Hospital Wastewater—Important Source of Multidrug Resistant Coliform Bacteria with ESBL-Production
Abstract
1. Introduction
2. Materials and Methods
2.1. Characterization of Healthcare Facilities and Description of Sampling Methodology
2.2. The Occurrence of ATB-Resistant Coliform Bacteria in HEs
2.3. Isolation and Identification of Resistant Coliform Bacteria
2.4. ATB Susceptibility Detection
2.4.1. Macro-Dilution Method Assay
2.4.2. Microtiter Plate Assay
2.5. Double Disk Synergy Test for the Production of ESBLs
2.6. Ethidium Bromide (EtBr) Agar Cartwheel Method for Efflux Pumps Overproduction
2.7. Biofilm Detection Assay
2.8. Antibiotic Resistance Gene Detection
2.8.1. Multiplex PCR Assay for ESBL Gene Detection
2.8.2. Single PCR Assay for ESBL Gene Detection
2.8.3. PCR Conditions
2.8.4. Multiplex PCR Assay for Tet Genes Detection
3. Results and Discussion
3.1. The occurrence of ATB-Resistant Coliform Bacteria in Wastewaters from Healthcare Facilities
3.2. Identification and Susceptibility of ATB-Resistant Coliform Bacteria Isolates
3.3. Selected Mechanisms of ATB Resistance in Isolates
3.3.1. Detection of Efflux Pumps Overproduction
3.3.2. Detection of ESBL Production
3.4. The Ability of ATB-Resistant Isolates to form Biofilm
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Barancheshme, F.; Munir, M. Strategies to combat antibiotic resistance in the wastewater treatment plants. Front. Microbiol. 2018, 8, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Mackuľak, T.; Nagyová, K.; Fáberová, M.; Grabic, R.; Koba, O.; Gál, M.; Birošová, L. Utilization of Fenton-like reaction for antibiotics and resistant bacteria elimination in different parts of WWTP. Environ. Toxicol. Pharmacol. 2015, 40, 492–497. [Google Scholar] [CrossRef] [PubMed]
- Le, T.H.; Ng, C.; Chen, H.; Yi, X.Z.; Koh, T.H.; Barkham, T.M.; Zhou, Z.; Gin, K.Y. Occurrences and characterization of antibiotic-resistant bacteria and genetic determinants of hospital wastewater in a tropical country. Antimicrob. Agents Chemother. 2016, 60, 7449–7456. [Google Scholar] [CrossRef] [PubMed]
- Jutkina, J.; Rutgersson, C.; Flach, C.F.; Joakim Larsson, D.G. An assay for determining minimal concentrations of antibiotics that drive horizontal transfer of resistance. Sci. Total Environ. 2016, 548–549, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Hocquet, D.; Muller, A.; Bertrand, X. What happens in hospitals does not stay in hospitals: Antibiotic-resistant bacteria in hospital wastewater systems. J. Hosp. Infect. 2016, 93, 395–402. [Google Scholar] [CrossRef]
- Islam, M.A.; Islam, M.; Hasan, R.; Hossain, M.I.; Nabi, A.; Rahman, M.; Goessens, W.H.F.; Endtz, E.P.; Boehm, A.B.; Faruque, S.M. Environmental spread of New Delhi metallo-β-lactamase-1-producing multidrug-resistant bacteria in Dhaka, Bangladesh. Appl. Environ. Microbiol. 2017, 83, e00793-17. [Google Scholar] [CrossRef]
- Lamba, M.; Graham, D.W.; Ahammad, S.Z. Hospital wastewater releases of carbapenem-resistance pathogens and genes in urban India. Environ. Sci. Technol. 2017, 51, 13906–13912. [Google Scholar] [CrossRef]
- Mackuľak, T.; Grabic, R.; Špalková, V.; Belišová, N.; Škulcová, A.; Slavík, O.; Horký, P.; Gál, M.; Filip, J.; Híveš, J.; et al. Hospital wastewaters treatment: Fenton reaction vs. BDDE vs. ferrate(VI). Environ. Sci. Pollut. Res. Int. 2019, 26, 31812–31821. [Google Scholar] [CrossRef]
- Tasca, A.L.; Clematis, D.; Stefanelli, E.; Panizza, M.; Puccini, M. Ciprofloxacin removal: BDD anode coupled with solid polymer electrolyte and ultrasound irradiation. J. Water Process. Eng. 2020, 33, 101074. [Google Scholar] [CrossRef]
- World Health Organisation, WHO. WHO Publishes List of Bacteria for which New Antibiotics are Urgently Needed. 27 February 2017, News Release, Geneva. Available online: https://www.who.int/news-room/detail/27-02-2017-who-publishes-list-of-bacteria-for-which-new-antibiotics-are-urgently-needed (accessed on 25 October 2018).
- Pilmis, B.; Cattoir, V.; Lecointe, D.; Limelette, A.; Grall, I.; Mizrahi, A.; Marcade, G.; Poilane, I.; Guillard, T.; Bourgeois Nicolaos, N.; et al. Carriage of ESBL-producing Enterobacteriaceae in French hospitals: The PORTABLSE study. J. Hosp. Infect. 2018, 98, 247–252. [Google Scholar] [CrossRef]
- Sabir, N.; Ikram, A.; Zaman, G.; Satti, L.; Gardezi, A.; Ahmed, A.; Ahmed, P. Bacterial biofilm-based catheter-associated urinary tract infections: Causative pathogens and antibiotic resistance. Am. J. Infect. Control. 2017, 45, 1101–1105. [Google Scholar] [CrossRef] [PubMed]
- Flemming, H.C.; Wingender, J.; Szewzyk, U.; Steinberg, P.; Rice, S.A.; Kjelleberg, S. Biofilms: An emergent form of bacterial life. Nat. Rev. Microbiol. 2016, 14, 563–575. [Google Scholar] [CrossRef] [PubMed]
- International Organization for Standardization. ISO 9308-1:2014. Water Quality—Enumeration of Escherichia Coli and Coliform Bacteria—Part 1: Membrane Filtration Method for Waters with Low Bacterial Background Flora; International Organization for Standardization: Geneva, Switzerland, 2014. [Google Scholar]
- Lépesová, K.; Kraková, L.; Pangallo, D.; Medveďová, A.; Olejníková, P.; Mackuľak, T.; Tichý, J.; Grabic, R.; Birošová, L. Prevalence of antibiotic resistant coliform bacteria, Enterococcus spp. and Staphylococcus spp. in wastewater sewerage biofilm. J. Glob. Antimicrob. Resist. 2018, 14, 145–151. [Google Scholar] [CrossRef] [PubMed]
- European Committee on Antimicrobial Susceptibility Testing, EUCAST. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 8.0 Valid from 2018-01-01; EUCAST: Växjö, Sweden, 2018; pp. 1–95. [Google Scholar]
- Clinical and Laboratory Standards Institute, CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; CLSI: Wayne, PA, USA, 2017; pp. 1–282. [Google Scholar]
- Hrabák, J.; Bergerová, T. Detection of Broad-Spectrum Beta-Lactamases and AmpC in Enterobacteriaceae; State Health Institute: Prague, Czech Republic, 2008; pp. 1–9. (In Czech) [Google Scholar]
- Martins, M.; McCusker, M.P.; Viveiros, M.; Couto, I.; Fanning, S.; Pagès, J.M.; Amaral, L. A simple method for assessment of MDR bacteria for over-expressed efflux pumps. Open Microbiol. J. 2013, 7, 72–82. [Google Scholar] [CrossRef]
- Taniguchi, L.; De Fátima Faria, B.; Rosa, R.T.; De Paula ECarvalho, A.; Gursky, L.C.; Elifio-Esposito, S.L.; Parahitiyawa, N.; Samaranayake, L.P.; Rosa, E.A. Proposal of a low-cost protocol for colorimetric semi-quantification of secretory phospholipase by Candida albicans grown in planktonic and biofilm phases. J. Microbiol. Methods 2009, 78, 171–174. [Google Scholar] [CrossRef]
- Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef]
- Memariani, M.; Peerayeh, S.N.; Salehi, T.Z.; Mostafavi, S.K.S. Occurrence of SHV, TEM and CTX-M β-lactamase genes among enteropathogenic Escherichia coli strains isolated from children with diarrhea. Jundishapur J. Microbiol. 2015, 8, 1–8. [Google Scholar] [CrossRef]
- Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef]
- Szczepanowski, R.; Linke, B.; Krahn, I.; Gartemann, K.H.; Gützkow, T.; Eichler, W.; Pühler, A.; Scglüter, A. Detection of 140 clinically relevant antibiotic-resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics. Microbiology 2009, 155, 2306–2319. [Google Scholar] [CrossRef]
- Luo, Y.; Yang, F.; Mathieu, J.; Mao, D.; Wang, Q.; Alvarez, P.J.J. Proliferation of multidrug-resistant New Delhi metallo-β-lactamase genes in municipal wastewater treatment plants in Northern China. Environ. Sci. Technol. Lett. 2014, 1, 26–30. [Google Scholar] [CrossRef]
- Narciso-Da-Rocha, C.; Varela, A.R.; Schwartz, T.; Nunes, O.C.; Manaia, C.M. blaTEM and vanA as indicator genes of antibiotic resistance contamination in a hospital–urban wastewater treatment plant system. J. Glob. Antimicrob. Resist. 2014, 2, 309–315. [Google Scholar] [CrossRef] [PubMed]
- Berendonk, T.U.; Manaia, C.M.; Merlin, C.; Fatta-Kassinos, D.; Cytryn, E.; Walsh, F.; Bürgmann, H.; Sørum, H.; Norström, M.; Pons, M.N.; et al. Tackling antibiotic resistance: The environmental framework. Nat. Rev. Microbiol. 2015, 13, 310–317. [Google Scholar] [CrossRef]
- Szekeres, E.; Baricz, A.; Chiriac, C.M.; Farkas, A.; Opris, O.; Soran, M.L.; Andrei, A.S.; Rudi, K.; Balcázar, J.L.; Dragos, N.; et al. Abundance of antibiotics, antibiotic resistance genes and bacterial community composition in wastewater effluents from different Romanian hospitals. Environ. Pollut. 2017, 225, 304–315. [Google Scholar] [CrossRef]
- Lépesová, K.; Mackuľak, T.; Birošová, L. The prevalence of antibiotic resistant fecal coliform bacteria in wastewater treatment plants. In Nutrients, Wastewater and Leachate: Testing, Risks and Hazards; Nova Science Publishers: New York, NY, USA, 2018; pp. 57–88. ISBN 9978-1-53613-950-1. [Google Scholar]
- European Centre for Disease Prevention and Control. ECDC: Country Overview of Antimicrobial Consumption. Available online: https://www.ecdc.europa.eu/en/antimicrobial-consumption/database/country-overview (accessed on 25 October 2020).
- Birošová, L.; Mackuľak, T.; Bodík, I.; Ryba, J.; Škubák, J.; Grabic, R. Pilot study of seasonal occurrence and distribution of antibiotics and drug resistant bacteria in wastewater treatment plants in Slovakia. Sci. Total Environ. 2014, 490, 440–444. [Google Scholar] [CrossRef] [PubMed]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
- Azzam, M.I.; Ezzat, S.M.; Othman, B.A.; El-Dougdoug, K.A. Antibiotics resistance phenomenon and virulence ability in bacteria from water environment. Water Sci. 2017, 31, 109–121. [Google Scholar] [CrossRef]
- Qiao, M.; Ying, G.G.; Singer, A.C.; Zhu, Y.G. Review of antibiotic resistance in China and its environment. Environ. Int. 2018, 110, 160–172. [Google Scholar] [CrossRef]
- Conte, D.; Kasuko Palmeiro, J.; Da Silva Nogueira, K.; Rosa De Lima, M.T.; Cardoso, M.A.; Pontarolo, R.; Pontes, F.L.D.; Dalla-Costa, L.M. Characterization of CTX-M enzymes, quinolones resistance determinants, and antimicrobial residues from hospital sewage, wastewater treatment plant, and river water. Ecotoxicol. Environ. Saf. 2017, 136, 62–69. [Google Scholar] [CrossRef]
- Maheshwari, M.; Yaser, N.H.; Naz, S.; Fatima, M.; Ahmad, I. Emergence of ciprofloxacin-resistant extended-spectrum β-lactamase-producing enteric bacteria in hospital wastewater and clinical sources. J. Glob. Antimicrob. Resist. 2016, 5, 22–26. [Google Scholar] [CrossRef]
- Daoud, Z.; Salem-Sokhn, E.; Dahdouh, E.; Irani, J.; Matar, G.M.; Doron, S. Resistance and clonality in Escherichia coli and Klebsiella spp. and relationship with antibiotic consumption in major Lebanese hospital. J. Glob. Antimicrob. Resist. 2017, 11, 45–51. [Google Scholar] [CrossRef]
- Olowe, O.A.; Idris, O.J.; Taiwo, S.S. Prevalence of tet genes mediating tetracycline resistance in Escherichia coli clinical isolates in Osun State, Nigeria. Eur. J. Microbiol. Immunol. 2013, 3, 135–140. [Google Scholar] [CrossRef] [PubMed]
- Adesoji, A.T.; Ogunjobi, A.A.; Olatoye, I.O.; Douglas, D.R. Prevalence of tetracycline resistance genes among multi-drug resistant bacteria from selected water distribution systems in southwestern Nigeria. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Møller, T.S.B.; Overgaard, M.; Nielsen, S.S.; Bortolaia, V.; Sommer, M.O.A.; Guardabassi, L.; Olsen, J.E. Relation between tetR and tetA expression in tetracycline resistant Escherichia coli. BMC Microbiol. 2016, 16, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Varela, A.R.; Andre, S.; Nunes, O.C.; Manaia, C.M. Insights into the relationship between antimicrobial residues and bacterial populations in a hospital-urban wastewater treatment plant system. Water Res. 2014, 54, 327–336. [Google Scholar] [CrossRef] [PubMed]
- Chopra, I.; Roberts, M. Tetracycline antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 2001, 65, 232–260. [Google Scholar] [CrossRef]
- Yamashita, N.; Katakawa, Y.; Tanaka, H. Occurrence of antimicrobial resistance bacteria in the Yodo River basin, Japan and determination of beta-lactamases producing bacteria. Ecotoxicol. Environ. Saf. 2017, 143, 38–45. [Google Scholar] [CrossRef]
- European Committee on Antimicrobial Susceptibility Testing, EUCAST. EUCAST Guidelines for Detection of Resistance Mechanisms and Specific Resistances of Clinical and/or Epidemiological Importance; EUCAST: Växjö, Sweden, 2017; pp. 1–43. [Google Scholar]
- Thenmozhi, S.; Kannaiyan, M.; Sureshkumar, B.T.; Mickymaray, S. Antibiotic resistance mechanisms of ESBL producing Enterobacteriaceae in clinical field: A review. Int. J. Pure Appl. Biosci. 2014, 2, 207–224. [Google Scholar]
- Zhu, M.; Yang, G.; Li, A.; Zong, L.; Dong, Z.; Lu, J.; Zhang, K.; Cheng, C.; Chang, Q.; Wu, X.; et al. Identification and molecular characterization of Escherichia coli blaSHV genes in a Chinese teaching hospital. Gene 2017, 600, 29–35. [Google Scholar] [CrossRef]
- Seyedjavadi, S.S.; Goudarzi, M.; Sabzehali, F. Relation between blaTEM, blaSHV and blaCTX-M genes and acute urinary tract infections. J. Acute Dis. 2016, 5, 71–76. [Google Scholar] [CrossRef]
- Haller, L.; Chen, H.; Ng, C.H.; Hoang Le, T.; Koh, T.H.; Barkham, T.; Sobsey, M.; Gin, K.Y. Occurrence and characteristics of extended-spectrum β-lactamase- and carbapenemases-producing bacteria from hospital effluents in Singapore. Sci. Total Environ. 2018, 615, 1119–1125. [Google Scholar] [CrossRef]
- Haghighatpanah, M.; Mozzafari Nejad, A.S.; Mojtahedi, A.; Amirmozafari, N.; Zeighami, H. Detection of extended spectrum β-lactamase (ESBL) and plasmid-borne blaCTX-M and blaTEM genes among clinical strains of Escherichia coli isolated from patients in the north of Iran. J. Glob. Antimicrob. Resist. 2016, 7, 110–113. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Xu, J.; He, F. Draft genome sequence of an NDM-5, CTX-M-15 and OXA-1 co-producing Escherichia coli ST167 clinical strain isolated from a urine sample. J. Glob. Antimicrob. Resist. 2018, 14, 284–286. [Google Scholar] [CrossRef] [PubMed]
- Khatoon, Z.; McTiernam, C.H.D.; Suuronen, E.J.; Mah, T.F.; Alarcon, E.I. Bacterial biofilm formation on implantable devices and approaches to its treatment and prevention. Heliyon 2018, 4, 1–36. [Google Scholar] [CrossRef]
| Hospital (SR) | Number of Beds | Equipment Type | Recipient |
| Psychiatric Clinic in Oščadnica (PC) | outpatient care | River Oščadničanka | |
| National Cancer Institute of St. Elizabeth (NCISE) | 198 | hospital with outpatient care | Public sewerage network |
| University Hospital in Ružinov | 875 | hospital with outpatient care | |
| University Hospital of Academician Ladislav Dérer | 635 | hospital with outpatient care | |
| Children´s Faculty Hospital | 397 | hospital with outpatient care | |
| Hospital in Malacky | 222 | hospital with outpatient care | |
| Hospital (CZ) | Number of beds | Equipment type | Recipient |
| Policlinic in Rožnov pod Radhoštěm | ambulance | Public sewerage network | |
| Hospital in Vsetín | 350 | hospital with outpatient care | |
| Hospital in Valašské Meziříčí (HVM) | 190 | hospital with outpatient care | |
| Hospice Citadela | 450 | palliative and outpatient care |
| Primer | Sequence (5’ to 3’ Direction) | Primer Volume (μL) | Amplicon Size (bp) | Source | |
|---|---|---|---|---|---|
| Multiplex I | TEM_fwd | CATTTCCGTGTCGCCCTTATTC | 1 | 800 | [21] |
| TEM_rev | CGTTCATCCATAGTTGCCTGAC | 1 | |||
| SHV_fwd | AGCCGCTTGAGCAAATTAAAC | 1 | 713 | ||
| SHV_rev | ATCCCGCAGATAAATCACCAC | 1 | |||
| OXA_fwd | GGCACCAGATTCAACTTTCAAG | 1 | 564 | ||
| OXA_rev | GACCCCAAGTTTCCTGTAAGTG | 1 | |||
| Multiplex II | CTXMGp1_fwd | TTAGGAARTGTGCCGCTGYA a | 0.25 | 688 | |
| CTXMGp1_rev | CGATATCGTTGGTGGTRCCAT a | 0.25 | |||
| CTXMGp2_fwd | CGTTAACGGCACGATGAC | 0.25 | 404 | ||
| CTXMGp2_rev | CGATATCGTTGGTGGTRCCAT a | 0.25 | |||
| Single PCR | CTXM8/25_fwd | AACRCRCAGACGCTCTAC a | 0.25 | 326 | |
| CTXM8/25_rev | TCGAGCCGGAASGTGTYAT a | 0.25 | |||
| CTXM15_fwd | CACACGTGGAATTTAGGGACT | 1 | 995 | [22] | |
| CTXM15_rev | GCCGTCTAAGGCGATAAACA | 1 | |||
| Tet Multiplex | TetA_fwd | GCTACATCCTGCTTGCCTTC | 0.5 | 210 | [23] |
| TetA_rev | CATAGATCGCCGTGAAGAGC | 0.5 | |||
| TetE_fwd | AAACCACATCCTCCATACGC | 0.5 | 278 | ||
| TetE_rev | AAATAGGCCACAACCGTCAG | 0.5 |
| CFB (log CFU·mL−1) | EC (log CFU·mL−1) | |
|---|---|---|
| Total | ND-7.18 ± 0.32 | ND-4.49 ± 0.15 |
| AMP (EU) | ND-7.17 ± 0.41 | ND-4.37 ± 0.31 |
| GEN (EU) | ND-6.59 ± 0.18 | ND-3.81 ± 0.16 |
| CIP (EU) | ND-6.39 ± 0.21 | ND-3.69 ± 0.09 |
| CMP (EU) | ND-5.41 ± 0.14 | ND-2.86 ± 0.06 |
| AMP (US) | ND-7.17 ± 0.12 | ND-4.35 ± 0.11 |
| GEN (US) | ND-6.45 ± 0.22 | ND-3.63 ± 0.08 |
| CIP (US) | ND-5.79 ± 0.17 | ND-3.59 ± 0.14 |
| CMP (US) | ND-5.00 ± 0.25 | ND-2.62 ± 0.19 |
| TET (US) | ND-5.86 ± 0.09 | ND-3.73 ± 0.07 |
| Number of resistant isolates | ||||||
|---|---|---|---|---|---|---|
| E. coli | Citrobacter spp. | L. amnigena | E. cloacae | Klebsiella spp. | ||
| Number of isolates | 19 | 6 | 6 | 2 | 2 | |
| Antibiotics | AMP | 19 | INR | 6 | INR | INR |
| AMS | 14 | - | - | - | 2 | |
| CFZ | 13 | - | - | - | 2 | |
| CXM | 10 | - | - | - | 2 | |
| AZT | 7 | - | - | - | 1 | |
| GEN | 16 | 6 | 2 | 1 | 2 | |
| AMK | 7 | - | - | - | 0 | |
| COL | 3 | - | - | - | 1 | |
| T/S | 8 | - | - | - | 2 | |
| CIP | 9 | 5 | 5 | 1 | 2 | |
| CMP | 7 | 5 | 2 | 1 | 1 | |
| TET | 14 | 6 | 5 | 2 | 2 | |
| PIP | 17 | - | - | - | 2 | |
| PIT | 6 | - | - | - | 1 | |
| CTX | 9 | - | - | - | 1 | |
| CAZ | 12 | 6 | 6 | 2 | 1 | |
| CPZ | 8 | - | - | - | 2 | |
| CPS | - | - | - | - | - | |
| CEP | 12 | - | - | - | 1 | |
| MER | 0 | 0 | 0 | 0 | 0 | |
| ERT | 3 | - | - | - | 0 | |
| TGC | 0 | - | - | - | 0 | |
| NET | 14 | - | - | - | 1 | |
| TOB | 15 | - | - | - | 1 | |
| % MDR | 79 | 100 | 100 | 100 | 100 | |
| Isolate | Phenotype | ESBLs | Efflux Pumps | tet Genes | |
|---|---|---|---|---|---|
| O1 | E. coli | - | TEM,OXA,CTX-M-1 | - | - |
| O2 | E. coli | - | TEM,CTX-M-2,CTX-M-8/25 | - | tetA |
| O3 | E. coli | ESBL | SHV,CTX-M-2,CTX-M-8/25 | - | tetA |
| O4 | E. coli | ESBL | SHV,CTX-M-2,CTX-M-8/25 | - | - |
| O5 | E. coli | ESBL | SHV,CTX-M-2 | + | - |
| O6 | E. coli | ESBL | SHV,CTX-M-2,CTX-M-8/25 | + | tetA,tetE |
| O7 | E. coli | ESBL | SHV,CTX-M-2,CTX-M-8/25 | + | tetA,tetE |
| O8 | E. coli | ESBL | SHV,CTX-M-2,CTX-M-8/25 | + | tetA,tetE |
| O9 | E. coli | ESBL | CTX-M-1,CTX-M-2,CTX-M-8/25 | + | tetA,tetE |
| O10 | E. coli | AmpC | SHV,CTX-M-2,CTX-M-8/25 | + | tetA,tetE |
| O11 | L. amnigena | ESBL | TEM, SHV,OXA,CTX-M-1,CTX-M-2,CTX-M-15 | + | tetA,tetE |
| O12 | E. cloacae | ESBL | - | - | - |
| O13 | L. amnigena | - | - | - | - |
| O14 | E. cloacae | - | - | - | - |
| O15 | L. amnigena | - | CTX-M-2,CTX-M-8/25 | + | tetA |
| O16 | L. amnigena | - | CTX-M-1,CTX-M-2,CTX-M-8/25 | - | tetA |
| O17 | L. amnigena | ESBL + AmpC | - | - | - |
| O18 | L. amnigena | ESBL | - | - | - |
| P1 | E. coli | - | TEM,CTX-M-8/25 | - | - |
| P2 | E. coli | - | TEM,SHV | + | - |
| P3 | E. coli | - | - | + | - |
| P4 | E. coli | - | TEM | + | tetA |
| P5 | E. coli | - | TEM,CTX-M-8/25 | + | tetA |
| P6 | E. coli | - | - | + | tetA |
| P7 | E. coli | - | TEM,CTX-M-1 | + | tetA |
| P8 | E. coli | - | TEM,CTX-M-1 | + | tetA |
| P9 | E. coli | - | TEM,OXA,CTX-M-1 | + | tetA |
| P10 | C. freundii | ESBL | TEM,OXA,CTX-M-1,CTX-M-2,CTX-M-8/25,CTX-M-15 | + | tetA |
| P11 | C. freundii | - | TEM,OXA,CTX-M-1,CTX-M-2,CTX-M-8/25,CTX-M-15 | - | tetA,tetE |
| P12 | C. freundii | ESBL | TEM,OXA,CTX-M-1,CTX-M-2,CTX-M-8/25,CTX-M-15 | - | tetA,tetE |
| P13 | C. freundii | ESBL | TEM,OXA,CTX-M-1,CTX-M-2,CTX-M-8/25,CTX-M-15 | - | tetA,tetE |
| P14 | C. freundii | ESBL | TEM,OXA,CTX-M-1,CTX-M-2,CTX-M-8/25,CTX-M-15 | - | tetA,tetE |
| P15 | C. gillenii | - | TEM,OXA,CTX-M-8/25 | - | - |
| P16 | K. variicola | - | TEM,SHV,OXA,CTX-M-1,CTX-M-2,CTX-M-15 | + | tetA,tetE |
| P17 | K. pneumoniae | - | TEM,SHV,OXA,CTX-M-1 | - | tetA |
| Intensity of Biofilm Production | Number of Antibiotic Resistant Isolates | ||||
|---|---|---|---|---|---|
| E. coli (19) | Citrobacter spp. (6) | Lelliottia amnigena (6) | E. cloacae (2) | Klebsiella spp. (2) | |
| low | 0 | 0 | 0 | 0 | 0 |
| medium | 7 | 0 | 0 | 0 | 0 |
| strong | 9 | 1 | 6 | 2 | 1 |
| very strong | 3 | 5 | 0 | 0 | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lépesová, K.; Olejníková, P.; Mackuľak, T.; Cverenkárová, K.; Krahulcová, M.; Bírošová, L. Hospital Wastewater—Important Source of Multidrug Resistant Coliform Bacteria with ESBL-Production. Int. J. Environ. Res. Public Health 2020, 17, 7827. https://doi.org/10.3390/ijerph17217827
Lépesová K, Olejníková P, Mackuľak T, Cverenkárová K, Krahulcová M, Bírošová L. Hospital Wastewater—Important Source of Multidrug Resistant Coliform Bacteria with ESBL-Production. International Journal of Environmental Research and Public Health. 2020; 17(21):7827. https://doi.org/10.3390/ijerph17217827
Chicago/Turabian StyleLépesová, Kristína, Petra Olejníková, Tomáš Mackuľak, Klára Cverenkárová, Monika Krahulcová, and Lucia Bírošová. 2020. "Hospital Wastewater—Important Source of Multidrug Resistant Coliform Bacteria with ESBL-Production" International Journal of Environmental Research and Public Health 17, no. 21: 7827. https://doi.org/10.3390/ijerph17217827
APA StyleLépesová, K., Olejníková, P., Mackuľak, T., Cverenkárová, K., Krahulcová, M., & Bírošová, L. (2020). Hospital Wastewater—Important Source of Multidrug Resistant Coliform Bacteria with ESBL-Production. International Journal of Environmental Research and Public Health, 17(21), 7827. https://doi.org/10.3390/ijerph17217827

