The Rise and Fall of Omicron BA.1 Variant as Seen in Wastewater Supports Epidemiological Model Predictions
Abstract
1. Introduction
2. Materials and Methods
2.1. Wastewater Samples
2.2. RNA Extraction
2.3. RT-qPCR
3. Results
3.1. Wastewater Portrait of SARS-CoV-2
3.2. Remodeling
- , , and are the fractions of actively infected populations in Delta, Omicron BA.1, and Omicron BA.2, respectively.
- , , and are the effective fractions of susceptible populations to Delta, Omicron BA.1, and Omicron BA.2 infections, respectively, henceforth “susceptibilities”. These variables present an average over the diverse immunity presented in the population, although, in the original SIR model, they simply present the fraction of population that is neither actively infected nor recovered.
- , , and are the fractions of recovered population from Delta, Omicron BA.1, and Omicron BA.2, respectively. The contribution of recovered individuals from previous outbreaks is accounted for in the initial conditions.
- , , and are the infection time-periods of Delta, Omicron BA.1, and Omicron BA.2, respectively.
- , , and are the basic reproduction numbers of Delta, Omicron BA.1, and Omicron BA.2, respectively.
- , , and are the corresponding characteristic waning-immunity times, based on exponential decay of the immunity.
- Basic reproduction numbers
- Infection periods
- Characteristic waning-immunity times
- Cross immunity probabilities
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. WHO COVID-19 Weekly Epidemiological Update, 144th ed.; WHO: Geneva, Switzerland, 2023. [Google Scholar]
- Wang, H.; Paulson, K.R.; Pease, S.A.; Watson, S.; Comfort, H.; Zheng, P.; Aravkin, A.Y.; Bisignano, C.; Barber, R.M.; Alam, T.; et al. Estimating Excess Mortality Due to the COVID-19 Pandemic: A Systematic Analysis of COVID-19-Related Mortality, 2020–21. Lancet 2022, 399, 1513–1536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goswami, S.; Dey, C. COVID-19 and SARS-CoV-2: The Science and Clinical Application of Conventional and Complementary Treatments, 1st ed.; CRC Press: Boca Raton, FL, USA, 2022; ISBN 978-1-00-317851-4. [Google Scholar]
- Farheen, S.; Araf, Y.; Tang, Y.; Zheng, C. The Deltacron Conundrum: Its Origin and Potential Health Risks. J. Med. Virol. 2022, 94, 5096–5102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tao, K.; Tzou, P.L.; Nouhin, J.; Gupta, R.K.; De Oliveira, T.; Kosakovsky Pond, S.L.; Fera, D.; Shafer, R.W. The Biological and Clinical Significance of Emerging SARS-CoV-2 Variants. Nat. Rev. Genet. 2021, 22, 757–773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kannan, S.; Shaik Syed Ali, P.; Sheeza, A. Omicron (B.1.1.529)—Variant of Concern—Molecular Profile and Epidemiology: A Mini Review. Eur. Rev. Med. Pharmacol. Sci. 2021, 25, 8019–8022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karim, S.S.A.; Karim, Q.A. Omicron SARS-CoV-2 Variant: A New Chapter in the COVID-19 Pandemic. Lancet 2021, 398, 2126–2128. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.K.; Misra, A. Impact of COVID-19 and Comorbidities on Health and Economics: Focus on Developing Countries and India. Diabetes Metab. Syndr. 2020, 14, 1625–1630. [Google Scholar] [CrossRef] [Scilit]
- Callaway, E. Heavily Mutated Omicron Variant Puts Scientists on Alert. Nature 2021, 600, 21. [Google Scholar] [CrossRef] [Scilit]
- Chatterjee, S.; Bhattacharya, M.; Nag, S.; Dhama, K.; Chakraborty, C. A Detailed Overview of SARS-CoV-2 Omicron: Its Sub-Variants, Mutations and Pathophysiology, Clinical Characteristics, Immunological Landscape, Immune Escape, and Therapies. Viruses 2023, 15, 167. [Google Scholar] [CrossRef] [Scilit]
- Kliker, L.; Zuckerman, N.; Atari, N.; Barda, N.; Gilboa, M.; Nemet, I.; Abd Elkader, B.; Fratty, I.S.; Jaber, H.; Mendelson, E.; et al. COVID-19 Vaccination and BA.1 Breakthrough Infection Induce Neutralising Antibodies Which Are Less Efficient against BA.4 and BA.5 Omicron Variants, Israel, March to June 2022. Eurosurveillance 2022, 27, 2200559. [Google Scholar] [CrossRef] [Scilit]
- WHO. WHO COVID-19 Weekly Epidemiological Update, 115th ed.; WHO: Geneva, Switzerland, 2022. [Google Scholar]
- Collivignarelli, M.C.; Collivignarelli, C.; Carnevale Miino, M.; Abbà, A.; Pedrazzani, R.; Bertanza, G. SARS-CoV-2 in Sewer Systems and Connected Facilities. Process Saf. Environ. Prot. 2020, 143, 196–203. [Google Scholar] [CrossRef] [Scilit]
- Martin, J.; Klapsa, D.; Wilton, T.; Zambon, M.; Bentley, E.; Bujaki, E.; Fritzsche, M.; Mate, R.; Majumdar, M. Tracking SARS-CoV-2 in Sewage: Evidence of Changes in Virus Variant Predominance during COVID-19 Pandemic. Viruses 2020, 12, 1144. [Google Scholar] [CrossRef] [Scilit]
- La Rosa, G.; Bonadonna, L.; Lucentini, L.; Kenmoe, S.; Suffredini, E. Coronavirus in Water Environments: Occurrence, Persistence and Concentration Methods—A Scoping Review. Water Res. 2020, 179, 115899. [Google Scholar] [CrossRef] [Scilit]
- Westhaus, S.; Weber, F.-A.; Schiwy, S.; Linnemann, V.; Brinkmann, M.; Widera, M.; Greve, C.; Janke, A.; Hollert, H.; Wintgens, T.; et al. Detection of SARS-CoV-2 in Raw and Treated Wastewater in Germany—Suitability for COVID-19 Surveillance and Potential Transmission Risks. Sci. Total Environ. 2021, 751, 141750. [Google Scholar] [CrossRef] [Scilit]
- Yaniv, K.; Ozer, E.; Lewis, Y.; Kushmaro, A. RT-QPCR Assays for SARS-CoV-2 Variants of Concern in Wastewater Reveals Compromised Vaccination-Induced Immunity. Water Res. 2021, 207, 117808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yaniv, K.; Ozer, E.; Shagan, M.; Lakkakula, S.; Plotkin, N.; Bhandarkar, N.S.; Kushmaro, A. Direct RT-QPCR Assay for SARS-CoV-2 Variants of Concern (Alpha, B.1.1.7 and Beta, B.1.351) Detection and Quantification in Wastewater. Environ. Res. 2021, 201, 111653. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maida, C.M.; Tramuto, F.; Giammanco, G.M.; Palermo, R.; Priano, W.; De Grazia, S.; Purpari, G.; La Rosa, G.; Suffredini, E.; Lucentini, L.; et al. Wastewater-Based Epidemiology as a Tool to Detect SARS-CoV-2 Circulation at the Community Level: Findings from a One-Year Wastewater Investigation Conducted in Sicily, Italy. Pathogens 2023, 12, 748. [Google Scholar] [CrossRef] [Scilit]
- Yaniv, K.; Ozer, E.; Shagan, M.; Paitan, Y.; Granek, R.; Kushmaro, A. Managing an Evolving Pandemic: Cryptic Circulation of the Delta Variant during the Omicron Rise. Sci. Total Environ. 2022, 836, 155599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dreier, J.; Störmer, M.; Kleesiek, K. Use of Bacteriophage MS2 as an Internal Control in Viral Reverse Transcription-PCR Assays. J. Clin. Microbiol. 2005, 43, 4551–4557. [Google Scholar] [CrossRef] [Scilit]
- Nill, F. Endemic Oscillations for SARS-CoV-2 Omicron—A SIRS Model Analysis. Chaos Solitons Fractals 2023, 173, 113678. [Google Scholar] [CrossRef] [Scilit]
- Goncalves, S.; Abramson, G.; Gomes, M.F.C. Oscillations in SIRS Model with Distributed Delays. Eur. Phys. J. B 2009, 81, 363–371. [Google Scholar] [CrossRef] [Scilit]
- Laurie, M.T.; Liu, J.; Sunshine, S.; Peng, J.; Black, D.; Mitchell, A.M.; Mann, S.A.; Pilarowski, G.; Zorn, K.C.; Rubio, L.; et al. SARS-CoV-2 Variant Exposures Elicit Antibody Responses With Differential Cross-Neutralization of Established and Emerging Strains Including Delta and Omicron. J. Infect. Dis. 2022, 225, 1909–1914. [Google Scholar] [CrossRef] [Scilit]
- Suryawanshi, R.K.; Chen, I.P.; Ma, T.; Syed, A.M.; Brazer, N.; Saldhi, P.; Simoneau, C.R.; Ciling, A.; Khalid, M.M.; Sreekumar, B.; et al. Limited Cross-Variant Immunity after Infection with the SARS-CoV-2 Omicron Variant Without Vaccination. Nature 2022, 607, 351–355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Data Resources—COVID-19 Data Tracker—Israeli Ministry of Health Dashboard. Available online: https://datadashboard.health.gov.il/portal/dashboard/corona (accessed on 19 June 2023).
- Tsori, Y.; Granek, R. Epidemiological Model for the Inhomogeneous Spatial Spreading of COVID-19 and Other Diseases. PLoS ONE 2021, 16, e0246056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsori, Y.; Granek, R. Spatio-Temporal Spread of COVID-19: Comparison of the Inhomogeneous SEPIR Model and Data from South Carolina. PLoS ONE 2022, 17, e0268995. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dos Santos, J.P.C.; Monteiro, E.; Ferreira, J.C.; Teixeira Lemes, N.H.; Rodrigues, D.S. Well Posedness and Qualitative Analysis of a SEIR Model with Spatial Diffusion for COVID-19 Spread. SSRN Electron. J. 2022, 1, 1. [Google Scholar] [CrossRef] [Scilit]
- La Torre, D.; Liuzzi, D.; Marsiglio, S. Geographical Heterogeneities and Externalities in an Epidemiological-macroeconomic Framework. J. Public Econ. Theory 2022, 24, 1154–1181. [Google Scholar] [CrossRef] [Scilit]
- Yaniv, K.; Shagan, M.; Lewis, Y.E.; Kramarsky-Winter, E.; Weil, M.; Indenbaum, V.; Elul, M.; Erster, O.; Brown, A.S.; Mendelson, E.; et al. City-Level SARS-CoV-2 Sewage Surveillance. Chemosphere 2021, 283, 131194. [Google Scholar] [CrossRef] [Scilit]
- Lee, W.L.; Armas, F.; Guarneri, F.; Gu, X.; Formenti, N.; Wu, F.; Chandra, F.; Parisio, G.; Chen, H.; Xiao, A.; et al. Rapid Displacement of SARS-CoV-2 Variant Delta by Omicron Revealed by Allele-Specific PCR in Wastewater. Water Res. 2022, 221, 118809. [Google Scholar] [CrossRef] [Scilit]
- Sangsanont, J.; Rattanakul, S.; Makkaew, P.; Precha, N.; Rukthanapitak, P.; Sresung, M.; Siri, Y.; Kitajima, M.; Takeda, T.; Haramoto, E.; et al. Wastewater Monitoring in Tourist Cities as Potential Sentinel Sites for near Real-Time Dynamics of Imported SARS-CoV-2 Variants. Sci. Total Environ. 2023, 860, 160317. [Google Scholar] [CrossRef] [Scilit]
- Westcott, C.E.; Sokoloski, K.J.; Rouchka, E.C.; Chariker, J.H.; Holm, R.H.; Yeager, R.A.; Moore, J.B.; Elliott, E.M.; Talley, D.; Bhatnagar, A.; et al. The Detection of Periodic Reemergence Events of SARS-CoV-2 Delta Strain in Communities Dominated by Omicron. Pathogens 2022, 11, 1249. [Google Scholar] [CrossRef] [Scilit]


| Name | Target | Primer/Probe | Sequence (5′ ->3′) | Database Accession Number | Position | Reference |
|---|---|---|---|---|---|---|
| nCoV_N2-F | All Variants | Forward | TTACAAACATTGGCCGCAAA | NC_045512.2 † | 29,164–29,183 | CDC |
| nCoV_N2-R | Reverse | GCGCGACATTCCGAAGAA | 29,230–29,213 | |||
| nCoV_N2-P | Probe | FAM/ACAATTTGCCCCCAGCGCTTCAG/3IABkFQ | 29,188–29,210 | |||
| F21989 * | Delta | Forward | GTTTATTACCACAAAAACAACAAAAG | EPI_ISL_1704637 ‡ | 21,964–21,989 | [17] |
| R22083 * | Reverse | GGCTGAGAGACATATTCAAAAGTG | 22,052–22,029 | |||
| S∆157 | Probe | FAM/TGGATGGAA/ZEN/AGTGGAGTTTATTCTAGT/3IABkFQ | 21,991–22,017 | |||
| F22083 | Omicron | Forward | TTAAAATATATTCTAAGCACACGC | EPI_ISL_6794907 ‡ | 22,083–22,106 | [20] |
| R22181 | Reverse | CATTTCGCTGATTTTGGGGTCC | 22,157–22,181 | |||
| Ins214 S | Probe | FAM/TATTATAGT/ZEN/CGTGAGCCAGAAGATCTCC/3IABkFQ | 28,215–28,244 | |||
| MS2-TM2-F | MS2 | Forward | TGCTCGCGGATACCCG | V00642 † | 3169–3184 | [21] |
| MS2-TM2-R | Reverse | AACTTGCGTTCTCGAGCGAT | 3229–3210 | |||
| MS2-TM2JOE | Probe | HEX/ACCTCGGGTTTCCGTCTTGCTCGT/3IABkFQ | 3186–3209 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liddor Naim, M.; Fu, Y.; Shagan, M.; Bar-Or, I.; Marks, R.; Sun, Q.; Granek, R.; Kushmaro, A. The Rise and Fall of Omicron BA.1 Variant as Seen in Wastewater Supports Epidemiological Model Predictions. Viruses 2023, 15, 1862. https://doi.org/10.3390/v15091862
Liddor Naim M, Fu Y, Shagan M, Bar-Or I, Marks R, Sun Q, Granek R, Kushmaro A. The Rise and Fall of Omicron BA.1 Variant as Seen in Wastewater Supports Epidemiological Model Predictions. Viruses. 2023; 15(9):1862. https://doi.org/10.3390/v15091862
Chicago/Turabian StyleLiddor Naim, Michal, Yu Fu, Marilou Shagan, Itay Bar-Or, Robert Marks, Qun Sun, Rony Granek, and Ariel Kushmaro. 2023. "The Rise and Fall of Omicron BA.1 Variant as Seen in Wastewater Supports Epidemiological Model Predictions" Viruses 15, no. 9: 1862. https://doi.org/10.3390/v15091862
APA StyleLiddor Naim, M., Fu, Y., Shagan, M., Bar-Or, I., Marks, R., Sun, Q., Granek, R., & Kushmaro, A. (2023). The Rise and Fall of Omicron BA.1 Variant as Seen in Wastewater Supports Epidemiological Model Predictions. Viruses, 15(9), 1862. https://doi.org/10.3390/v15091862

