google Scholar]
- Cappellini, M.D.; Musallam, K.M.; Taher, A.T. Iron Deficiency Anaemia Revisited. J. Intern. Med. 2020, 287, 153–170. [Google Scholar] [CrossRef]
- Yadav, N.; Kaur, D.; Malaviya, R.; Saini, P.; Anjum, S. Enhancement in Mineral Bioavailability of Extruded Pulses with Reduced Antinutrients. Br. Food J. 2019, 121, 2967–2978. [Google Scholar] [CrossRef]
- Rousseau, S.; Kyomugasho, C.; Celus, M.; Hendrickx, M.E.G.; Grauwet, T. Barriers Impairing Mineral Bioaccessibility and Bioavailability in Plant-Based Foods and the Perspectives for Food Processing. Crit. Rev. Food Sci. Nutr. 2020, 60, 826–843. [Google Scholar] [CrossRef] [PubMed]
- Blanco-Rojo, R.; Vaquero, M.P. Iron Bioavailability from Food Fortification to Precision Nutrition. A Review. Innov. Food Sci. Emerg. Technol. 2019, 51, 126–138. [Google Scholar] [CrossRef]
- Rajagukguk, Y.V.; Arnold, M.; Gramza-Michałowska, A. Pulse Probiotic Superfood as Iron Status Improvement Agent in Active Women—A Review. Molecules 2021, 26, 2121. [Google Scholar] [CrossRef] [PubMed]
- Venkidasamy, B.; Selvaraj, D.; Nile, A.S.; Ramalingam, S.; Kai, G.; Nile, S.H. Indian Pulses: A Review on Nutritional, Functional and Biochemical Properties with Future Perspectives. Trends Food Sci. Technol. 2019, 88, 228–242. [Google Scholar] [CrossRef]
- Robinson, G.H.J.; Balk, J.; Domoney, C. Improving Pulse Crops as a Source of Protein, Starch and Micronutrients. Nutr. Bull. 2019, 44, 202–215. [Google Scholar] [CrossRef] [PubMed]
- Sulaiman, N.; Givens, D.I.; Anitha, S. A Narrative Review: In-Vitro Methods for Assessing Bio-Accessibility/Bioavailability of Iron in Plant-Based Foods. Front. Sustain. Food Syst. 2021, 5, 727533. [Google Scholar] [CrossRef]
- Ferruzzi, M.G.; Kruger, J.; Mohamedshah, Z.; Debelo, H.; Taylor, J.R.N. Insights from in Vitro Exploration of Factors Influencing Iron, Zinc and Provitamin A Carotenoid Bioaccessibility and Intestinal Absorption from Cereals. J. Cereal Sci. 2020, 96, 103126. [Google Scholar] [CrossRef]
- Bergamaschi, G.; Di Sabatino, A.; Pasini, A.; Ubezio, C.; Costanzo, F.; Grataroli, D.; Masotti, M.; Alvisi, C.; Corazza, G.R. Intestinal Expression of Genes Implicated in Iron Absorption and Their Regulation by Hepcidin. Clin. Nutr. 2017, 36, 1427–1433. [Google Scholar] [CrossRef]
- Baye, K.; Guyot, J.P.; Mouquet-Rivier, C. The Unresolved Role of Dietary Fibers on Mineral Absorption. Crit. Rev. Food Sci. Nutr. 2017, 57, 949–957. [Google Scholar] [CrossRef]
- Plamada, D.; Vodnar, D.C. Polyphenols—Gut Microbiota Interrelationship: A Transition to a New Generation of Prebiotics. Nutrients 2021, 14, 137. [Google Scholar] [CrossRef]
- Reider, S.J.; Moosmang, S.; Tragust, J.; Trgovec-Greif, L.; Tragust, S.; Perschy, L.; Przysiecki, N.; Sturm, S.; Tilg, H.; Stuppner, H.; et al. Prebiotic Effects of Partially Hydrolyzed Guar Gum on the Composition and Function of the Human Microbiota—Results from the PAGODA Trial. Nutrients 2020, 12, 1257. [Google Scholar] [CrossRef] [PubMed]
- Baxter, N.T.; Schmidt, A.W.; Venkataraman, A.; Kim, K.S.; Waldron, C.; Schmidt, T.M. Dynamics of Human Gut Microbiota and Short-Chain Fatty Acids in Response to Dietary Interventions with Three Fermentable Fibers. mBio 2019, 10, e02566-18. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, A.M.R.; Ahmed, W.; Iqbal, S.; Javed, M.; Rashid, S. Iahtisham-ul-Haq Prebiotics and Iron Bioavailability? Unveiling the Hidden Association—A Review. Trends Food Sci. Technol. 2021, 110, 584–590. [Google Scholar] [CrossRef]
- Obayashi, Y.K.; Hbuchi, T.O.; Ukuda, T.F.; Akasugi, E.W.; Asui, R.Y.; Amada, M.H.; Okoyama, M.Y.; Uwahata, M.K.; Ido, Y.K. Acidic Xylooligosaccharide Preserves Hepatic Iron Storage Level in Adult Female Rats Fed a Low-Iron Diet. J. Nutr. Sci. Vitaminol. 2011, 57, 292. [Google Scholar] [CrossRef]
- Jiao, X.; Wang, Y.; Lin, Y.; Lang, Y.; Li, E.; Zhang, X.; Zhang, Q.; Feng, Y.; Meng, X.; Li, B. Blueberry Polyphenols Extract as a Potential Prebiotic with Anti-Obesity Effects on C57BL/6 J Mice by Modulating the Gut Microbiota. J. Nutr. Biochem. 2019, 64, 88–100. [Google Scholar] [CrossRef] [PubMed]
- Alexander, C.; Swanson, K.S.; Fahey, G.C.; Garleb, K.A. Perspective: Physiologic Importance of Short-Chain Fatty Acids from Nondigestible Carbohydrate Fermentation. Adv. Nutr. 2019, 10, 576–589. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Li, L.; Dai, T.; Qi, X.; Wang, Y.; Zheng, T.; Gao, X.; Zhang, Y.; Ai, Y.; Ma, L.; et al. Short-Chain Fatty Acids Produced by Ruminococcaceae Mediate α-Linolenic Acid Promote Intestinal Stem Cells Proliferation. Mol. Nutr. Food Res. 2021, 66, 2100408. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Kotani, T.; Konno, T.; Setiawan, J.; Kitamura, Y.; Imada, S.; Usui, Y.; Hatano, N.; Shinohara, M.; Saito, Y.; et al. Promotion of Intestinal Epithelial Cell Turnover by Commensal Bacteria: Role of Short-Chain Fatty Acids. PLoS ONE 2016, 11, e0156334. [Google Scholar] [CrossRef]
- Guo, F.; Tsao, R.; Li, C.; Wang, X.; Zhang, H.; Jiang, L.; Sun, Y.; Xiong, H. Green Pea (Pisum sativum L.) Hull Polyphenol Extracts Ameliorate Dss-Induced Colitis through Keap1/Nrf2 Pathway and Gut Microbiota Modulation. Foods 2021, 10, 2765. [Google Scholar] [CrossRef]
- Dueñas, M.; Estrella, I.; Hernández, T. Occurrence of Phenolic Compounds in the Seed Coat and the Cotyledon of Peas (Pisum sativum L.). Eur. Food Res. Technol. 2004, 219, 116–123. [Google Scholar] [CrossRef]
- Warkentin, T.; Kolba, N.; Tako, E. Low Phytate Peas (Pisum sativum L.) Improve Iron Status, Gut Microbiome, and Brush Border Membrane Functionality In Vivo (Gallus Gallus). Nutrients 2020, 12, 2563. [Google Scholar] [CrossRef] [PubMed]
- Guillon, F.; Champ, M.M.-J. Carbohydrate Fractions of Legumes: Uses in Human Nutrition and Potential for Health. Br. J. Nutr. 2002, 88, 293–306. [Google Scholar] [CrossRef] [PubMed]
- Zhong, L.; Fang, Z.; Wahlqvist, M.L.; Wu, G.; Hodgson, J.M.; Johnson, S.K. Seed Coats of Pulses as a Food Ingredient: Characterization, Processing, and Applications. Trends Food Sci. Technol. 2018, 80, 35–42. [Google Scholar] [CrossRef]
- Moore, K.L.; Rodríguez-Ramiro, I.; Jones, E.R.; Jones, E.J.; Rodríguez-Celma, J.; Halsey, K.; Domoney, C.; Shewry, P.R.; Fairweather-Tait, S.; Balk, J. The Stage of Seed Development Influences Iron Bioavailability in Pea (Pisum sativum L.). Sci. Rep. 2018, 8, 6865. [Google Scholar] [CrossRef] [PubMed]
- Ambe, S. Móssbauer Study of Iron in Soybean Hulls and Cotyledons. J. Agric. Food Chem. 1994, 42, 262–267. [Google Scholar] [CrossRef]
- Dellavalle, D.M.; Vandenberg, A.; Glahn, R.P. Seed Coat Removal Improves Iron Bioavailability in Cooked Lentils: Studies Using an In Vitro Digestion/Caco-2 Cell Culture Model. J. Agric. Food Chem. 2013, 61, 8084–8089. [Google Scholar] [CrossRef] [PubMed]
- Dahl, W.J.; Foster, L.M.; Tyler, R.T. Review of the Health Benefits of Peas (Pisum sativum L.). Br. J. Nutr. 2012, 108, S3–S10. [Google Scholar] [CrossRef] [PubMed]
- Pacifici, S.; Song, J.; Zhang, C.; Wang, Q.; Glahn, R.P.; Kolba, N.; Tako, E. Intra Amniotic Administration of Raffinose and Stachyose Affects the Intestinal Brush Border Functionality and Alters Gut Microflora Populations. Nutrients 2017, 9, 304. [Google Scholar] [CrossRef] [PubMed]
- Agboola, S.O.; Mofolasayo, O.A.; Watts, B.M.; Aluko, R.E. Functional Properties of Yellow Field Pea (Pisum sativum L.) Seed Flours and the In Vitro Bioactive Properties of Their Polyphenols. Food Res. Int. 2010, 43, 582–588. [Google Scholar] [CrossRef]
- Guo, F.; Tsao, R.; Wang, X.; Jiang, L.; Sun, Y.; Xiong, H. Phenolics of Yellow Pea (Pisum sativum L.) Hulls, Their Plasma and Urinary Metabolites, Organ Distribution, and In Vivo Antioxidant Activities. J. Agric. Food Chem. 2021, 69, 5013–5025. [Google Scholar] [CrossRef]
- Warkentin, T.; Vandenberg, A.; Banniza, S.; Slinkard, A. CDC Striker Field Pea. Can. J. Plant Sci. 2004, 84, 239–240. [Google Scholar] [CrossRef]
- Warkentin, T.; Vandenberg, A.; Tar’an, B.; Banniza, S.; Barlow, B.; Ife, S. CDC Meadow Field Pea. Can. J. Plant Sci. 2007, 87, 909–910. [Google Scholar] [CrossRef]
- Waterhouse, A.L. Determination of Total Phenolics. Curr. Protoc. Food Anal. Chem. 2002, 6, I1.1.1–I1.1.8. [Google Scholar]
- Lee, J.; Durst, R.W.; Wrolstad, R.E.; Barnes, K.W.; Eisele, T.; Giusti, M.M.; Haché, J.; Hofsommer, H.; Koswig, S.; Krueger, D.A.; et al. Determination of Total Monomeric Anthocyanin Pigment Content of Fruit Juices, Beverages, Natural Colorants, and Wines by the PH Differential Method: Collaborative Study. J. AOAC Int. 2001, 88, 1269–1278. [Google Scholar] [CrossRef]
- Dias, D.M.; Kolba, N.; Binyamin, D.; Ziv, O.; Nutti, M.R.; Martino, H.S.D.; Glahn, R.P.; Koren, O.; Tako, E. Iron Biofortified Carioca Bean (Phaseolus vulgaris L.)—Based Brazilian Diet Delivers More Absorbable Iron and Affects the Gut Microbiota In Vivo (Gallus gallus). Nutrients 2018, 10, 1970. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, N.; Kolba, N.; Khen, N.; Even, C.; Turjeman, S.; Koren, O.; Tako, E. Quinoa Soluble Fiber and Quercetin Alter the Composition of the Gut Microbiome and Improve Brush Border Membrane Morphology In Vivo (Gallus gallus). Nutrients 2022, 14, 448. [Google Scholar] [CrossRef] [PubMed]
- Jackson, C.; Kolba, N.; Tako, E. Assessing the Interactions between Zinc and Vitamin A on Intestinal Functionality, Morphology, and the Microbiome In Vivo (Gallus gallus). Nutrients 2023, 15, 2754. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Rutzke, M.A.; Glahn, R.P. Using the Domestic Chicken (Gallus gallus) as an In Vivo Model for Iron Bioavailability. Poult. Sci. 2010, 89, 514–521. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Blair, M.W.; Glahn, R.P. Biofortified Red Mottled Beans (Phaseolus vulgaris L.) in a Maize and Bean Diet Provide More Bioavailable Iron than Standard Red Mottled Beans: Studies in Poultry (Gallus gallus) and an In Vitro Digestion/Caco-2 Model. Nutr. J. 2011, 10, 113. [Google Scholar] [CrossRef]
- Reed, S.; Neuman, H.; Glahn, R.P.; Koren, O.; Tako, E. Characterizing the Gut (Gallus gallus) Microbiota Following the Consumption of an Iron Biofortified Rwandan Cream Seeded Carioca (Phaseolus vulgaris L.) Bean-Based Diet. PLoS ONE 2017, 12, e0182431. [Google Scholar] [CrossRef]
- Zhuo, Z.; Fang, S.; Yue, M.; Zhang, Y.; Feng, J. Kinetics Absorption Characteristics of Ferrous Glycinate in SD Rats and Its Impact on the Relevant Transport Protein. Biol. Trace Elem. Res. 2014, 158, 197–202. [Google Scholar] [CrossRef]
- Zhuo, Z.; Fang, S.; Hu, Q.; Huang, D.; Feng, J. Digital Gene Expression Profiling Analysis of Duodenum Transcriptomes in SD Rats Administered Ferrous Sulfate or Ferrous Glycine Chelate by Gavage. Sci. Rep. 2016, 6, 37923. [Google Scholar] [CrossRef] [PubMed]
- Noy, Y.; Sklan, D. Yolk and Exogenous Feed Utilization in the Posthatch Chick. Poult. Sci. 2001, 80, 1490–1495. [Google Scholar] [CrossRef]
- Ruff, J.; Barros, T.L.; Tellez, G.; Blankenship, J.; Lester, H.; Graham, B.D.; Selby, C.A.M.; Vuong, C.N.; Dridi, S.; Greene, E.S.; et al. Research Note: Evaluation of a Heat Stress Model to Induce Gastrointestinal Leakage in Broiler Chickens. Poult. Sci. 2020, 99, 1687–1692. [Google Scholar] [CrossRef]
- Hall, L.E.; Robinson, S.; Buchanan-Smith, H.M. Refining Dosing by Oral Gavage in the Dog: A Protocol to Harmonise Welfare. J. Pharmacol. Toxicol. Methods 2015, 72, 35–46. [Google Scholar] [CrossRef] [PubMed]
- Turner, P.V.; Brabb, T.; Pekow, C.; Vasbinder, M.A. Administration of Substances to Laboratory Animals: Routes of Administration and Factors to Consider. J. Am. Assoc. Lab. Anim. Sci. 2011, 50, 600–613. [Google Scholar]
- Li, X.; Zhang, L.; Zhang, L.; Lu, L.; Luo, X. Effect of Iron Source on Iron Absorption by in Situ Ligated Intestinal Loops of Broilers. Anim. Prod. Sci. 2017, 57, 308–314. [Google Scholar] [CrossRef]
- Zhang, L.Y.; Liao, X.D.; Zhang, L.Y.; Lu, L.; Luo, X.G. Kinetics of Iron Absorption by In Situ Ligated Small Intestinal Loops of Broilers Involved in Iron Transporters. J. Anim. Sci. 2016, 94, 5219–5229. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.Y.; Li, X.F.; Liao, X.D.; Zhang, L.Y.; Lu, L.; Luo, X.G. Effect of Iron Source on Iron Absorption and Gene Expression of Iron Transporters in the Ligated Duodenal Loops of Broilers. J. Anim. Sci. 2017, 95, 1587–1597. [Google Scholar] [CrossRef]
- Berger, V.W.; Bour, L.J.; Carter, K.; Chipman, J.J.; Everett, C.C.; Heussen, N.; Hewitt, C.; Hilgers, R.D.; Luo, Y.A.; Renteria, J.; et al. A Roadmap to Using Randomization in Clinical Trials. BMC Med. Res. Methodol. 2021, 21, 168. [Google Scholar] [CrossRef]
- Odgaard-Jensen, J.; Vist, G.E.; Timmer, A.; Kunz, R.; Akl, E.A.; Schünemann, H.; Briel, M.; Nordmann, A.J.; Pregno, S.; Oxman, A.D. Randomisation to Protect against Selection Bias in Healthcare Trials. Cochrane Database Syst. Rev. 2011, 2015, MR000012. [Google Scholar] [CrossRef] [PubMed]
- Brittenham, G.M. Pathophysiology of Iron Homeostasis. In Hematology; Elsevier: Amsterdam, The Netherlands, 2018; pp. 468–477. [Google Scholar]
- Ha, E.C.; Bhagavan, N.V. Hemoglobin and Metabolism of Iron and Heme in Essentials of Medical Biochemistry, 3rd ed.; Elsevier: Amsterdam, The Netherlands, 2023. [Google Scholar]
- Swiatek, M.; Antosik, A.; Kochanowska, D.; Jezowski, P.; Smarzyński, K.; Tomczak, A.; Kowalczewski, P.Ł. The Potential for the Use of Leghemoglobin and Plant Ferritin as Sources of Iron. Open Life Sci. 2023, 18, 20220805. [Google Scholar] [CrossRef] [PubMed]
- Zielińska-Dawidziak, M. Plant Ferritin—A Source of Iron to Prevent Its Deficiency. Nutrients 2015, 7, 1184–1201. [Google Scholar] [CrossRef] [PubMed]
- Lobreaux, S.; Briat, J.-F. Ferritin Accumulation and Degradation in Different Organs of Pea (Pisum sativum) during Development. Biochem. J. 1991, 274, 601–606. [Google Scholar] [CrossRef] [PubMed]
- Monnier, L.; Colette, C.; Aguirre, L.; Mirouze, J. Evidence and Mechanism for Pectin-Reduced Intestinal Inorganic Iron Absorption in Idiopathic Hemochromatosis. Am. J. Clin. Nutr. 1980, 33, 1225–1232. [Google Scholar] [CrossRef]
- Elshahed, M.S.; Miron, A.; Aprotosoaie, A.C.; Farag, M.A. Pectin in Diet: Interactions with the Human Microbiome, Role in Gut Homeostasis, and Nutrient-Drug Interactions. Carbohydr. Polym. 2021, 255, 117388. [Google Scholar] [CrossRef]
- Bosscher, D.; Van Caillie-Bertrand, M.; Van Cauwenbergh, R.; Deelstra, H. Availabilities of Calcium, Iron, and Zinc from Dairy Infant Formulas Is Affected by Soluble Dietary Fibers and Modified Starch Fractions. Nutrition 2003, 19, 641–645. [Google Scholar] [CrossRef]
- Esra Ilhan, Z.; Marcus, A.K.; Kang, D.-W.; Rittmann, B.E.; Krajmalnik-Brown, R. PH-Mediated Microbial and Metabolic Interactions in Fecal Enrichment Cultures. Msphere 2017, 2, 10–1128. [Google Scholar]
- Metzler-Zebeli, B.U.; Canibe, N.; Montagne, L.; Freire, J.; Bosi, P.; Prates, J.A.M.; Tanghe, S.; Trevisi, P. Resistant Starch Reduces Large Intestinal PH and Promotes Fecal Lactobacilli and Bifidobacteria in Pigs. Animal 2019, 13, 64–73. [Google Scholar] [CrossRef]
- Anderson, G.J.; Frazer, D.M. Current Understanding of Iron Homeostasis. Am. J. Clin. Nutr. 2017, 106, 1559S–1566S. [Google Scholar]
- Guarino, M.P.L.; Altomare, A.; Emerenziani, S.; Di Rosa, C.; Ribolsi, M.; Balestrieri, P.; Iovino, P.; Rocchi, G.; Cicala, M. Mechanisms of Action of Prebiotics and Their Effects on Gastro-Intestinal Disorders in Adults. Nutrients 2020, 12, 1037. [Google Scholar] [CrossRef] [PubMed]
- Holscher, H.D. Dietary Fiber and Prebiotics and the Gastrointestinal Microbiota. Gut Microbes 2017, 8, 172–184. [Google Scholar] [CrossRef] [PubMed]
- Marín-Manzano, M.d.C.; Hernandez-Hernandez, O.; Diez-Municio, M.; Delgado-Andrade, C.; Moreno, F.J.; Clemente, A. Prebiotic Properties of Non-Fructosylated α-Galactooligosaccharides from PEA (Pisum sativum L.) Using Infant Fecal Slurries. Foods 2020, 9, 921. [Google Scholar] [CrossRef] [PubMed]
- Perdijk, O.; van Baarlen, P.; Fernandez-Gutierrez, M.M.; Brink, E.v.D.; Schuren, F.H.J.; Brugman, S.; Savelkoul, H.F.J.; Kleerebezem, M.; van Neerven, R.J.J. Van Sialyllactose and Galactooligosaccharides Promote Epithelial Barrier Functioning and Distinctly Modulate Microbiota Composition and Short Chain Fatty Acid Production In Vitro. Front. Immunol. 2019, 10, 94. [Google Scholar] [CrossRef]
- Hart, J.J.; Tako, E.; Kochian, L.V.; Glahn, R.P. Identification of Black Bean (Phaseolus vulgaris L.) Polyphenols That Inhibit and Promote Iron Uptake by Caco-2 Cells. J. Agric. Food Chem. 2015, 63, 5950–5956. [Google Scholar] [CrossRef] [PubMed]
- Perron, N.R.; Brumaghim, J.L. A Review of the Antioxidant Mechanisms of Polyphenol Compounds Related to Iron Binding. Cell Biochem. Biophys. 2009, 53, 75–100. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Glahn, R.P.; Arganosa, G.C.; Warkentin, T.D. Iron Bioavailability in Low Phytate Pea. Crop. Sci. 2015, 55, 320–330. [Google Scholar] [CrossRef]
- Jha, A.B.; Purves, R.W.; Elessawy, F.M.; Zhang, H.; Vandenberg, A.; Warkentin, T.D. Polyphenolic Profile of Seed Components of White and Purple Flower Pea Lines. Crop. Sci. 2019, 59, 2711–2719. [Google Scholar] [CrossRef]
- Brasse-Lagnel, C.; Karim, Z.; Letteron, P.; Bekri, S.; Bado, A.; Beaumont, C. Intestinal DMT1 Cotransporter Is Down-Regulated by Hepcidin via Proteasome Internalization and Degradation. Gastroenterology 2011, 140, 1261–1271.e1. [Google Scholar] [CrossRef]
- Lane, D.J.R.; Bae, D.H.; Merlot, A.M.; Sahni, S.; Richardson, D.R. Duodenal Cytochrome b (DCYTB) in Iron Metabolism: An Update on Function and Regulation. Nutrients 2015, 7, 2274–2296. [Google Scholar] [CrossRef]
- Zhu, X.Y.; Zhong, T.; Pandya, Y.; Joerger, R.D. 16S RRNA-Based Analysis of Microbiota from the Cecum of Broiler Chickens. Appl. Environ. Microbiol. 2002, 68, 124–137. [Google Scholar] [CrossRef] [PubMed]
- Yegani, M.; Korver, D.R. Factors Affecting Intestinal Health in Poultry. Poult. Sci. 2008, 87, 2052–2063. [Google Scholar] [CrossRef] [PubMed]
- Qin, J.; Li, R.; Raes, J.; Arumugam, M.; Burgdorf, K.S.; Manichanh, C.; Nielsen, T.; Pons, N.; Levenez, F.; Yamada, T.; et al. A Human Gut Microbial Gene Catalogue Established by Metagenomic Sequencing. Nature 2010, 464, 59–65. [Google Scholar] [CrossRef] [PubMed]
- Goodfellow, M.; Kampfer, P.; Busse, H.-J.; Trujillo, M.; Suzuki, K.; Ludwig, W.; Whitman, W. Bergey’s Manual of Systematic Bacteriology; Springer: New York, NY, USA, 2012. [Google Scholar]
- Milani, C.; Turroni, F.; Duranti, S.; Lugli, G.A.; Mancabelli, L.; Ferrario, C.; Van Sinderen, D.; Ventura, M. Genomics of the Genus Bifidobacterium Reveals Species-Specific Adaptation to the Glycan-Rich Gut Environment. Appl. Environ. Microbiol. 2016, 82, 980–991. [Google Scholar] [CrossRef] [PubMed]
- Healey, G.; Murphy, R.; Butts, C.; Brough, L.; Whelan, K.; Coad, J. Habitual Dietary Fibre Intake Influences Gut Microbiota Response to an Inulin-Type Fructan Prebiotic: A Randomised, Double-Blind, Placebo-Controlled, Cross-over, Human Intervention Study. Br. J. Nutr. 2018, 119, 176–189. [Google Scholar] [CrossRef] [PubMed]
- Kiewiet, M.B.G.; Elderman, M.E.; El Aidy, S.; Burgerhof, J.G.M.; Visser, H.; Vaughan, E.E.; Faas, M.M.; de Vos, P. Flexibility of Gut Microbiota in Ageing Individuals during Dietary Fiber Long-Chain Inulin Intake. Mol. Nutr. Food Res. 2021, 65, e2000390. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Wang, W.; Huang, J.; Ding, Y.; Pan, Z.; Zhao, Y.; Zhang, R.; Hu, B.; Zeng, X. In Vitro Extraction and Fermentation of Polyphenols from Grape Seeds (Vitis vinifera) by Human Intestinal Microbiota. Food Funct. 2016, 7, 1959–1967. [Google Scholar] [CrossRef] [PubMed]
- Borges, A.; Ferreira, C.; Saavedra, M.J.; Simões, M. Antibacterial Activity and Mode of Action of Ferulic and Gallic Acids against Pathogenic Bacteria. Microb. Drug Resist. 2013, 19, 256–265. [Google Scholar] [CrossRef]
- Chen, H.; Xu, Y.; Chen, H.; Liu, H.; Yu, Q.; Han, L. Isolation and Identification of Polyphenols from Fresh Sweet Sorghum Stems and Their Antibacterial Mechanism against Foodborne Pathogens. Front. Bioeng. Biotechnol. 2022, 9, 770726. [Google Scholar] [CrossRef]
- Stuivenberg, G.A.; Burton, J.P.; Bron, P.A.; Reid, G. Why Are Bifidobacteria Important for Infants? Microorganisms 2022, 10, 278. [Google Scholar] [CrossRef]
- Gesquiere, I.; Matthys, C.; van der Schueren, B. Iron and Bariatric Surgery. In Metabolism and Pathophysiology of Bariatric Surgery; Nutrition, Procedures, Outcomes and Adverse Effects; Academic Press: Cambridge, MA, USA, 2017; pp. 499–508. [Google Scholar]
- Flogan, C.; Dahl, W. Effects of Fiber-Fortified Foods on Children with Constipation: Potential Improved Stool Frequency and Decreased Energy Intake. ICAN Infant Child Adolesc. Nutr. 2010, 2, 312–317. [Google Scholar] [CrossRef]
- Schmidt, D.E. United States (12) Patent Application Publication (10). U.S. Patent 2015/0023899, 22 January 2015. [Google Scholar]
- Bresciani, A.; Vanara, F.; Pagliarini, E.; Locatelli, M.; Proserpio, C.; Travaglia, F.; Blandino, M.; Marti, A. Enrichment of Rice Snacks with Pulse Seed Coat: Phenolic Compounds, Product Features and Consumer Hedonic Response. Food Chem. 2023, 398, 133936. [Google Scholar] [CrossRef] [PubMed]



| Analyte | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Base Pair | GI Identifier |
|---|---|---|---|---|
| DCYTB | CATGTCATTCTCTTCCAAAGTC | CTCCTTGGTGACCGCATTAT | 103 | 20380692 |
| DMT-1 | TTGATCAGAGCCTCCCATTAG | GCGAGGAGTAGGCTTGTATTT | 101 | 206597489 |
| 18S rRNA | GCAAGACGAACTAAAGCGAAAG | TCGGAACTACGACGGTATCT | 100 | 7262899 |
| Pea Type | TPC (mg GAE/g) | MA (CE/g) |
|---|---|---|
| CDC Striker Cotyledon (2020 SPG) | 0.106 ± 0.001 | ND |
| CDC Dakota Cotyledon (2020 SPG) | 0.143 ± 0.001 | ND |
| CDC Meadow Cotyledon (2020 SPG) | 0.131 ± 0.003 | ND |
| CDC Striker Seed Coat (2020 SPG) | 0.050 ± 0.002 | <1/ND |
| CDC Dakota Seed Coat (2020 SPG) | 0.826 ± 0.005 | ND |
| CDC Meadow Seed Coat (2020 SPG) | 0.069 ± 0.001 | ND |
| Pea Type | Body Weight (g) | Cecum-to-Bodyweight Ratio (%) |
|---|---|---|
| Control (ddH2O) | 43.6 ± 1.4 a | 0.014 ± 0.003 a |
| CDC Striker Cotyledon (2020 SPG) | 38.8 ± 0.7 b | 0.014 ± 0.002 a |
| CDC Dakota Cotyledon (2020 SPG) | 39.8 ± 0.9 ab | 0.011 ± 0.001 a |
| CDC Meadow Cotyledon (2020 SPG) | 38.5 ± 2.3 b | 0.014 ± 0.001 a |
| CDC Striker Seed Coat (2020 SPG) | 41.6 ± 1.5 ab | 0.010 ± 0.001 a |
| CDC Dakota Seed Coat (2020 SPG) | 39.4 ± 0.9 b | 0.013 ± 0.001 a |
| CDC Meadow Seed Coat (2020 SPG) | 40.7 ± 0.9 ab | 0.014 ± 0.001 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Armah, A.; Jackson, C.; Kolba, N.; Gracey, P.R.; Shukla, V.; Padilla-Zakour, O.I.; Warkentin, T.; Tako, E. Effects of Pea (Pisum sativum) Prebiotics on Intestinal Iron-Related Proteins and Microbial Populations In Vivo (Gallus gallus). Nutrients 2024, 16, 1856. https://doi.org/10.3390/nu16121856
Armah A, Jackson C, Kolba N, Gracey PR, Shukla V, Padilla-Zakour OI, Warkentin T, Tako E. Effects of Pea (Pisum sativum) Prebiotics on Intestinal Iron-Related Proteins and Microbial Populations In Vivo (Gallus gallus). Nutrients. 2024; 16(12):1856. https://doi.org/10.3390/nu16121856
Chicago/Turabian StyleArmah, Abigail, Cydney Jackson, Nikolai Kolba, Peter R. Gracey, Viral Shukla, Olga I. Padilla-Zakour, Tom Warkentin, and Elad Tako. 2024. "Effects of Pea (Pisum sativum) Prebiotics on Intestinal Iron-Related Proteins and Microbial Populations In Vivo (Gallus gallus)" Nutrients 16, no. 12: 1856. https://doi.org/10.3390/nu16121856
APA StyleArmah, A., Jackson, C., Kolba, N., Gracey, P. R., Shukla, V., Padilla-Zakour, O. I., Warkentin, T., & Tako, E. (2024). Effects of Pea (Pisum sativum) Prebiotics on Intestinal Iron-Related Proteins and Microbial Populations In Vivo (Gallus gallus). Nutrients, 16(12), 1856. https://doi.org/10.3390/nu16121856

