Effects of Caries Activity on Compositions of Mutans Streptococci in Saliva-Induced Biofilm Formed on Bracket Materials
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Preparation
2.2. Surface Analysis
2.3. Subject Recruitment
2.4. Saliva Collection
2.5. Biofilm Formation
2.6. Microbial Analysis
2.7. Statistical Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Tasios, T.; Papageorgiou, S.N.; Papadopoulos, M.A.; Tsapas, A.; Haidich, A.B. Prevention of orthodontic enamel demineralization: A systematic review with meta-analyses. Orthod. Craniofac. Res. 2019, 22, 225–235. [Google Scholar] [CrossRef]
- Artun, J.; Brobakken, B.O. Prevalence of carious white spots after orthodontic treatment with multibonded appliances. Eur. J. Orthod. 1986, 8, 229–234. [Google Scholar] [CrossRef] [PubMed]
- Sukontapatipark, W.; el-Agroudi, M.A.; Selliseth, N.J.; Thunold, K.; Selvig, K.A. Bacterial colonization associated with fixed orthodontic appliances. A scanning electron microscopy study. Eur. J. Orthod. 2001, 23, 475–484. [Google Scholar] [CrossRef] [PubMed]
- Shemesh, M.; Tam, A.; Steinberg, D. Expression of biofilm-associated genes of Streptococcus mutans in response to glucose and sucrose. J. Med. Microbiol. 2007, 56, 1528–1535. [Google Scholar] [CrossRef] [PubMed]
- Lundstrom, F.; Krasse, B. Caries incidence in orthodontic patients with high levels of Streptococcus mutans. Eur. J. Orthod. 1987, 9, 117–121. [Google Scholar] [CrossRef] [PubMed]
- Scheie, A.A.; Arneberg, P.; Krogstad, O. Effect of orthodontic treatment on prevalence of Streptococcus mutans in plaque and saliva. Scand. J. Dent. Res. 1984, 92, 211–217. [Google Scholar] [CrossRef] [PubMed]
- Fine, D.H. Lactoferrin: A Roadmap to the Borderland between Caries and Periodontal Disease. J. Dent. Res. 2015, 94, 768–776. [Google Scholar] [CrossRef]
- Ho, C.S.; Ming, Y.; Foong, K.W.; Rosa, V.; Thuyen, T.; Seneviratne, C.J. Streptococcus mutans forms xylitol-resistant biofilm on excess adhesive flash in novel ex-vivo orthodontic bracket model. Am. J. Orthod. Dentofacial Orthop. 2017, 151, 669–677. [Google Scholar] [CrossRef]
- Jeon, D.M.; An, J.S.; Lim, B.S.; Ahn, S.J. Orthodontic bonding procedures significantly influence biofilm composition. Prog. Orthod. 2020, 21, 14. [Google Scholar] [CrossRef]
- Rymovicz, A.U.; Ronsani, M.M.; Gregio, A.M.; Guariza-Filho, O.G.; Tanaka, O.; Rosa, E.A. Virulence modulation of Streptococcus mutans biofilms by metal ions released from orthodontic appliances. Angle Orthod. 2013, 83, 987–993. [Google Scholar] [CrossRef] [Green Version]
- Taha, M.; El-Fallal, A.; Degla, H. In vitro and in vivo biofilm adhesion to esthetic coated arch wires and its correlation with surface roughness. Angle Orthod. 2016, 86, 285–291. [Google Scholar] [CrossRef] [Green Version]
- An, J.S.; Kim, K.; Cho, S.; Lim, B.S.; Ahn, S.J. Compositional differences in multi-species biofilms formed on various orthodontic adhesives. Eur. J. Orthod. 2017, 39, 528–533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, X.; He, J.; Xue, J.; Wang, Y.; Li, K.; Zhang, K.; Guo, Q.; Liu, X.; Zhou, Y.; Cheng, L.; et al. Oral cavity contains distinct niches with dynamic microbial communities. Environ. Microbiol. 2015, 17, 699–710. [Google Scholar] [CrossRef]
- Aas, J.A.; Paster, B.J.; Stokes, L.N.; Olsen, I.; Dewhirst, F.E. Defining the normal bacterial flora of the oral cavity. J. Clin. Microbiol. 2005, 43, 5721–5732. [Google Scholar] [CrossRef] [Green Version]
- Zaura, E.; Keijser, B.J.; Huse, S.M.; Crielaard, W. Defining the healthy “core microbiome” of oral microbial communities. BMC Microbiol. 2009, 9, 259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Washio, J.; Takahashi, N. Metabolomic Studies of Oral Biofilm, Oral Cancer, and Beyond. Int. J. Mol. Sci. 2016, 17, 870. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- World Health Organization. Oral Health Surveys—Basic Methods, 4th ed.; WHO: Geneva, Switzerland, 1997. [Google Scholar]
- Park, J.W.; An, J.S.; Lim, W.H.; Lim, B.S.; Ahn, S.J. Microbial changes in biofilms on composite resins with different surface roughness: An in vitro study with a multispecies biofilm model. J. Prosthet. Dent. 2019, 122, 493.e1–493.e8. [Google Scholar] [CrossRef]
- Ogaard, B. Prevalence of white spot lesions in 19-year-olds: A study on untreated and orthodontically treated persons 5 years after treatment. Am. J. Orthod. Dentofac. Orthop. 1989, 96, 423–427. [Google Scholar] [CrossRef]
- Eliades, T.; Bourauel, C. Intraoral aging of orthodontic materials: The picture we miss and its clinical relevance. Am. J. Orthod. Dentofac. Orthop. 2005, 127, 403–412. [Google Scholar] [CrossRef]
- Chen, Y.; Wong, R.W.; Seneviratne, C.J.; Hagg, U.; McGrath, C.; Samaranayake, L.P.; Kao, R. The antimicrobial efficacy of Fructus mume extract on orthodontic bracket: A monospecies-biofilm model study in vitro. Arch. Oral. Biol. 2011, 56, 16–21. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.P.; Lee, S.J.; Lim, B.S.; Ahn, S.J. Surface characteristics of orthodontic materials and their effects on adhesion of mutans streptococci. Angle Orthod. 2009, 79, 353–360. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Chen, S.; Zhang, C.; Zhao, X.; Huang, X.; Cai, Z. Effect of the Biofilm Age and Starvation on Acid Tolerance of Biofilm Formed by Streptococcus mutans Isolated from Caries-Active and Caries-Free Adults. Int. J. Mol. Sci. 2017, 18, 713. [Google Scholar] [CrossRef] [PubMed]
- Salli, K.M.; Ouwehand, A.C. The use of in vitro model systems to study dental biofilms associated with caries: A short review. J. Oral. Microbiol. 2015, 7, 26149. [Google Scholar] [CrossRef] [PubMed]
- Ahn, S.J.; Lim, B.S.; Lee, S.J. Prevalence of cariogenic streptococci on incisor brackets detected by polymerase chain reaction. Am. J. Orthod. Dentofac. Orthop. 2007, 131, 736–741. [Google Scholar] [CrossRef] [Green Version]
- Teughels, W.; Van Assche, N.; Sliepen, I.; Quirynen, M. Effect of material characteristics and/or surface topography on biofilm development. Clin. Oral. Implants Res. 2006, 17, 68–81. [Google Scholar] [CrossRef]
- Etxeberria, M.; Lopez-Jimenez, L.; Merlos, A.; Escuin, T.; Vinas, M. Bacterial adhesion efficiency on implant abutments: A comparative study. Int. Microbiol. 2013, 16, 235–242. [Google Scholar]
- Li, J.; Helmerhorst, E.J.; Leone, C.W.; Troxler, R.F.; Yaskell, T.; Haffajee, A.D.; Socransky, S.S.; Oppenheim, F.G. Identification of early microbial colonizers in human dental biofilm. J. Appl. Microbiol. 2004, 97, 1311–1318. [Google Scholar] [CrossRef]
Group | Age | Sex | Number of Decayed Teeth | Number of Missing Teeth | Number of Filled Teeth | DMFT Score | |
---|---|---|---|---|---|---|---|
Caries-active (CA) | 1 | 29 | Male | 3 | 0 | 7 | 10 |
2 | 48 | Female | 2 | 0 | 9 | 11 | |
3 | 20 | Female | 5 | 2 | 6 | 13 | |
4 | 29 | Male | 3 | 0 | 7 | 10 | |
Caries-free (CF) | 5 | 22 | Male | 0 | 0 | 0 | 0 |
6 | 31 | Male | 0 | 0 | 0 | 0 | |
7 | 38 | Female | 0 | 0 | 0 | 0 | |
8 | 33 | Male | 0 | 0 | 0 | 0 |
Primer | Sequence (5’-to-3’) | Size of Amplicon (Base Pairs) | Initial Denaturation | Denaturation | Annealing | Extension | Cycles |
---|---|---|---|---|---|---|---|
Total Bacteria | Forward: TGGAGCATGTGGTTAATTCGA | 160 | 94 °C | 95 °C | 60 °C | 60 °C | 40 |
Reverse: TGCGGACTTAACCCAACA | 30 s | 20 s | 45 s | 10 s | |||
Streptococcus mutans | Forward: CTACACTTTCGGGTGGCTTG | 261 | 94 °C | 95 °C | 60 °C | 60 °C | 40 |
Reverse: GAAGCTTTTCACCATTAGAAGCTG | 30 s | 20 s | 45 s | 10 s | |||
Streptococcus sobrinus | Forward: AAAACATTGGGTTACGATTGCG | 156 | 94 °C | 95 °C | 60 °C | 60 °C | 40 |
Reverse: CGTCATTGGTAGTAGCCTGA | 30 s | 20 s | 45 s | 10 s |
Surface Analyses | Ceramic | Metal | Plastic | Significance † | p Value |
---|---|---|---|---|---|
Surface Roughness | 0.41 ± 0.09 | 0.19 ± 0.08 | 0.27 ± 0.06 | Ceramic > Metal, Plastic | 0.000 |
Water Contact Angle | 62.71 ± 6.08 | 65.98 ± 5.75 | 74.83 ± 6.09 | Ceramic, Metal < Plastic | 0.000 |
Counts per mL | Caries-Active | Caries-Free | Significance † | p Value |
---|---|---|---|---|
Total Bacteria | 1.0 × 108 ± 0.1 × 108 | 1.1 × 108 ± 0.2 × 108 | Caries-Active = Caries-Free | 0.745 |
Streptococcus mutans | 6430.9 ± 1061.5 | 802.2 ± 153.6 | Caries-Active > Caries-Free | 0.000 |
Streptococcus sobrinus | 97.8 ± 13.6 | 13.4 ± 5.9 | Caries-Active > Caries-Free | 0.003 |
Count per Specimen | Ceramic | Metal | Plastic | Significance † | p Value |
---|---|---|---|---|---|
Total Bacteria | Caries-Active < Caries-Free Ceramic > Plastic | 0.019 0.007 | |||
Caries-Active | 2.4 × 107 ± 1.0 × 107 | 1.8 × 107 ± 0.9 × 107 | 1.3 × 107 ± 0.5 × 107 | ||
Caries-Free | 3.5 × 107 ± 2.4 × 107 | 2.1 × 107 ± 1.5 × 107 | 2.2 × 107 ± 1.4 × 107 | ||
Streptococcus mutans | Caries-Active > Caries-Free | 0.000 | |||
Caries-Active | 1674.8 ± 482.2 | 560.8 ± 432.0 | 564.2 ± 478.9 | Caries-Active (Ceramic >> Metal, Plastic) | 0.000 |
Caries-Free | 47.7 ± 19.3 | 34.1 ± 10.0 | 36.8 ± 13.2 | Caries-Free (Ceramic > Metal, Plastic) | 0.032 |
Streptococcus sobrinus | |||||
Caries-Active | 115.7 ± 48.6 | 91.4 ± 41.7 | 80.7 ± 43.3 | Caries-Active > Caries-Free | 0.000 |
Caries-Free | 48.9 ± 21.9 | 28.8 ± 14.0 | 39.8 ± 16.8 | Ceramic > Metal, Plastic | 0.041 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, B.-S.; Kim, B.-H.; Shon, W.-J.; Ahn, S.-J. Effects of Caries Activity on Compositions of Mutans Streptococci in Saliva-Induced Biofilm Formed on Bracket Materials. Materials 2020, 13, 4764. https://doi.org/10.3390/ma13214764
Lim B-S, Kim B-H, Shon W-J, Ahn S-J. Effects of Caries Activity on Compositions of Mutans Streptococci in Saliva-Induced Biofilm Formed on Bracket Materials. Materials. 2020; 13(21):4764. https://doi.org/10.3390/ma13214764
Chicago/Turabian StyleLim, Bum-Soon, Bo-Hyun Kim, Won-Jun Shon, and Sug-Joon Ahn. 2020. "Effects of Caries Activity on Compositions of Mutans Streptococci in Saliva-Induced Biofilm Formed on Bracket Materials" Materials 13, no. 21: 4764. https://doi.org/10.3390/ma13214764
APA StyleLim, B.-S., Kim, B.-H., Shon, W.-J., & Ahn, S.-J. (2020). Effects of Caries Activity on Compositions of Mutans Streptococci in Saliva-Induced Biofilm Formed on Bracket Materials. Materials, 13(21), 4764. https://doi.org/10.3390/ma13214764