Identification of the Promoter Antisense Transcript Enhancing the Transcription of the Equine Herpesvirus-1 Immediate-Early Gene
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Primers and Synthetic dsDNA
2.3. Reverse Transcription-Quantitative PCR (RT-qPCR)
2.4. RACE
2.5. DNA Cloning and Preparation of RNA Probes
2.6. Northern Hybridization
2.7. Expression Vector and Reporter Plasmid Construction
2.8. Luciferase Reporter Assay
2.9. Construction of IE pancRNA-Expressing Rn33B-A68B2M Cells
2.10. Flow Cytometry
2.11. Statistical Analyses
3. Results
3.1. Identification of a Novel ncRNA Expressed in the Upstream Region of IE Coding Sequences in EHV-1-Infected Rn33B-A68B2M Cells
3.2. Determination of the 5′- and 3’-Ends of ncRNA via RACE
3.3. IE pancRNA Is Expressed in EHV-1-Infected RN33B-A68B2M, RK13, and E. Derm Cells
3.4. IE pancRNA Promotes IE Gene Transcription
3.5. IE pancRNA Promotes EHV-1 Infection in Rn33B-A68B2M Cells
4. Discussions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Slater, J.D.; Borchers, K.; Thackray, A.M.; Field, H.J. The trigeminal ganglion is a location for equine herpesvirus 1 latency and reactivation in the horse. J. Gen. Virol. 1994, 75, 2007–2016. [Google Scholar] [CrossRef] [PubMed]
- Welch, H.M.; Bridges, C.G.; Lyon, A.M.; Griffiths, L.; Edington, N. Latent equid herpesviruses 1 and 4: Detection and distinction using the polymerase chain reaction and co-cultivation from lymphoid tissues. J. Gen. Virol. 1992, 73, 261–268. [Google Scholar] [CrossRef]
- Gray, W.L.; Baumann, R.P.; Robertson, A.T.; Caughman, G.B.; O’Callaghan, D.J.; Staczek, J. Regulation of equine herpesvirus type 1 gene expression: Characterization of immediate early, early, and late transcription. Virology 1987, 158, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Gray, W.L.; Baumann, R.P.; Robertson, A.T.; O’Callaghan, D.J.; Staczek, J. Characterization and mapping of equine herpesvirus type 1 immediate early, early, and late transcripts. Virus Res. 1987, 8, 233–244. [Google Scholar] [CrossRef] [PubMed]
- Grundy, F.J.; Baumann, R.P.; O’Callaghan, D.J. DNA sequence and comparative analyses of the equine herpesvirus type 1 immediate early gene. Virology 1989, 172, 223–236. [Google Scholar] [CrossRef] [PubMed]
- Garko-Buczynski, K.A.; Smith, R.H.; Kim, S.K.; O’Callaghan, D.J. Complementation of a replication-defective mutant of equine herpesvirus type 1 by a cell line expressing the immediate-early protein. Virology 1998, 248, 83–94. [Google Scholar] [CrossRef] [PubMed]
- Lewis, J.B.; Thompson, Y.G.; Feng, X.; Holden, V.R.; O’Callaghan, D.; Caughman, G.B. Structural and antigenic identification of the ORF12 protein (alpha TIF) of equine herpesvirus 1. Virology 1997, 230, 369–375. [Google Scholar] [CrossRef] [PubMed]
- Purewal, A.S.; Smallwood, A.V.; Kaushal, A.; Adegboye, D.; Edington, N. Identification and control of the cis-acting elements of the immediate early gene of equid herpesvirus type 1. J. Gen. Virol. 1992, 73, 513–519. [Google Scholar] [CrossRef] [PubMed]
- Elliott, G.; O’Hare, P. Equine herpesvirus 1 gene 12, the functional homologue of herpes simplex virus VP16, transactivates via octamer sequences in the equine herpesvirus IE gene promoter. Virology 1995, 213, 258–262. [Google Scholar] [CrossRef]
- Fan, D.; Wang, M.; Cheng, A.; Jia, R.; Yang, Q.; Wu, Y.; Zhu, D.; Zhao, X.; Chen, S.; Liu, M.; et al. The role of VP16 in the life cycle of alphaherpesviruses. Front. Microbiol. 2020, 11, 1910. [Google Scholar] [CrossRef]
- Fortes, P.; Morris, K.V. Long noncoding RNAs in viral infections. Virus Res. 2016, 212, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Gottwein, E.; Cullen, B.R. Viral and cellular microRNAs as determinants of viral pathogenesis and immunity. Cell Host Microbe 2008, 3, 375–387. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, W.; Liu, Z.F. Long non-coding RNAs: Novel players in regulation of immune response upon herpesvirus infection. Front. Immunol. 2018, 9, 761. [Google Scholar] [CrossRef]
- Perng, G.C.; Jones, C.; Ciacci-Zanella, J.; Stone, M.; Henderson, G.; Yukht, A.; Slanina, S.M.; Hofman, F.M.; Ghiasi, H.; Nesburn, A.B.; et al. Virus-induced neuronal apoptosis blocked by the herpes simplex virus latency-associated transcript. Science 2000, 287, 1500–1503. [Google Scholar] [CrossRef] [PubMed]
- Umbach, J.L.; Kramer, M.F.; Jurak, I.; Karnowski, H.W.; Coen, D.M.; Cullen, B.R. MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs. Nature 2008, 454, 780–783. [Google Scholar] [CrossRef] [PubMed]
- Rossetto, C.C.; Tarrant-Elorza, M.; Verma, S.; Purushothaman, P.; Pari, G.S. Regulation of viral and cellular gene expression by Kaposi’s sarcoma-associated herpesvirus polyadenylated nuclear RNA. J. Virol. 2013, 87, 5540–5553. [Google Scholar] [CrossRef]
- Nukui, M.; Mori, Y.; Murphy, E.A. A human herpesvirus 6A-encoded microRNA: Role in viral lytic replication. J. Virol. 2015, 89, 2615–2627. [Google Scholar] [CrossRef] [PubMed]
- Chellini, L.; Frezza, V.; Paronetto, M.P. Dissecting the transcriptional regulatory networks of promoter-associated noncoding RNAs in development and cancer. J. Exp. Clin. Cancer Res. 2020, 39, 51. [Google Scholar] [CrossRef]
- Uesaka, M.; Nishimura, O.; Go, Y.; Nakashima, K.; Agata, K.; Imamura, T. Bidirectional promoters are the major source of gene activation-associated non-coding RNAs in mammals. BMC Genom. 2014, 15, 35. [Google Scholar] [CrossRef]
- Hamazaki, N.; Uesaka, M.; Nakashima, K.; Agata, K.; Imamura, T. Gene activation-associated long noncoding RNAs function in mouse preimplantation development. Development 2015, 142, 910–920. [Google Scholar] [CrossRef]
- Tomikawa, J.; Shimokawa, H.; Uesaka, M.; Yamamoto, N.; Mori, Y.; Tsukamura, H.; Maeda, K.; Imamura, T. Single-stranded noncoding RNAs mediate local epigenetic alterations at gene promoters in rat cell lines. J. Biol. Chem. 2011, 286, 34788–34799. [Google Scholar] [CrossRef] [PubMed]
- Minato, E.; Kobayashi, A.; Aoshima, K.; Fukushi, H.; Kimura, T. Susceptibility of rat immortalized neuronal cell line Rn33B expressing equine major histocompatibility class 1 to equine herpesvirus-1 infection is differentiation dependent. Microbiol. Immunol. 2020, 64, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Nugent, J.; Birch-Machin, I.; Smith, K.C.; Mumford, J.A.; Swann, Z.; Newton, J.R.; Bowden, R.J.; Allen, G.P.; Davis-Poynter, N. Analysis of equid herpesvirus 1 strain variation reveals a point mutation of the DNA polymerase strongly associated with neuropathogenic versus nonneuropathogenic disease outbreaks. J. Virol. 2006, 80, 4047–4060. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, E.S.M.; Pagmajav, O.; Yamaguchi, T.; Matsumura, T.; Fukushi, H. Growth and virulence alterations of equine herpesvirus 1 by insertion of a green fluorescent protein gene in the intergenic region between ORFs 62 and 63. Microbiol. Immunol. 2004, 48, 831–842. [Google Scholar] [CrossRef] [PubMed]
- Shifman, M.I.; Stein, D.G. A reliable and sensitive method for non-radioactive northern blot analysis of nerve growth factor mRNA from brain tissues. J. Neurosci. Methods 1995, 59, 205–208. [Google Scholar] [CrossRef] [PubMed]
- Deng, W.; McLaughlin, S.L.; Klinke, D.J. Quantifying spontaneous metastasis in a syngeneic mouse melanoma model using real time PCR. Analyst 2017, 142, 2945–2953. [Google Scholar] [CrossRef] [PubMed]
- O’Hare, P.; Goding, C.R.; Haigh, A. Direct combinatorial interaction between a herpes simplex virus regulatory protein and a cellular octamer-binding factor mediates specific induction of virus immediate-early gene expression. EMBO J. 1988, 7, 4231–4238. [Google Scholar] [CrossRef] [PubMed]
- Elliott, G.D. The extreme carboxyl terminus of the equine herpesvirus 1 homolog of herpes simplex virus VP16 is essential for immediate-early gene activation. J. Virol. 1994, 68, 4890–4897. [Google Scholar] [CrossRef] [PubMed]
- Lewis, J.B.; Thompson, Y.G.; Caughman, G.B. Transcriptional control of the equine herpesvirus 1 immediate early gene. Virology 1993, 197, 788–792. [Google Scholar] [CrossRef]
- Purewal, A.S.; Allsopp, R.; Riggio, M.; Telford, E.A.; Azam, S.; Davison, A.J.; Edington, N. Equid herpesviruses 1 and 4 encode functional homologs of the herpes simplex virus type 1 virion transactivator protein, VP16. Virology 1994, 198, 385–389. [Google Scholar] [CrossRef]
- Hitachi, K.; Nakatani, M.; Takasaki, A.; Ouchi, Y.; Uezumi, A.; Ageta, H.; Inagaki, H.; Kurahashi, H.; Tsuchida, K. Myogenin promoter-associated lncRNA Myoparr is essential for myogenic differentiation. EMBO Rep. 2019, 20, e47468. [Google Scholar] [CrossRef] [PubMed]
- Jolles, B.; Aliouat, A.; Stierlé, V.; Salhi, S.; Jean-Jean, O. Translation termination-dependent deadenylation of MYC mRNA in human cells. Oncotarget 2018, 9, 26171–26182. [Google Scholar] [CrossRef] [PubMed]
- Djebali, S.; Davis, C.A.; Merkel, A.; Dobin, A.; Lassmann, T.; Mortazavi, A.; Tanzer, A.; Lagarde, J.; Lin, W.; Schlesinger, F.; et al. Landscape of transcription in human cells. Nature 2012, 489, 101–108. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence (5′–3′) | |
---|---|---|
EHV-1 IE promoter_F | TCAACGGCCAATCACAATCG | (20 bp) |
EHV-1 IE promoter_R | TACGATGGGTAAGCAACAGGTG | (22 bp) |
Rat_β-actin_F | AAGTCCCTCACCCTCCCAAAAG | (22 bp) |
Rat_β-actin_R | AAGCAATGCTGTCACCTTCCC | (21 bp) |
5′ RACE Antisense GSP | GATTACGCCAAGCTTCGACACACGGGTTCTAATTGGTTGGAG | (42 bp) |
3′ RACE Antisense GSP | GATTACGCCAAGCTTCTACGATGGAGTTTTGCCTTCCCCCTA | (42 bp) |
5′ RACE Sense GSP-1 | GATTACGCCAAGCTTTACGATGGAGTTTTGCCTTCCCCCTAGT | (43 bp) |
5′ RACE Sense GSP-2 | GATTACGCCAAGCTTCTCCAACCAATTAGAACCCGTGTGTCG | (42 bp) |
3′ RACE Sense GSP-1 | GATTACGCCAAGCTTACGACACACGGGTTCTAATTGGTTGGAG | (43 bp) |
3′ RACE Sense GSP-2 | GATTACGCCAAGCTTCGCTTCCCTGGGAGGAGACATACGCAAA | (43 bp) |
3′ RACE Sense GSP-3 | GATTACGCCAAGCTTCACTAGGGGGAAGGCAAAACTCCATCG | (42 bp) |
Firefly Luciferase_F | CACCGTCGTATTCGTGAGCA | (20 bp) |
Firefly Luciferase_R | AGTCGTACTCGTTGAAGCCG | (20 bp) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maeda, M.; Abe, M.; Aoshima, K.; Kobayashi, A.; Fukushi, H.; Kimura, T. Identification of the Promoter Antisense Transcript Enhancing the Transcription of the Equine Herpesvirus-1 Immediate-Early Gene. Viruses 2024, 16, 1195. https://doi.org/10.3390/v16081195
Maeda M, Abe M, Aoshima K, Kobayashi A, Fukushi H, Kimura T. Identification of the Promoter Antisense Transcript Enhancing the Transcription of the Equine Herpesvirus-1 Immediate-Early Gene. Viruses. 2024; 16(8):1195. https://doi.org/10.3390/v16081195
Chicago/Turabian StyleMaeda, Mayuko, Miou Abe, Keisuke Aoshima, Atsushi Kobayashi, Hideto Fukushi, and Takashi Kimura. 2024. "Identification of the Promoter Antisense Transcript Enhancing the Transcription of the Equine Herpesvirus-1 Immediate-Early Gene" Viruses 16, no. 8: 1195. https://doi.org/10.3390/v16081195
APA StyleMaeda, M., Abe, M., Aoshima, K., Kobayashi, A., Fukushi, H., & Kimura, T. (2024). Identification of the Promoter Antisense Transcript Enhancing the Transcription of the Equine Herpesvirus-1 Immediate-Early Gene. Viruses, 16(8), 1195. https://doi.org/10.3390/v16081195