Bacillus amyloliquifaciens-Supplemented Camel Milk Suppresses Neuroinflammation of Autoimmune Encephalomyelitis in a Mouse Model by Regulating Inflammatory Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strain and Preparation of Yogurt
2.2. Animal Care and Experimental Design for EAE Induction and Clinical Evaluation
2.3. Antibiotic Treatment
2.4. Classification of Paralysis Symptoms
2.5. Isolation of Cells
2.6. ELISA Quantification of Secreted Cytokines
2.7. In Vitro Stimulation of MOG35-55 Reactive Mononuclear Cells
2.8. Histological Analysis
2.9. Markers of Inflammation in the Spinal Cord and Colon Tissues
2.10. Myeloperoxidase (MPO) Activity
2.11. Quantification of SCFAs
2.12. Quantitative PCR Evaluation and RNA Isolation
2.13. Western Blot
2.14. Statistical Analysis
3. Results
3.1. Effect of Immunomodulation and Biocompatibility of BA on HT-29 Colon Cell Lines
3.2. Pathology of EAE C57Bl6j Mice Affected by BASY
3.3. Effect of BASY on Inflammatory Markers in MOG-Induced EAE Mice
3.4. BASY Activated Treg Cells and Alleviated EAE Symptoms
3.5. BASY Augmented the Level of Neurotransmitters and Neuronal Hormones in MOG-Immunized Mice Spinal Tissues
3.6. Gut–Brain Axis Was Regulated by BASY Administration in the MOG-Immunized EAE Mice
3.7. The Cell Adhesion Molecules Regulated by BASY Treatment in Immunized EAE Mice
3.8. BASY Enhanced the Myelin Protein and Neurotropic Factors in Spinal Cord EAE Mice by Regulating Cell Adhesion Molecules
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Morshedi, M.; Hashemi, R.; Moazzen, S.; Sahebkar, A.; Hosseinifard, E.-S. Immunomodulatory and anti-inflammatory effects of probiotics in multiple sclerosis: A systematic review. J. Neuroinflamm. 2019, 16, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Wildner, P.; Stasiołek, M.; Matysiak, M. Differential diagnosis of multiple sclerosis and other inflammatory CNS diseases. Mult. Scler. Relat. Disord. 2019, 37, 101452. [Google Scholar] [CrossRef] [PubMed]
- Reich, D.S.; Lucchinetti, C.F.; Calabresi, P.A. Multiple Sclerosis. N. Engl. J. Med. 2018, 378, 169–180. [Google Scholar] [CrossRef] [PubMed]
- Zeydan, B.; Kantarci, O.H. Progressive Forms of Multiple Sclerosis: Distinct Entity or Age-Dependent Phenomena. Neurol. Clin. 2018, 36, 163–171. [Google Scholar] [CrossRef] [PubMed]
- Lemus, H.N.; Warrington, A.E.; Rodriguez, M. Multiple Sclerosis: Mechanisms of Disease and Strategies for Myelin and Axonal Repair. Neurol. Clin 2018, 36, 1–11. [Google Scholar] [CrossRef]
- Khalil, M.; Teunissen, C.E.; Otto, M.; Piehl, F.; Sormani, M.P.; Gattringer, T.; Barro, C.; Kappos, L.; Comabella, M.; Fazekas, F.; et al. Neurofilaments as biomarkers in neurological disorders. Nat. Rev. Neurol. 2018, 14, 577–589. [Google Scholar] [CrossRef]
- Fisher, E.; Chang, A.; Fox, R.J.; Tkach, J.A.; Bs, T.S.; Bs, K.N.; Rudick, R.A.; Trapp, B.D. Imaging correlates of axonal swelling in chronic multiple sclerosis brains. Ann. Neurol. 2007, 62, 219–228. [Google Scholar] [CrossRef]
- Bielekova, B.; Martin, R. Development of biomarkers in multiple sclerosis. Brain 2004, 127, 1463–1478. [Google Scholar] [CrossRef]
- Hashemi, R.; Morshedi, M.; Jafarabadi, M.A.; Altafi, D.; Hosseini-Asl, S.S.; Rafie-Arefhosseini, S. Anti-inflammatory effects of dietary vitamin D3 in patients with multiple sclerosis. Neurol. Genet. 2018, 4, e278. [Google Scholar] [CrossRef]
- Brinkmann, V. FTY720 (fingolimod) in Multiple Sclerosis: Therapeutic effects in the immune and the central nervous system. Br. J. Pharmacol. 2009, 158, 1173–1182. [Google Scholar] [CrossRef]
- Ochoa-Repáraz, J.; Kirby, T.O.; Kasper, L.H. The Gut Microbiome and Multiple Sclerosis. Cold Spring Harb. Perspect. Med. 2018, 8, a029017. [Google Scholar] [CrossRef]
- Crane, J.D.; Palanivel, R.; Mottillo, E.P.; Bujak, A.L.; Wang, H.; Ford, R.J.; Collins, A.; Blümer, R.M.; Fullerton, M.D.; Yabut, J.M.; et al. Inhibiting peripheral serotonin synthesis reduces obesity and metabolic dysfunction by promoting brown adipose tissue thermogenesis. Nat. Med. 2015, 21, 166–172. [Google Scholar] [CrossRef]
- Yano, J.M.; Yu, K.; Donaldson, G.P.; Shastri, G.G.; Ann, P.; Ma, L.; Nagler, C.R.; Ismagilov, R.F.; Mazmanian, S.K.; Hsiao, E.Y. Indigenous Bacteria from the Gut Microbiota Regulate Host Serotonin Biosynthesis. Cell 2015, 161, 264–276, Erratum in 2015, 163, 258. [Google Scholar] [CrossRef]
- Ochoa-Repáraz, J.; Mielcarz, D.W.; Wang, Y.; Begum-Haque, S.; Dasgupta, S.; Kasper, D.L.; Kasper, L.H. A polysaccharide from the human commensal Bacteroides fragilis protects against CNS demyelinating disease. Mucosal Immunol. 2010, 3, 487–495. [Google Scholar] [CrossRef]
- Wong, R.K.; Yang, C.; Song, G.-H.; Wong, J.; Ho, K.-Y. Melatonin Regulation as a Possible Mechanism for Probiotic (VSL#3) in Irritable Bowel Syndrome: A Randomized Double-Blinded Placebo Study. Dig. Dis. Sci. 2015, 60, 186–194. [Google Scholar] [CrossRef]
- Fan, Y.; Zhang, J. Dietary Modulation of Intestinal Microbiota: Future Opportunities in Experimental Autoimmune Encepha-lomyelitis and Multiple Sclerosis. Front. Microbiol. 2019, 10, 740. [Google Scholar] [CrossRef]
- Erny, D.; Hrabě de Angelis, A.L.; Jaitin, D.; Wieghofer, P.; Staszewski, O.; David, E.; Keren-Shaul, H.; Mahlakoiv, T.; Jakobshagen, K.; Buch, T.; et al. Host microbiota constantly control maturation and function of microglia in the CNS. Nat. Neurosci. 2015, 18, 965–977. [Google Scholar] [CrossRef]
- Freedman, S.N.; Shahi, S.K.; Mangalam, A.K. The “Gut Feeling”: Breaking Down the Role of Gut Microbiome in Multiple Sclerosis. Neurotherapeutics 2018, 15, 109–125. [Google Scholar] [CrossRef]
- Kennedy, E.A.; King, K.Y.; Baldridge, M.T. Mouse Microbiota Models: Comparing Germ-Free Mice and Antibiotics Treatment as Tools for Modifying Gut Bacteria. Front. Physiol. 2018, 9, 1534. [Google Scholar] [CrossRef]
- Naghavian, R.; Ghaedi, K.; Kiani-Esfahani, A.; Hakemi, M.G.; Etemadifar, M.; Nasr-Esfahani, M.-H. miR-141 and miR-200a, Revelation of New Possible Players in Modulation of Th17/Treg Differentiation and Pathogenesis of Multiple Sclerosis. PLoS ONE 2015, 10, e0124555. [Google Scholar] [CrossRef]
- Mousa, W.K.; Chehadeh, F.; Husband, S. Microbial dysbiosis in the gut drives systemic autoimmune diseases. Front. Immunol. 2022, 13, 906258. [Google Scholar] [CrossRef] [PubMed]
- Varesi, A.; Campagnoli, L.I.M.; Fahmideh, F.; Pierella, E.; Romeo, M.; Ricevuti, G.; Nicoletta, M.; Chirumbolo, S.; Pascale, A. The Interplay between Gut Microbiota and Parkinson’s Disease: Implications on Diagnosis and Treatment. Int. J. Mol. Sci. 2022, 23, 12289. [Google Scholar] [CrossRef]
- Alfonsetti, M.; Castelli, V.; D’angelo, M. Are We What We Eat? Impact of Diet on the Gut–Brain Axis in Parkinson’s Disease. Nutrients 2022, 14, 380. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Chu, C.; Wu, C.; Wang, C.; Zhang, C.; Li, T.; Zhai, Q.; Yu, L.; Tian, F.; Chen, W. Efficacy of probiotics in multiple sclerosis: A systematic review of preclinical trials and meta-analysis of randomized controlled trials. Food Funct. 2021, 12, 2354–2377. [Google Scholar] [CrossRef] [PubMed]
- Hosseinifard, E.-S.; Morshedi, M.; Bavafa-Valenlia, K.; Saghafi-Asl, M. The novel insight into anti-inflammatory and anxiolytic effects of psychobiotics in diabetic rats: Possible link between gut microbiota and brain regions. Eur. J. Nutr. 2019, 58, 3361–3375. [Google Scholar] [CrossRef] [PubMed]
- Ganji-Arjenaki, M.; Rafieian-Kopaei, M. Probiotics are a good choice in remission of inflammatory bowel diseases: A meta analysis and systematic review. J. Cell. Physiol. 2017, 233, 2091–2103. [Google Scholar] [CrossRef]
- Salehipour, Z.; Haghmorad, D.; Sankian, M.; Rastin, M.; Nosratabadi, R.; Dallal, M.M.S.; Tabasi, N.; Khazaee, M.; Nasiraii, L.R.; Mahmoudi, M. Bifidobacterium animalis in combination with human origin of Lactobacillus plantarum ameliorate neuroinflammation in experimental model of multiple sclerosis by altering CD4+ T cell subset balance. Biomed. Pharmacother. 2017, 95, 1535–1548. [Google Scholar] [CrossRef]
- Ngo, D.-H.; Vo, T.S. An Updated Review on Pharmaceutical Properties of Gamma-Aminobutyric Acid. Molecules 2019, 24, 2678. [Google Scholar] [CrossRef]
- Zheng, P.; Zeng, B.; Liu, M.; Chen, J.; Pan, J.; Han, Y.; Liu, Y.; Cheng, K.; Zhou, C.; Wang, H.; et al. The gut microbiome from patients with schizophrenia modulates the glutamate-glutamine-GABA cycle and schizophrenia-relevant behaviors in mice. Sci. Adv. 2019, 5, eaau8317, Correction in 2019, 5, eaay2759. https://doi.org/10.1126/sciadv.aay2759. [Google Scholar] [CrossRef]
- Cortès-Saladelafont, E.; Molero-Luis, M.; Cuadras, D.; Casado, M.; Armstrong-Morón, J.; Yubero, D.; Montoya, J.; Artuch, R.; García-Cazorla, À. Institut De Recerca Sant Joan De Déu Working Group Gamma-aminobutyric acid levels in cerebrospinal fluid in neuropaediatric disorders. Dev. Med. Child Neurol. 2018, 60, 780–792. [Google Scholar] [CrossRef]
- Pan, S.; Wei, H.; Yuan, S.; Kong, Y.; Yang, H.; Zhang, Y.; Cui, X.; Chen, W.; Liu, J.; Zhang, Y. Probiotic Pediococcus pentosaceus ameliorates MPTP-induced oxidative stress via regulating the gut microbiota–gut–brain axis. Front. Cell. Infect. Microbiol. 2022, 12, 1634. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, A.; Sheikh, A.; Ibrahim, H.I.M. Bacillus amyloliquefaciens Enriched Camel Milk Attenuated Colitis Symptoms in Mice Model. Nutrients 2022, 14, 1967. [Google Scholar] [CrossRef]
- Arab, H.H.; Salama, S.A.; Eid, A.H.; Omar, H.A.; Arafa, E.-S.A.; Maghrabi, I.A. Camel’s milk ameliorates TNBS-induced colitis in rats via downregulation of inflammatory cytokines and oxidative stress. Food Chem. Toxicol. 2014, 69, 294–302. [Google Scholar] [CrossRef]
- Hailu, Y.; Hansen, E.B.; Seifu, E.; Eshetu, M.; Ipsen, R.; Kappeler, S. Functional and technological properties of camel milk proteins: A review. J. Dairy Res. 2016, 83, 422–429. [Google Scholar] [CrossRef]
- Lei, Q.; Wu, T.; Wu, J.; Hu, X.; Guan, Y.; Wang, Y.; Yan, J.; Shi, G. Roles of A synuclein in Gastrointestinal Microbiome Dysbiosis related Parkinson’s Disease Progression (Review). Mol. Med. Rep. 2021, 24, 734. [Google Scholar] [CrossRef]
- El-Sayed, M.; Awad, S. Milk Bioactive Peptides: Antioxidant, Antimicrobial and Anti-Diabetic Activities. Adv. Biochem. 2019, 7, 22. [Google Scholar] [CrossRef]
- Al-Dhabi, N.A.; Arasu, M.V.; Vijayaraghavan, P.; Esmail, G.A.; Duraipandiyan, V.; Kim, Y.O.; Kim, H.; Kim, H.-J. Probiotic and Antioxidant Potential of Lactobacillus reuteriLR12 and Lactobacillus lactisLL10 Isolated from Pineapple Puree and Quality Analysis of Pineapple-Flavored Goat Milk Yoghurt during Storage. Microorganisms 2020, 8, 1461. [Google Scholar] [CrossRef]
- Jäger, A.; Dardalhon, V.; Sobel, R.A.; Bettelli, E.; Kuchroo, V.K. Th1, Th17, and Th9 Effector Cells Induce Experimental Autoimmune Encephalomyelitis with Different Pathological Phenotypes. J. Immunol. 2009, 183, 7169–7177. [Google Scholar] [CrossRef]
- Peters, A.; Pitcher, L.A.; Sullivan, J.M.; Mitsdoerffer, M.; Acton, S.E.; Franz, B.; Wucherpfennig, K.; Turley, S.; Carroll, M.C.; Sobel, R.A.; et al. Th17 Cells Induce Ectopic Lymphoid Follicles in Central Nervous System Tissue Inflammation. Immunity 2011, 35, 986–996. [Google Scholar] [CrossRef]
- Zaiss, M.M.; Rapin, A.; Lebon, L.; Dubey, L.K.; Mosconi, I.; Sarter, K.; Piersigilli, A.; Menin, L.; Walker, A.W.; Rougemont, J.; et al. The Intestinal Microbiota Contributes to the Ability of Helminths to Modulate Allergic Inflammation. Immunity 2015, 43, 998–1010. [Google Scholar] [CrossRef]
- Pennartz, S.; Reiss, S.; Biloune, R.; Hasselmann, D.; Bosio, A. Generation of Single-Cell Suspensions from Mouse Neural Tissue. J. Vis. Exp. 2009, 7, e1267. [Google Scholar] [CrossRef] [PubMed]
- De Bondt, M.; Hellings, N.; Opdenakker, G.; Struyf, S. Neutrophils: Underestimated Players in the Pathogenesis of Multiple Sclerosis (MS). Int. J. Mol. Sci. 2020, 21, 4558. [Google Scholar] [CrossRef] [PubMed]
- Carriel, V.; Campos, A.; Alaminos, M.; Raimondo, S.; Geuna, S. Staining Methods for Normal and Regenerative Myelin in the Nervous System. In Histochemistry of Single Molecules; Humana Press: New York, NY, USA, 2017; Volume 1560, pp. 207–218. [Google Scholar] [CrossRef]
- Mirzaei, R.; Bouzari, B.; Hosseini-Fard, S.R.; Mazaheri, M.; Ahmadyousefi, Y.; Abdi, M.; Jalalifar, S.; Karimitabar, Z.; Teimoori, A.; Keyvani, H.; et al. Role of microbiota-derived short-chain fatty acids in nervous system disorders. Biomed. Pharmacother. 2021, 139, 111661. [Google Scholar] [CrossRef] [PubMed]
- Kaliyamoorthy, V.; Jacop, J.P.; Thirugnanasambantham, K.; Ibrahim, H.I.M.; Kandhasamy, S. The synergic impact of lignin and Lactobacillus plantarum on DSS-induced colitis model via regulating CD44 and miR 199a alliance. World J. Microbiol. Biotechnol. 2022, 38, 233. [Google Scholar] [CrossRef] [PubMed]
- Mu, C.; Yang, Y.; Zhu, W. Gut Microbiota: The Brain Peacekeeper. Front. Microbiol. 2016, 7, 345. [Google Scholar] [CrossRef]
- Foster, J.A.; Neufeld, K.-A.M. Gut–brain axis: How the microbiome influences anxiety and depression. Trends Neurosci. 2013, 36, 305–312. [Google Scholar] [CrossRef]
- Vuong, H.E.; Yano, J.M.; Fung, T.C.; Hsiao, E.Y. The Microbiome and Host Behavior. Annu. Rev. Neurosci. 2017, 40, 21–49. [Google Scholar] [CrossRef]
- Sarkar, A.; Lehto, S.M.; Harty, S.; Dinan, T.G.; Cryan, J.F.; Burnet, P.W.J. Psychobiotics and the Manipulation of Bacteria–Gut–Brain Signals. Trends Neurosci. 2016, 39, 763–781. [Google Scholar] [CrossRef]
- Enck, P.; Aziz, Q.; Barbara, G.; Farmer, A.D.; Fukudo, S.; Mayer, E.A.; Niesler, B.; Quigley, E.M.M.; Rajilic-Stojanovic, M.; Schemann, M.; et al. Irritable bowel syndrome. Nat. Rev. Dis. Prim. 2016, 2, 16014. [Google Scholar] [CrossRef]
- Calvo-Barreiro, L.; Eixarch, H.; Ponce-Alonso, M.; Castillo, M.; Lebrón-Galán, R.; Mestre, L.; Guaza, C.; Clemente, D.; del Campo, R.; Montalban, X.; et al. A Commercial Probiotic Induces Tolerogenic and Reduces Pathogenic Responses in Experimental Autoimmune Encephalomyelitis. Cells 2020, 9, 906. [Google Scholar] [CrossRef]
- Sengul, N.; Tore, F.; Isik, S.; Aslim, B.; Ucar, G.; Firat, T.; Ciftci, S.Y.; Kukner, A. Effects of Probiotic Bacteria on Central Neuronal Activation in Experimental Colitis. Turk. J. Gastroenterol. 2022, 33, 304–319. [Google Scholar] [CrossRef] [PubMed]
- Mangalam, A.; Shahi, S.K.; Luckey, D.; Karau, M.; Marietta, E.; Luo, N.; Choung, R.S.; Ju, J.; Sompallae, R.; Gibson-Corley, K.; et al. Human Gut-Derived Commensal Bacteria Suppress CNS Inflammatory and Demyelinating Disease. Cell Rep. 2017, 20, 1269–1277. [Google Scholar] [CrossRef] [PubMed]
- Mu, Q.; Tavella, V.J.; Luo, X.M. Role of Lactobacillus reuteri in Human Health and Diseases. Front. Microbiol. 2018, 9, 757. [Google Scholar] [CrossRef]
- Xin, J.; Zeng, D.; Wang, H.; Sun, N.; Zhao, Y.; Dan, Y.; Pan, K.; Jing, B.; Ni, X. Probiotic Lactobacillus johnsonii BS15 Promotes Growth Performance, Intestinal Immunity, and Gut Microbiota in Piglets. Probiotics Antimicrob. Proteins 2019, 12, 184–193. [Google Scholar] [CrossRef] [PubMed]
- Secher, T.; Kassem, S.; Benamar, M.; Bernard, I.; Boury, M.; Barreau, F.; Oswald, E.; Saoudi, A. Oral Administration of the Probiotic Strain Escherichia coli Nissle 1917 Reduces Susceptibility to Neuroinflammation and Repairs Experimental Autoimmune Encephalomyelitis-Induced Intestinal Barrier Dysfunction. Front. Immunol. 2017, 8, 1096. [Google Scholar] [CrossRef] [PubMed]
- Davoren, M.J.; Liu, J.; Castellanos, J.; Rodríguez-Malavé, N.I.; Schiestl, R.H. A novel probiotic, Lactobacillus johnsonii 456, resists acid and can persist in the human gut beyond the initial ingestion period. Gut Microbes 2018, 10, 458–480. [Google Scholar] [CrossRef]
- Jang, H.-M.; Lee, K.-E.; Lee, H.-J.; Kim, D.-H. Immobilization stress-induced Escherichia coli causes anxiety by inducing NF-κB activation through gut microbiota disturbance. Sci. Rep. 2018, 8, 13897. [Google Scholar] [CrossRef]
- Pascale, A.; Marchesi, N.; Marelli, C.; Coppola, A.; Luzi, L.; Govoni, S.; Giustina, A.; Gazzaruso, C. Microbiota and metabolic diseases. Endocrine 2018, 61, 357–371. [Google Scholar] [CrossRef]
- Silva, Y.P.; Bernardi, A.; Frozza, R.L. The Role of Short-Chain Fatty Acids From Gut Microbiota in Gut-Brain Communication. Front. Endocrinol. 2020, 11, 25. [Google Scholar] [CrossRef]
- Liu, Y.; Alookaran, J.J.; Rhoads, J.M. Probiotics in Autoimmune and Inflammatory Disorders. Nutrients 2018, 10, 1537. [Google Scholar] [CrossRef]
- He, J.; Guo, K.; Chen, Q.; Wang, Y. Jirimutu Camel milk modulates the gut microbiota and has anti-inflammatory effects in a mouse model of colitis. J. Dairy Sci. 2022, 105, 3782–3793. [Google Scholar] [CrossRef]
- Luu, M.; Monning, H.; Visekruna, A. Exploring the Molecular Mechanisms Underlying the Protective Effects of Microbial SCFAs on Intestinal Tolerance and Food Allergy. Front. Immunol. 2020, 11, 1–6. [Google Scholar] [CrossRef]
- Xu, Y.; Yu, Y.; Shen, Y.; Li, Q.; Lan, J.; Wu, Y.; Zhang, R.; Cao, G.; Yang, C. Effects of Bacillus subtilis and Bacillus licheniformis on growth performance, immunity, short chain fatty acid production, antioxidant capacity, and cecal microflora in broilers. Poult. Sci. 2021, 100, 101358. [Google Scholar] [CrossRef]
- Musa, B.B.; Duan, Y.; Khawar, H.; Sun, Q.; Ren, Z.; Mohamed, M.A.E.; Abbasi, I.H.R.; Yang, X. Bacillus subtilisB21 and Bacillus licheniformisB26 improve intestinal health and performance of broiler chickens with Clostridium perfringens-induced necrotic enteritis. J. Anim. Physiol. Anim. Nutr. 2019, 103, 1039–1049. [Google Scholar] [CrossRef]








| Primer Name | Forward Primer | Reverse Primer | PCR Product Size in bp |
|---|---|---|---|
| MBP F | : ATTCACCGAGGAGAGGCTGGAA 106 R: | TGTGTGCTTGGAGTCTGTCACC | 245 |
| VEGF | AGTCCCATGAAGTGATCAAGTTCA | ATCCGCATGATCTGCATGG | 188 |
| GABA-A A1 | AAAAGTCGGGGTCTCTCTGAC | CAGTCGGTCCAAAATTCTTGTGA | 138 |
| COX2 | CAA TTC CCG GAC GTC TAA ACC | CTA GGA CGA TGG GCA TGA AAC | 114 |
| BDNF | GCCTTTGGAGCCTCCTCTAC | GCGGCATCCAGGTAATTTT | 213 |
| GAPDH | TGGCCTACATGGCCT CCA | TCCCTAGGCCCCTCCTGTTAT | 177 |
| Nutritional Content | BA 10 × 6 Inoculum | BA 10 × 7.5 Inoculum | BA 10 × 9 Inoculum |
|---|---|---|---|
| Total fat | 3.1 * ± 0.2 | 3.6 ± 0.2 | 3.9 ± 0.13 |
| Cholesterol | 0.038 ± 0.001 | 0.05 ± 0.01 | 0.1 ± 0.01 |
| Total carbohydrates | 4.4 ± 0.31 | 3.4 ± 0.2 | 3.5 ± 0.007 |
| Total protein | 3.5 ± 0.01 | 3.8 ± 0.2 | 4.1 ± 0.1 |
| Sodium | 0.04 ± 0.0031 | 0.04 ± 0.001 | 0.04 ± 0.0024 |
| Calcium | 0.07 ± 0.28 | 0.09 ±0.001 | 0.05 ± 0.002 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ibrahim, H.I.M.; Sheikh, A.; Khalil, H.E.; Khalifa, A. Bacillus amyloliquifaciens-Supplemented Camel Milk Suppresses Neuroinflammation of Autoimmune Encephalomyelitis in a Mouse Model by Regulating Inflammatory Markers. Nutrients 2023, 15, 550. https://doi.org/10.3390/nu15030550
Ibrahim HIM, Sheikh A, Khalil HE, Khalifa A. Bacillus amyloliquifaciens-Supplemented Camel Milk Suppresses Neuroinflammation of Autoimmune Encephalomyelitis in a Mouse Model by Regulating Inflammatory Markers. Nutrients. 2023; 15(3):550. https://doi.org/10.3390/nu15030550
Chicago/Turabian StyleIbrahim, Hairul Islam Mohamed, Abdullah Sheikh, Hany Ezzat Khalil, and Ashraf Khalifa. 2023. "Bacillus amyloliquifaciens-Supplemented Camel Milk Suppresses Neuroinflammation of Autoimmune Encephalomyelitis in a Mouse Model by Regulating Inflammatory Markers" Nutrients 15, no. 3: 550. https://doi.org/10.3390/nu15030550
APA StyleIbrahim, H. I. M., Sheikh, A., Khalil, H. E., & Khalifa, A. (2023). Bacillus amyloliquifaciens-Supplemented Camel Milk Suppresses Neuroinflammation of Autoimmune Encephalomyelitis in a Mouse Model by Regulating Inflammatory Markers. Nutrients, 15(3), 550. https://doi.org/10.3390/nu15030550

