Crosstalk of Nrf2 with the Trace Elements Selenium, Iron, Zinc, and Copper
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Experiment
2.2. ICP-MS/MS Analysis of TE
2.3. RNA Isolation, Reverse Transcription, and Quantitative Real-Time PCR
2.4. ELISA
2.5. Western Blot
2.6. Enzyme Activities
2.7. Statistics
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Brigelius-Flohé, R.; Flohé, L. Basic principles and emerging concepts in the redox control of transcription factors. Antioxid. Redox. Signal. 2011, 15, 2335–2381. [Google Scholar] [CrossRef] [Scilit]
- Tebay, L.E.; Robertson, H.; Durant, S.T.; Vitale, S.R.; Penning, T.M.; Dinkova-Kostova, A.T.; Hayes, J.D. Mechanisms of activation of the transcription factor Nrf2 by redox stressors, nutrient cues, and energy status and the pathways through which it attenuates degenerative disease. Free. Radic. Biol. Med. 2015, 88, 108–146. [Google Scholar] [CrossRef] [Scilit]
- Hayes, J.D.; Dinkova-Kostova, A.T. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism. Trends. Biochem. Sci. 2014, 39, 199–218. [Google Scholar] [CrossRef] [Scilit]
- McMahon, M.; Swift, S.R.; Hayes, J.D. Zinc-binding triggers a conformational-switch in the cullin-3 substrate adaptor protein KEAP1 that controls transcription factor NRF2. Toxicol. Appl. Pharmacol. 2018, 360, 45–57. [Google Scholar] [CrossRef] [Scilit]
- Moon, M.S.; McDevitt, E.I.; Zhu, J.; Stanley, B.; Krzeminski, J.; Amin, S.; Aliaga, C.; Miller, T.G.; Isom, H.C. Elevated hepatic iron activates NF-E2-related factor 2-regulated pathway in a dietary iron overload mouse model. Toxicol. Sci. 2012, 129, 74–85. [Google Scholar] [CrossRef] [Scilit]
- Silva-Gomes, S.; Santos, A.G.; Caldas, C.; Silva, C.M.; Neves, J.V.; Lopes, J.; Carneiro, F.; Rodrigues, P.N.; Duarte, T.L. Transcription factor NRF2 protects mice against dietary iron-induced liver injury by preventing hepatocytic cell death. J. Hepatol. 2014, 60, 354–361. [Google Scholar] [CrossRef] [Scilit]
- Harada, N.; Kanayama, M.; Maruyama, A.; Yoshida, A.; Tazumi, K.; Hosoya, T.; Mimura, J.; Toki, T.; Maher, J.M.; Yamamoto, M.; et al. Nrf2 regulates ferroportin 1-mediated iron efflux and counteracts lipopolysaccharide-induced ferroportin 1 mRNA suppression in macrophages. Arch. Biochem. Biophys. 2011, 508, 101–109. [Google Scholar] [CrossRef] [Scilit]
- Kerins, M.J.; Ooi, A. The Roles of NRF2 in Modulating Cellular Iron Homeostasis. Antioxid. Redox Signal. 2018, 29, 1756–1773. [Google Scholar] [CrossRef] [Scilit]
- Davis, S.R.; Cousins, R.J. Metallothionein expression in animals: A physiological perspective on function. J. Nutr. 2000, 130, 1085–1088. [Google Scholar] [CrossRef] [Scilit]
- Polishchuk, E.V.; Concilli, M.; Iacobacci, S.; Chesi, G.; Pastore, N.; Piccolo, P.; Paladino, S.; Baldantoni, D.; van, I.S.C.; Chan, J.; et al. Wilson disease protein ATP7B utilizes lysosomal exocytosis to maintain copper homeostasis. Dev. Cell 2014, 29, 686–700. [Google Scholar] [CrossRef] [Scilit]
- Lutsenko, S. Human copper homeostasis: A network of interconnected pathways. Curr. Opin. Chem. Biol. 2010, 14, 211–217. [Google Scholar] [CrossRef] [Scilit]
- Mocchegiani, E.; Costarelli, L.; Giacconi, R.; Malavolta, M.; Basso, A.; Piacenza, F.; Ostan, R.; Cevenini, E.; Gonos, E.S.; Monti, D. Micronutrient-gene interactions related to inflammatory/immune response and antioxidant activity in ageing and inflammation. A systematic review. Mech. Ageing Dev. 2014, 136–137, 29–49. [Google Scholar] [CrossRef] [Scilit]
- Song, M.O.; Mattie, M.D.; Lee, C.H.; Freedman, J.H. The role of Nrf1 and Nrf2 in the regulation of copper-responsive transcription. Exp. Cell. Res. 2014, 322, 39–50. [Google Scholar] [CrossRef] [Scilit]
- Cui, Z.; Zhong, Z.; Yang, Y.; Wang, B.; Sun, Y.; Sun, Q.; Yang, G.Y.; Bian, L. Ferrous Iron Induces Nrf2 Expression in Mouse Brain Astrocytes to Prevent Neurotoxicity. J. Biochem. Mol. Toxicol. 2016, 30, 396–403. [Google Scholar] [CrossRef] [Scilit]
- Alam, J.; Cook, J.L. Transcriptional regulation of the heme oxygenase-1 gene via the stress response element pathway. Curr. Pharm. Des. 2003, 9, 2499–2511. [Google Scholar] [CrossRef] [Scilit]
- Pietsch, E.C.; Chan, J.Y.; Torti, F.M.; Torti, S.V. Nrf2 mediates the induction of ferritin H in response to xenobiotics and cancer chemopreventive dithiolethiones. J. Biol. Chem. 2003, 278, 2361–2369. [Google Scholar] [CrossRef] [Scilit]
- Müller, M.; Banning, A.; Brigelius-Flohé, R.; Kipp, A. Nrf2 target genes are induced under marginal selenium-deficiency. Genes. Nutr. 2010, 5, 297–307. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Wang, H.; Peng, D.; Taylor, E.W. Further insight into the impact of sodium selenite on selenoenzymes: High-dose selenite enhances hepatic thioredoxin reductase 1 activity as a consequence of liver injury. Toxicol. Lett. 2008, 176, 223–229. [Google Scholar] [CrossRef] [Scilit]
- Banning, A.; Deubel, S.; Kluth, D.; Zhou, Z.; Brigelius-Flohé, R. The GI-GPx gene is a target for Nrf2. Mol. Cell. Biol. 2005, 25, 4914–4923. [Google Scholar] [CrossRef] [Scilit]
- Sakurai, A.; Nishimoto, M.; Himeno, S.; Imura, N.; Tsujimoto, M.; Kunimoto, M.; Hara, S. Transcriptional regulation of thioredoxin reductase 1 expression by cadmium in vascular endothelial cells: Role of NF-E2-related factor-2. J. Cell. Physiol. 2005, 203, 529–537. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Cui, W.; Tan, Y.; Luo, P.; Chen, Q.; Zhang, C.; Qu, W.; Miao, L.; Cai, L. Zinc is essential for the transcription function of Nrf2 in human renal tubule cells in vitro and mouse kidney in vivo under the diabetic condition. J. Cell. Mol. Med. 2014, 18, 895–906. [Google Scholar] [CrossRef] [Scilit]
- Wakabayashi, N.; Slocum, S.L.; Skoko, J.J.; Shin, S.; Kensler, T.W. When NRF2 talks, who’s listening? Antioxid. Redox. Signal. 2010, 13, 1649–1663. [Google Scholar] [CrossRef] [Scilit]
- Gunther, V.; Lindert, U.; Schaffner, W. The taste of heavy metals: Gene regulation by MTF-1. Biochim. Biophys. Acta 2012, 1823, 1416–1425. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.I.; Jagadeesh, K.A.; Birgmeier, J.; Wenger, A.M.; Guturu, H.; Schelley, S.; Bernstein, J.A.; Bejerano, G. An MTF1 binding site disrupted by a homozygous variant in the promoter of ATP7B likely causes Wilson Disease. Eur. J. Hum. Genet. 2018, 26, 1810–1818. [Google Scholar] [CrossRef] [Scilit]
- Ohtsuji, M.; Katsuoka, F.; Kobayashi, A.; Aburatani, H.; Hayes, J.D.; Yamamoto, M. Nrf1 and Nrf2 play distinct roles in activation of antioxidant response element-dependent genes. J. Biol. Chem. 2008, 283, 33554–33562. [Google Scholar] [CrossRef] [Scilit]
- Lennicke, C.; Rahn, J.; Kipp, A.P.; Dojcinovic, B.P.; Müller, A.S.; Wessjohann, L.A.; Lichtenfels, R.; Seliger, B. Individual effects of different selenocompounds on the hepatic proteome and energy metabolism of mice. Biochim. Biophys. Acta. 2017, 1861, 3323–3334. [Google Scholar] [CrossRef] [Scilit]
- Rayman, M.P. Selenium and human health. Lancet 2012, 379, 1256–1268. [Google Scholar] [CrossRef] [Scilit]
- Cebula, M.; Schmidt, E.E.; Arnér, E.S. TrxR1 as a potent regulator of the Nrf2-Keap1 response system. Antioxid. Redox Signal. 2015, 23, 823–853. [Google Scholar] [CrossRef] [Scilit]
- Itoh, K.; Chiba, T.; Takahashi, S.; Ishii, T.; Igarashi, K.; Katoh, Y.; Oyake, T.; Hayashi, N.; Satoh, K.; Hatayama, I.; et al. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem. Biophys. Res. Commun. 1997, 236, 313–322. [Google Scholar] [CrossRef] [Scilit]
- Ritskes-Hoitinga, M. Nutrition of the laboratory mouse. In The Laboratory Mouse; Academic Press, Elsevier: London, UK, 2012; pp. 567–596. [Google Scholar]
- Marschall, T.A.; Kroepfl, N.; Jensen, K.B.; Bornhorst, J.; Meermann, B.; Kuehnelt, D.; Schwerdtle, T. Tracing cytotoxic effects of small organic Se species in human liver cells back to total cellular Se and Se metabolites. Metallomics 2017, 9, 268–277. [Google Scholar] [CrossRef] [Scilit]
- Kopp, J.F.; Müller, S.M.; Pohl, G.; Lossow, K.; Kipp, A.P.; Schwerdtle, T. A quick and simple method for the determination of six trace elements in mammalian serum samples using ICP-MS/MS. J. Trace Elem. Med. Biol. 2019, 54, 221–225. [Google Scholar] [CrossRef] [Scilit]
- Krehl, S.; Loewinger, M.; Florian, S.; Kipp, A.P.; Banning, A.; Wessjohann, L.A.; Brauer, M.N.; Iori, R.; Esworthy, R.S.; Chu, F.F.; et al. Glutathione peroxidase-2 and selenium decreased inflammation and tumors in a mouse model of inflammation-associated carcinogenesis whereas sulforaphane effects differed with selenium supply. Carcinogenesis 2012, 33, 620–628. [Google Scholar] [CrossRef] [Scilit]
- Florian, S.; Krehl, S.; Loewinger, M.; Kipp, A.; Banning, A.; Esworthy, S.; Chu, F.F.; Brigelius-Flohé, R. Loss of GPx2 increases apoptosis, mitosis and GPx1 expression in the intestine of mice. Free. Radic. Biol. Med. 2010, 49, 1694–1702. [Google Scholar] [CrossRef] [Scilit]
- Habig, W.H.; Pabst, M.J.; Jakoby, W.B. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 1974, 249, 7130–7139. [Google Scholar]
- Lim, P.J.; Duarte, T.L.; Arezes, J.; Garcia-Santos, D.; Hamdi, A.; Pasricha, S.R.; Armitage, A.E.; Mehta, H.; Wideman, S.; Santos, A.G.; et al. Nrf2 controls iron homeostasis in haemochromatosis and thalassaemia via Bmp6 and hepcidin. Nat. Metab. 2019, 1, 519–531. [Google Scholar] [CrossRef] [Scilit]
- Köhler, U.A.; Böhm, F.; Rolfs, F.; Egger, M.; Hornemann, T.; Pasparakis, M.; Weber, A.; Werner, S. NF-kappaB/RelA and Nrf2 cooperate to maintain hepatocyte integrity and to prevent development of hepatocellular adenoma. J. Hepatol. 2016, 64, 94–102. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.D.; Fan, S.D.; Chen, X.Y.; Yan, X.L.; Zhang, X.Z.; Ma, B.W.; Yu, D.Y.; Xiao, W.Y.; Zhuang, C.L.; Yu, Z. Nrf2 deficiency exacerbates frailty and sarcopenia by impairing skeletal muscle mitochondrial biogenesis and dynamics in an age-dependent manner. Exp. Gerontol. 2019, 119, 61–73. [Google Scholar] [CrossRef] [Scilit]
- Baudry, J.; Kopp, J.F.; Boeing, H.; Kipp, A.P.; Schwerdtle, T.; Schulze, M.B. Changes of trace element status during aging: Results of the EPIC-Potsdam cohort study. Eur. J. Nutr. 2019. submitted. [Google Scholar]
- Rooney, J.; Oshida, K.; Vasani, N.; Vallanat, B.; Ryan, N.; Chorley, B.N.; Wang, X.; Bell, D.A.; Wu, K.C.; Aleksunes, L.M.; et al. Activation of Nrf2 in the liver is associated with stress resistance mediated by suppression of the growth hormone-regulated STAT5b transcription factor. PLoS ONE 2018, 13, e0200004. [Google Scholar] [CrossRef] [Scilit]
- Duarte, T.L.; Caldas, C.; Santos, A.G.; Silva-Gomes, S.; Santos-Goncalves, A.; Martins, M.J.; Porto, G.; Lopes, J.M. Genetic disruption of NRF2 promotes the development of necroinflammation and liver fibrosis in a mouse model of HFE-hereditary hemochromatosis. Redox Biol. 2017, 11, 157–169. [Google Scholar] [CrossRef] [Scilit]
- Okada, K.; Warabi, E.; Sugimoto, H.; Horie, M.; Tokushige, K.; Ueda, T.; Harada, N.; Taguchi, K.; Hashimoto, E.; Itoh, K.; et al. Nrf2 inhibits hepatic iron accumulation and counteracts oxidative stress-induced liver injury in nutritional steatohepatitis. J. Gastroenterol. 2012, 47, 924–935. [Google Scholar] [CrossRef] [Scilit]
- Yanagawa, T.; Itoh, K.; Uwayama, J.; Shibata, Y.; Yamaguchi, A.; Sano, T.; Ishii, T.; Yoshida, H.; Yamamoto, M. Nrf2 deficiency causes tooth decolourization due to iron transport disorder in enamel organ. Genes Cells 2004, 9, 641–651. [Google Scholar] [CrossRef] [Scilit]
- Shindo, M.; Torimoto, Y.; Saito, H.; Motomura, W.; Ikuta, K.; Sato, K.; Fujimoto, Y.; Kohgo, Y. Functional role of DMT1 in transferrin-independent iron uptake by human hepatocyte and hepatocellular carcinoma cell, HLF. Hepatol. Res. 2006, 35, 152–162. [Google Scholar] [CrossRef] [Scilit]
- Liuzzi, J.P.; Aydemir, F.; Nam, H.; Knutson, M.D.; Cousins, R.J. Zip14 (Slc39a14) mediates non-transferrin-bound iron uptake into cells. Proc. Natl. Acad. Sci. USA 2006, 103, 13612–13617. [Google Scholar] [CrossRef] [Scilit]
- Aydemir, T.B.; Cousins, R.J. The Multiple Faces of the Metal Transporter ZIP14 (SLC39A14). J. Nutr. 2018, 148, 174–184. [Google Scholar] [CrossRef] [Scilit]
- Macara, I.G.; Hoy, T.G.; Harrison, P.M. The formation of ferritin from apoferritin. Kinetics and mechanism of iron uptake. Biochem. J. 1972, 126, 151–162. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Knovich, M.A.; Coffman, L.G.; Torti, F.M.; Torti, S.V. Serum ferritin: Past, present and future. Biochim. Biophys. Acta. 2010, 1800, 760–769. [Google Scholar] [CrossRef] [Scilit]
- Santambrogio, P.; Cozzi, A.; Levi, S.; Arosio, P. Human serum ferritin G-peptide is recognized by anti-L ferritin subunit antibodies and concanavalin-A. Br. J. Haematol. 1987, 65, 235–237. [Google Scholar] [CrossRef] [Scilit]
- Kuosmanen, S.M.; Viitala, S.; Laitinen, T.; Perakyla, M.; Polonen, P.; Kansanen, E.; Leinonen, H.; Raju, S.; Wienecke-Baldacchino, A.; Narvanen, A.; et al. The Effects of Sequence Variation on Genome-wide NRF2 Binding--New Target Genes and Regulatory SNPs. Nucleic Acids Res. 2016, 44, 1760–1775. [Google Scholar] [CrossRef] [Scilit]
- Kipp, A.P.; Frombach, J.; Deubel, S.; Brigelius-Flohé, R. Selenoprotein W as biomarker for the efficacy of selenium compounds to act as source for selenoprotein biosynthesis. Methods Enzymol. 2013, 527, 87–112. [Google Scholar]
- Hu, R.; Hebbar, V.; Kim, B.R.; Chen, C.; Winnik, B.; Buckley, B.; Soteropoulos, P.; Tolias, P.; Hart, R.P.; Kong, A.N. In vivo pharmacokinetics and regulation of gene expression profiles by isothiocyanate sulforaphane in the rat. J. Pharmacol. Exp. Ther. 2004, 310, 263–271. [Google Scholar] [CrossRef] [Scilit]
- Hardyman, J.E.; Tyson, J.; Jackson, K.A.; Aldridge, C.; Cockell, S.J.; Wakeling, L.A.; Valentine, R.A.; Ford, D. Zinc sensing by metal-responsive transcription factor 1 (MTF1) controls metallothionein and ZnT1 expression to buffer the sensitivity of the transcriptome response to zinc. Metallomics 2016, 8, 337–343. [Google Scholar] [CrossRef] [Scilit]
- Troadec, M.B.; Ward, D.M.; Lo, E.; Kaplan, J.; De Domenico, I. Induction of FPN1 transcription by MTF-1 reveals a role for ferroportin in transition metal efflux. Blood 2010, 116, 4657–4664. [Google Scholar] [CrossRef] [Scilit]
- Nose, Y.; Kim, B.E.; Thiele, D.J. Ctr1 drives intestinal copper absorption and is essential for growth, iron metabolism, and neonatal cardiac function. Cell Metab. 2006, 4, 235–244. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.; Son, H.Y.; Bailey, S.M.; Lee, J. Deletion of hepatic Ctr1 reveals its function in copper acquisition and compensatory mechanisms for copper homeostasis. Am. J. Physiol. Gastrointest. Liver Physiol. 2009, 296, G356–G364. [Google Scholar] [CrossRef] [Scilit]
- Burk, R.F.; Hill, K.E.; Nakayama, A.; Mostert, V.; Levander, X.A.; Motley, A.K.; Johnson, D.A.; Johnson, J.A.; Freeman, M.L.; Austin, L.M. Selenium deficiency activates mouse liver Nrf2-ARE but vitamin E deficiency does not. Free Radic. Biol. Med. 2008, 44, 1617–1623. [Google Scholar] [CrossRef] [Scilit]
- Carlson, B.A.; Tobe, R.; Yefremova, E.; Tsuji, P.A.; Hoffmann, V.J.; Schweizer, U.; Gladyshev, V.N.; Hatfield, D.L.; Conrad, M. Glutathione peroxidase 4 and vitamin E cooperatively prevent hepatocellular degeneration. Redox Biol. 2016, 9, 22–31. [Google Scholar] [CrossRef] [Scilit]
- Patterson, A.D.; Carlson, B.A.; Li, F.; Bonzo, J.A.; Yoo, M.H.; Krausz, K.W.; Conrad, M.; Chen, C.; Gonzalez, F.J.; Hatfield, D.L. Disruption of thioredoxin reductase 1 protects mice from acute acetaminophen-induced hepatotoxicity through enhanced NRF2 activity. Chem. Res. Toxicol. 2013, 26, 1088–1096. [Google Scholar] [CrossRef] [Scilit]
- Suvorova, E.S.; Lucas, O.; Weisend, C.M.; Rollins, M.F.; Merrill, G.F.; Capecchi, M.R.; Schmidt, E.E. Cytoprotective Nrf2 pathway is induced in chronically txnrd 1-deficient hepatocytes. PLoS ONE 2009, 4, e6158. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Mo, X.; Xiong, Y. The Study on Polymorphism of TrxR and Nrf2/HO-1 Signaling Pathway in Kaschin-Beck Disease. Biol. Trace Elem. Res. 2018, 190, 303–308. [Google Scholar] [CrossRef] [Scilit]
- Yim, S.H.; Clish, C.B.; Gladyshev, V.N. Selenium Deficiency Is Associated with Pro-longevity Mechanisms. Cell Rep. 2019, 27, 2785–2797 e3. [Google Scholar] [CrossRef] [Scilit]
- Dong, R.; Wang, D.; Wang, X.; Zhang, K.; Chen, P.; Yang, C.S.; Zhang, J. Epigallocatechin-3-gallate enhances key enzymatic activities of hepatic thioredoxin and glutathione systems in selenium-optimal mice but activates hepatic Nrf2 responses in selenium-deficient mice. Redox Biol. 2016, 10, 221–232. [Google Scholar] [CrossRef] [Scilit]
- Ma, S.; Lee, S.G.; Kim, E.B.; Park, T.J.; Seluanov, A.; Gorbunova, V.; Buffenstein, R.; Seravalli, J.; Gladyshev, V.N. Organization of the Mammalian Ionome According to Organ Origin, Lineage Specialization and Longevity. Cell. Rep. 2015, 13, 1319–1326. [Google Scholar] [CrossRef] [Scilit]





| TE | Nrf2 Pathway Activity | TE-Related Nrf2 Target Genes |
|---|---|---|
| Cu | CuCl2 activates Nrf2; Nrf2 is crucial for MRE/ARE-mediated transcription in response to Cu [13] | MT1/2, SOD1 |
| Fe | cytotoxic concentrations of Fe activate Nrf2 in murine primary astrocytes [14] and hepatocytes [6] | Fpn1, heme oxygenase (Hmox1) [15], Hamp, ferritin (FTH-1, FTL) [16], heme transporter (Slc48a1/HRG1), ferrochelatase (Fech), biliverdin reductases (BlvrA/B) |
| Se | a suboptimal Se status activates Nrf2 in mice [17]; high selenite concentrations enhance Nrf2 target gene expression [18] | GPX2 [19], TXNRD1 [20] |
| Zn | Zn upregulates Nrf2 function, e.g., via phosphorylation signals [21] | MT1/2, SOD1 |
| TE | Requirement (mg/kg) | Chow (Ssniff) (mg/kg) | Altromin C1045 (mg/kg) |
|---|---|---|---|
| Cu | 6 | 8.8 | 2.7 |
| Fe | 35 | 215 | 151 |
| Se | 0.15 | 0.3 | 0.03 |
| Zn | 10 | 97 | 57 |
| Gene | RefSeq-ID | Sequence |
|---|---|---|
| Atp7b, ATPase copper transporting beta | NM_007511.2 | CAGATGTCAAAGGCTCCCATTCAG CCAATGACGATCCACACCACC |
| Cp, ceruloplasmin | NM_001276248.1 | GTACTACTCTGGCGTTGACCC TTGTCTACATCTTTCTGTCTCCCA |
| DMT1, divalent metal transporter 1 | NM_001146161.1 | CTCAGCCATCGCCATCAATCTC TTCCGCAAGCCATATTTGTCCA |
| Epcam, epithelial cell adhesion molecule | NM_008532.2 | TCATCGCTGTCATTGTGGTGGT TCACCCATCTCCTTTATCTCAGCC |
| Fpn1, ferroportin | NM_016917.2 | CTGGTGGTTCAGAATGTGTCCGT AGCAGACAGTAAGGACCCATCCA |
| Fth1, ferritin heavy polypeptide 1 | NM_010239.2 | CGCCAGAACTACCACCAGGA TTCTTCAGAGCCACATCATCTCGG |
| Hamp, hepcidin | NM_032541.1 | AAGCAGGGCAGACATTGCGA TGCAACAGATACCACACTGGGA |
| MT2, metallothionein 2 | NM_008630.2 | CTGTGCCTCCGATGGATCCT CTTGTCGGAAGCCTCTTTGCAG |
| NQO1, NAD(P)H quinone dehydrogenase 1 | NM_008706.4 | ATGTACGACAACGGTCCTTTCCAG GATGCCACTCTGAATCGGCCA |
| Rpl13a, ribosomal protein L13a | NM_009438.5 | GTTCGGCTGAAGCCTACCAG TTCCGTAACCTCAAGATCTGCT |
| Selenow, selenoprotein W | NM_009156.2 | ATGCCTGGACATTTGTGGCGA GCAGCTTTGATGGCGGTCAC |
| Tfrc, transferrin receptor | NM_011638.4 | GGCTGAAACGGAGGAGACAGA CTGGCTCAGCTGCTTGATGGT |
| Zip14, solute carrier family 39 member 14 | NM_001135151.1 | GCCTCACCATCCTGGTATCCGT AGCAGACGAGGCATGAGTCTGG |
| TE | Nrf2 Genotype (KO vs. WT) | Sex in WT Mice (Female vs. Male) | Se Effect in WT Mice (–Se vs. +/++Se) |
|---|---|---|---|
| Cu | intracellular Cu → plasma Cu (↓) | plasma Cu ↑ | plasma Cu → |
| Fe | intracellular Fe ↑ plasma Fe biomarkers → | liver and plasma Fe ↑ | only hepatic ferritin H ↑ |
| Se | intracellular Se ↓ plasma Se → | liver Se ↑ | ↓ as expected |
| Zn | intestinal and plasma Zn ↓ liver Zn → | plasma Zn ↑ | plasma Zn ↓ |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schwarz, M.; Lossow, K.; Kopp, J.F.; Schwerdtle, T.; Kipp, A.P. Crosstalk of Nrf2 with the Trace Elements Selenium, Iron, Zinc, and Copper. Nutrients 2019, 11, 2112. https://doi.org/10.3390/nu11092112
Schwarz M, Lossow K, Kopp JF, Schwerdtle T, Kipp AP. Crosstalk of Nrf2 with the Trace Elements Selenium, Iron, Zinc, and Copper. Nutrients. 2019; 11(9):2112. https://doi.org/10.3390/nu11092112
Chicago/Turabian StyleSchwarz, Maria, Kristina Lossow, Johannes F. Kopp, Tanja Schwerdtle, and Anna P. Kipp. 2019. "Crosstalk of Nrf2 with the Trace Elements Selenium, Iron, Zinc, and Copper" Nutrients 11, no. 9: 2112. https://doi.org/10.3390/nu11092112
APA StyleSchwarz, M., Lossow, K., Kopp, J. F., Schwerdtle, T., & Kipp, A. P. (2019). Crosstalk of Nrf2 with the Trace Elements Selenium, Iron, Zinc, and Copper. Nutrients, 11(9), 2112. https://doi.org/10.3390/nu11092112

