Antiviral Activity of the G-Quadruplex Ligand TMPyP4 against Herpes Simplex Virus-1
Abstract
1. Introduction
2. Materials and Methods
2.1. G-Quadruplex Ligands and Oligonucleotides
2.2. Circular Dichroism
2.3. Taq-Polymerase Stop Assay
2.4. Cell Lines and Viruses
2.5. Cytotoxicity
2.6. Flow Cytometry
2.7. Viral Titration Assay
2.8. Early-Entry Viral Assay
2.9. Quantitative Polymerase Chain Reaction (q-PCR)
2.10. TMPyP4 Localization in Cells
2.11. Transmission Electron Microscopy (TEM)
2.12. Western Blot
2.13. Immunofluorescence
2.14. RT-qPCR
3. Results
3.1. The G4-Ligand TMPyP4 Does Not Impair the Early Stages of the HSV-1 Life Cycle
3.2. TMPyP4 Induces Trapping of Fully Infectious HSV-1 Virions in Vesicles in Cells
3.3. TMPyP4-Induced Vesicles Are Independent of Autophagy
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Looker, K.J.; Magaret, A.S.; May, M.T.; Turner, K.M.E.; Vickerman, P.; Gottlieb, S.L.; Newman, L.M. Global and Regional Estimates of Prevalent and Incident Herpes Simplex Virus Type 1 Infections in 2012. PLoS ONE 2015, 10, e0140765. [Google Scholar] [CrossRef]
- Frangoul, H.; Wills, M.; Crossno, C.; Engel, M.; Domm, J. Acyclovir-resistant herpes simplex virus pneumonia post-unrelated stem cell transplantation: A word of caution. Pediatric Transplant. 2007, 11, 942–944. [Google Scholar] [CrossRef]
- Roizman, B.; Whitley, R.J. An Inquiry into the Molecular Basis of HSV Latency and Reactivation. Annu. Rev. Microbiol. 2013, 67, 355–374. [Google Scholar] [CrossRef]
- Hodge, R.A.V.; Field, H.J. Chapter One—Antiviral Agents for Herpes Simplex Virus. In Advances in Pharmacology; De Clercq, E., Ed.; Academic Press: Cambridge, MA, USA, 2013; pp. 1–38. [Google Scholar] [CrossRef]
- Bacon, T.H.; Levin, M.J.; Leary, J.J.; Sarisky, R.T.; Sutton, D. Herpes Simplex Virus Resistance to Acyclovir and Penciclovir after Two Decades of Antiviral Therapy. Clin. Microbiol. Rev. 2003, 16, 114–128. [Google Scholar] [CrossRef]
- Artusi, S.; Nadai, M.; Perrone, R.; Biasolo, M.A.; Palù, G.; Flamand, L.; Calistri, A.; Richter, S.N. The Herpes Simplex Virus-1 genome contains multiple clusters of repeated G-quadruplex: Implications for the antiviral activity of a G-quadruplex ligand. Antivir. Res. 2015, 118, 123–131. [Google Scholar] [CrossRef]
- Frasson, I.; Nadai, M.; Richter, S.N. Conserved G-Quadruplexes Regulate the Immediate Early Promoters of Human Alphaherpesviruses. Molecules 2019, 24, 2375. [Google Scholar] [CrossRef]
- Artusi, S.; Perrone, R.; Lago, S.; Raffa, P.; Di Iorio, E.; Palù, G.; Richter, S.N. Visualization of DNA G-quadruplexes in herpes simplex virus 1-infected cells. Nucleic Acids Res. 2016, 44, 10343–10353. [Google Scholar] [CrossRef]
- Maizels, N. G4-associated human diseases. EMBO Rep. 2015, 16, 910–922. [Google Scholar] [CrossRef] [PubMed]
- Haeusler, A.R.; Donnelly, C.J.; Periz, G.; Simko, E.A.J.; Shaw, P.G.; Kim, M.-S.; Maragakis, N.J.; Troncoso, J.C.; Pandey, A.; Sattler, R.; et al. C9orf72 nucleotide repeat structures initiate molecular cascades of disease. Nat. Cell Biol. 2014, 507, 195–200. [Google Scholar] [CrossRef] [PubMed]
- Ruggiero, E.; Richter, S.N. Survey and summary G-quadruplexes and G-quadruplex ligands: Targets and tools in antiviral therapy. Nucleic Acids Res. 2018, 46, 3270–3283. [Google Scholar] [CrossRef] [PubMed]
- Grand, C.L.; Han, H.; Muñoz, R.M.; Weitman, S.; Hoff, D.D.V.; Hurley, L.H.; Bearss, D.J. The Cationic Porphyrin TMPyP4 Down-Regulates c-MYC and Human Telomerase Reverse Transcriptase Expression and Inhibits Tumor Growth in Vivo 1 This research was supported by grants from the NIH and the Arizona Disease Control Research Commission. Mol. Cancer Ther. 2002, 1, 565–573. [Google Scholar] [PubMed]
- Rha, S.Y.; Izbicka, E.; Lawrence, R.; Davidson, K.; Sun, D.; Moyer, M.P.; Roodman, G.D.; Hurley, L.; Von Hoff, D. Effect of telomere and telomerase interactive agents on human tumor and normal cell lines. Clin. Cancer Res. 2000, 6, 987–993. [Google Scholar] [PubMed]
- Shammas, M.A.; Reis, R.J.S.; Li, C.; Koley, H.; Hurley, L.H.; Anderson, K.C.; Munshi, N.C. Telomerase Inhibition and Cell Growth Arrest after Telomestatin Treatment in Multiple Myeloma. Clin. Cancer Res. 2004, 10, 770–776. [Google Scholar] [CrossRef] [PubMed]
- Izbicka, E.; Wheelhouse, R.T.; Raymond, E.; Davidson, K.K.; Lawrence, R.A.; Sun, D.; Windle, B.E.; Hurley, L.H.; Von Hoff, D.D. Effects of cationic porphyrins as G-quadruplex interactive agents in human tumor cells. Cancer Res. 1999, 59, 639–644. [Google Scholar] [PubMed]
- Liu, W.; Sun, D.; Hurley, L.H. Binding of G-Quadruplex-interactive Agents to Distinct G-Quadruplexes Induces Different Biological Effects in MiaPaCa Cells. Nucleosides Nucleotides Nucleic Acids 2005, 24, 1801–1815. [Google Scholar] [CrossRef]
- Siddiqui-Jain, A.; Grand, C.L.; Bearss, D.J.; Hurley, L. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. USA 2002, 99, 11593–11598. [Google Scholar] [CrossRef]
- Sun, D.; Liu, W.-J.; Guo, K.; Rusche, J.J.; Ebbinghaus, S.; Gokhale, V.; Hurley, L.H. The proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure that can be targeted by G-quadruplex–interactive agents. Mol. Cancer Ther. 2008, 7, 880–889. [Google Scholar] [CrossRef]
- Guo, K.; Pourpak, A.; Beetz-Rogers, K.; Gokhale, V.; Sun, D.; Hurley, L. Formation of Pseudosymmetrical G-Quadruplex and i-Motif Structures in the Proximal Promoter Region of theRETOncogene. J. Am. Chem. Soc. 2007, 129, 10220–10228. [Google Scholar] [CrossRef]
- De Armond, R.; Wood, S.; Sun, D.; Hurley, L.H.; Ebbinghaus, S.W. Evidence for the Presence of a Guanine Quadruplex Forming Region within a Polypurine Tract of the Hypoxia Inducible Factor 1α Promoter. Biochemistry 2005, 44, 16341–16350. [Google Scholar] [CrossRef]
- Mikami-Terao, Y.; Akiyama, M.; Yuza, Y.; Yanagisawa, T.; Yamada, O.; Yamada, H. Antitumor activity of G-quadruplex–interactive agent TMPyP4 in K562 leukemic cells. Cancer Lett. 2008, 261, 226–234. [Google Scholar] [CrossRef]
- Acedo, P.; Stockert, J.C.; Cañete, M.; Villanueva, A. Two combined photosensitizers: A goal for more effective photodynamic therapy of cancer. Cell Death Dis. 2014, 5, e1122. [Google Scholar] [CrossRef]
- Cogoi, S.; Xodo, L.E. G-quadruplex formation within the promoter of the KRAS proto-oncogene and its effect on transcription. Nucleic Acids Res. 2006, 34, 2536–2549. [Google Scholar] [CrossRef]
- Fujimori, J.; Matsuo, T.; Shimose, S.; Kubo, T.; Ishikawa, M.; Yasunaga, Y.; Ochi, M. Antitumor effects of telomerase inhibitor TMPyP4 in osteosarcoma cell lines. J. Orthop. Res. 2011, 29, 1707–1711. [Google Scholar] [CrossRef]
- Liu, A.-H.; Sun, X.; Wei, X.-Q.; Zhang, Y.-Z. Efficacy of Multiple Low-dose Photodynamic TMPYP4 Therapy on Cervical Cancer Tumour Growth in Nude Mice. Asian Pac. J. Cancer Prev. 2013, 14, 5371–5374. [Google Scholar] [CrossRef][Green Version]
- Mitra, J.; Ha, T. Streamlining effects of extra telomeric repeat on telomeric DNA folding revealed by fluorescence-force spectroscopy. Nucleic Acids Res. 2019, 47, 11044–11056. [Google Scholar] [CrossRef]
- Qin, Y.; Rezler, E.M.; Gokhale, V.; Sun, D.; Hurley, L. Characterization of the G-quadruplexes in the duplex nuclease hypersensitive element of the PDGF-A promoter and modulation of PDGF-A promoter activity by TMPyP4. Nucleic Acids Res. 2007, 35, 7698–7713. [Google Scholar] [CrossRef]
- Rapozzi, V.; Zorzet, S.; Zacchigna, M.; Della Pietra, E.; Cogoi, S.; Xodo, L.E. Anticancer activity of cationic porphyrins in melanoma tumour-bearing mice and mechanistic in vitro studies. Mol. Cancer 2014, 13, 75. [Google Scholar] [CrossRef]
- Han, F.X.; Wheelhouse, R.T.; Hurley, L.H. Interactions of TMPyP4 and TMPyP2 with Quadruplex DNA. Structural Basis for the Differential Effects on Telomerase Inhibition. J. Am. Chem. Soc. 1999, 121, 3561–3570. [Google Scholar] [CrossRef]
- Han, H.; Bennett, R.J.; Hurley, L.H. Inhibition of Unwinding of G-Quadruplex Structures by Sgs1 Helicase in the Presence of N,N′-Bis[2-(1-piperidino)ethyl]-3,4,9,10-perylenetetracarboxylic Diimide, a G-Quadruplex-Interactive Ligand. Biochemistry 2000, 39, 9311–9316. [Google Scholar] [CrossRef]
- Qin, Y.; Hurley, L. Structures, folding patterns, and functions of intramolecular DNA G-quadruplexes found in eukaryotic promoter regions. Biochemistry 2008, 90, 1149–1171. [Google Scholar] [CrossRef]
- Maxam, A.M.; Gilbert, W. Sequencing end-labeled DNA with base-specific chemical cleavages. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1980; Volume 65, pp. 499–560. [Google Scholar] [CrossRef]
- La Boissière, S.; Izeta, A.; Malcomber, S.; O’Hare, P. Compartmentalization of VP16 in Cells Infected with Recombinant Herpes Simplex Virus Expressing VP16-Green Fluorescent Protein Fusion Proteins. J. Virol. 2004, 78, 8002–8014. [Google Scholar] [CrossRef] [PubMed]
- Callegaro, S.; Perrone, R.; Scalabrin, M.; Doria, F.; Palù, G.; Richter, S.N. A core extended naphtalene diimide G-quadruplex ligand potently inhibits herpes simplex virus 1 replication. Sci. Rep. 2017, 7, 2341. [Google Scholar] [CrossRef] [PubMed]
- Le, V.H.; Nagesh, N.; Lewis, E.A. Bcl-2 Promoter Sequence G-Quadruplex Interactions with Three Planar and Non-Planar Cationic Porphyrins: TMPyP4, TMPyP3, and TMPyP2. PLoS ONE 2013, 8, e72462. [Google Scholar] [CrossRef] [PubMed]
- Han, H.; Langley, D.R.; Rangan, A.; Hurley, L.H. Selective Interactions of Cationic Porphyrins with G-Quadruplex Structures. J. Am. Chem. Soc. 2001, 123, 8902–8913. [Google Scholar] [CrossRef] [PubMed]
- Campadelli-Fiume, G.; Amasio, M.; Avitabile, E.; Cerretani, A.; Forghieri, C.; Gianni, T.; Menotti, L. The multipartite system that mediates entry of herpes simplex virus into the cell. Rev. Med. Virol. 2007, 17, 313–326. [Google Scholar] [CrossRef] [PubMed]
- Brown, S.M.; MacLean, A.R.; Aitken, J.D.; Harland, J. ICP34.5 influences herpes simplex virus type 1 maturation and egress from infected cells in vitro. J. Gen. Virol. 1994, 75, 3679–3686. [Google Scholar] [CrossRef]
- Orvedahl, A.; Alexander, D.; Tallóczy, Z.; Sun, Q.; Wei, Y.; Zhang, W.; Burns, D.; Leib, D.A.; Levine, B. HSV-1 ICP34.5 Confers Neurovirulence by Targeting the Beclin 1 Autophagy Protein. Cell Host Microbe 2007, 1, 23–35. [Google Scholar] [CrossRef]
- Lussignol, M.; Queval, C.; Bernet-Camard, M.-F.; Cotte-Laffitte, J.; Beau, I.; Codogno, P.; Esclatine, A. The Herpes Simplex Virus 1 Us11 Protein Inhibits Autophagy through Its Interaction with the Protein Kinase PKR. J. Virol. 2013, 87, 859–871. [Google Scholar] [CrossRef]
- Radtke, K.; English, L.; Rondeau, C.; Leib, D.; Lippé, R.; Desjardins, M. Inhibition of the Host Translation Shutoff Response by Herpes Simplex Virus 1 Triggers Nuclear Envelope-Derived Autophagy. J. Virol. 2013, 87, 3990–3997. [Google Scholar] [CrossRef]
- Bjørkøy, G.; Lamark, T.; Brech, A.; Outzen, H.; Perander, M.; Øvervatn, A.; Stenmark, H.; Johansen, T. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 2005, 171, 603–614. [Google Scholar] [CrossRef]
- Yaku, H.; Murashima, T.; Miyoshi, D.; Sugimoto, N. In Vitro Assays Predictive of Telomerase Inhibitory Effect of G-Quadruplex Ligands in Cell Nuclei. J. Phys. Chem. B 2013, 118, 2605–2614. [Google Scholar] [CrossRef] [PubMed]
- Lavezzo, E.; Berselli, M.; Frasson, I.; Perrone, R.; Palù, G.; Brazzale, A.R.; Richter, S.N.; Toppo, S. G-quadruplex forming sequences in the genome of all known human viruses: A comprehensive guide. PLoS Comput. Biol. 2018, 14, e1006675. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Zhang, J.; Harvey, S.E.; Hu, X.; Cheng, C. RNA G-quadruplex secondary structure promotes alternative splicing via the RNA-binding protein hnRNPF. Genes Dev. 2017, 31, 2296–2309. [Google Scholar] [CrossRef] [PubMed]
- Zamiri, B.; Reddy, K.; MacGregor, R.B.; Pearson, C.E. TMPyP4 Porphyrin Distorts RNA G-quadruplex Structures of the Disease-associated r(GGGGCC)nRepeat of theC9orf72Gene and Blocks Interaction of RNA-binding Proteins. J. Biol. Chem. 2014, 289, 4653–4659. [Google Scholar] [CrossRef]
- Morris, M.J.; Wingate, K.L.; Silwal, J.; Leeper, T.C.; Basu, S. The porphyrin TmPyP4 unfolds the extremely stable G-quadruplex in MT3-MMP mRNA and alleviates its repressive effect to enhance translation in eukaryotic cells. Nucleic Acids Res. 2012, 40, 4137–4145. [Google Scholar] [CrossRef]
- Zhang, D.-H.; Fujimoto, T.; Saxena, S.; Yu, H.-Q.; Miyoshi, D.; Sugimoto, N. Monomorphic RNA G-Quadruplex and Polymorphic DNA G-Quadruplex Structures Responding to Cellular Environmental Factors. Biochemistry 2010, 49, 4554–4563. [Google Scholar] [CrossRef]
- Assi, H.A.; Garavís, M.; González, C.; Damha, M.J. i-Motif DNA: Structural features and significance to cell biology. Nucleic Acids Res. 2018, 46, 8038–8056. [Google Scholar] [CrossRef]
- Zeraati, M.; Langley, D.B.; Schofield, P.; Moye, A.L.; Rouet, R.; Hughes, W.E.; Bryan, T.M.; Dinger, M.E.; Christ, D. I-motif DNA structures are formed in the nuclei of human cells. Nat. Chem. 2018, 10, 631–637. [Google Scholar] [CrossRef]
- Martino, L.; Pagano, B.; Fotticchia, I.; Neidle, S.; Giancola, C. Shedding Light on the Interaction between TMPyP4 and Human Telomeric Quadruplexes. J. Phys. Chem. B 2009, 113, 14779–14786. [Google Scholar] [CrossRef]
- Fedoroff, O.Y.; Rangan, A.; Chemeris, V.V.; Hurley, L.H. Cationic porphyrins promote the formation of i-motif DNA and bind peripherally by a nonintercalative mechanism. Biochemistry 2000, 39, 15083–15090. [Google Scholar] [CrossRef]
- Fernández, S.; Eritja, R.; Aviñó, A.; Jaumot, J.; Gargallo, R. Influence of pH, temperature and the cationic porphyrin TMPyP4 on the stability of the i-motif formed by the 5′-(C3TA2)4-3′ sequence of the human telomere. Int. J. Biol. Macromol. 2011, 49, 729–736. [Google Scholar] [CrossRef]
- Khan, N.; Aviñó, A.; Tauler, R.; González, C.; Eritja, R.; Gargallo, R. Solution equilibria of the i-motif-forming region upstream of the B-cell lymphoma-2 P1 promoter. Biochemistry 2007, 89, 1562–1572. [Google Scholar] [CrossRef]
- Masoud, S.S.; Nagasawa, K. i-Motif-Binding Ligands and Their Effects on the Structure and Biological Functions of i-Motif. Chem. Pharm. Bull. 2018, 66, 1091–1103. [Google Scholar] [CrossRef]
- Ren, J.; Chaires, J.B. Sequence and Structural Selectivity of Nucleic Acid Binding Ligands. Biochemistry 1999, 38, 16067–16075. [Google Scholar] [CrossRef]
- Luedtke, N.W. Targeting G-Quadruplex DNA with Small Molecules. Chim. Int. J. Chem. 2009, 63, 134–139. [Google Scholar] [CrossRef]
- Zheng, X.-H.; Nie, X.; Liu, H.-Y.; Fang, Y.-M.; Zhao, Y.; Xia, L.-X. TMPyP4 promotes cancer cell migration at low doses, but induces cell death at high doses. Sci. Rep. 2016, 6, 26592. [Google Scholar] [CrossRef]
- Perrone, R.; Nadai, M.; Poe, J.A.; Frasson, I.; Palumbo, M.; Palù, G.; Smithgall, T.E.; Richter, S.N. Formation of a Unique Cluster of G-Quadruplex Structures in the HIV-1 nef Coding Region: Implications for Antiviral Activity. PLoS ONE 2013, 8, e73121. [Google Scholar] [CrossRef]
- Norseen, J.; Johnson, F.B.; Lieberman, P.M. Role for G-Quadruplex RNA Binding by Epstein-Barr Virus Nuclear Antigen 1 in DNA Replication and Metaphase Chromosome Attachment. J. Virol. 2009, 83, 10336–10346. [Google Scholar] [CrossRef]
- Dabral, P.; Babu, J.; Zareie, A.; Verma, S.C. LANA and hnRNP A1 Regulate the Translation of LANA mRNA through G-Quadruplexes. J. Virol. 2019, 94, 01508–01519. [Google Scholar] [CrossRef]
- Wang, S.-R.; Min, Y.-Q.; Wang, J.-Q.; Liu, C.-X.; Fu, B.-S.; Wu, F.; Wu, L.-Y.; Qiao, Z.-X.; Song, Y.-Y.; Xu, G.-H.; et al. A highly conserved G-rich consensus sequence in hepatitis C virus core gene represents a new anti–hepatitis C target. Sci. Adv. 2016, 2, e1501535. [Google Scholar] [CrossRef]
- Wang, S.-R.; Zhang, Q.-Y.; Wang, J.-Q.; Ge, X.-Y.; Song, Y.-Y.; Wang, Y.; Li, X.-D.; Fu, B.-S.; Xu, G.-H.; Shu, B.; et al. Chemical Targeting of a G-Quadruplex RNA in the Ebola Virus L Gene. Cell Chem. Biol. 2016, 23, 1113–1122. [Google Scholar] [CrossRef]
- Lebedeva, N.; Gubarev, Y.A.; Koifman, M.O.; Koifman, O.I. The Application of Porphyrins and Their Analogues for Inactivation of Viruses. Molecules 2020, 25, 4368. [Google Scholar] [CrossRef]










| Assay | Name | Sequence (5′→3′) * |
|---|---|---|
| CD | gp054e | GGGGCTGGGGCTGGGGTTGGGG |
| un2 | GGGGGCGAGGGGCGGGAGGGGGCGAGGGG | |
| un3 | GGGAGGAGCGGGGGGAGGAGCGGG | |
| Taq polymerase stop assay | un3 template | TTTTTGGGAGGAGCGGGGGGAGGAGCGGGTTTTTCTGCATATAAGCAGCTGCTTTTTGCC |
| no-G4 template | TTGTCGTTAAAGTCTGACTGCGAGCTCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCC | |
| primer | GGCAAAAAGCAGCTGCTTATATGCAG | |
| qPCR | UL30 primer F | TTCGACTTTGCCAGCCTGTA |
| UL30 primer R | CAGGGAGAGCGTGCTGAAG | |
| actin primer F | TCACTGAGCGCGGCTACA | |
| actin primer R | CCTTAATGTCACGCACGATTTC | |
| RT-qPCR | ICP34.5 primer F | CGCCTTCTTGTTCGCTGCTG |
| ICP34.5 primer R | TCGTCGTCATCGTCGTCGTC | |
| UL36 primer F | AGGGAGGATGCCCACGAA | |
| UL36 primer R | TCCGCGTCTTCCACAAATC | |
| UL30 primer F | CAGGGAGAGCGTGCTGAAG | |
| UL30 primer R | TTCGACTTTGCCAGCCTGTA | |
| ICP22 primer F | GGCCCGGAGTGTGATCTTAG | |
| ICP22 primer R | GGTGGCATCGGAGATTTCAT | |
| ACTB primer F | CCTTAATGTCACGCACGATTTC | |
| ACTB primer R | TCACTGAGCGCGGCTACA | |
| p62 primer F | TGCCCAGACTACGACTTGTG | |
| p62 primer R | AGTGTCCGTGTTTCACCTTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Artusi, S.; Ruggiero, E.; Nadai, M.; Tosoni, B.; Perrone, R.; Ferino, A.; Zanin, I.; Xodo, L.; Flamand, L.; Richter, S.N. Antiviral Activity of the G-Quadruplex Ligand TMPyP4 against Herpes Simplex Virus-1. Viruses 2021, 13, 196. https://doi.org/10.3390/v13020196
Artusi S, Ruggiero E, Nadai M, Tosoni B, Perrone R, Ferino A, Zanin I, Xodo L, Flamand L, Richter SN. Antiviral Activity of the G-Quadruplex Ligand TMPyP4 against Herpes Simplex Virus-1. Viruses. 2021; 13(2):196. https://doi.org/10.3390/v13020196
Chicago/Turabian StyleArtusi, Sara, Emanuela Ruggiero, Matteo Nadai, Beatrice Tosoni, Rosalba Perrone, Annalisa Ferino, Irene Zanin, Luigi Xodo, Louis Flamand, and Sara N. Richter. 2021. "Antiviral Activity of the G-Quadruplex Ligand TMPyP4 against Herpes Simplex Virus-1" Viruses 13, no. 2: 196. https://doi.org/10.3390/v13020196
APA StyleArtusi, S., Ruggiero, E., Nadai, M., Tosoni, B., Perrone, R., Ferino, A., Zanin, I., Xodo, L., Flamand, L., & Richter, S. N. (2021). Antiviral Activity of the G-Quadruplex Ligand TMPyP4 against Herpes Simplex Virus-1. Viruses, 13(2), 196. https://doi.org/10.3390/v13020196

