The Synergistic Effect of Zuogui Pill and Eldecalcitol on Improving Bone Mass and Osteogenesis in Type 2 Diabetic Osteoporosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animals and Drug Administration
2.3. Blood Glucose Assay and Serum Biochemical Analysis
2.4. Animal Euthanasia and Sample Preparation
2.5. Micro-Computed Tomography (CT) Scan
2.6. Hematoxylin and Eosin (HE) Staining
2.7. Masson Staining
2.8. Immunohistochemical and Tartrate-Resistant Acid Phosphatase (TRAP) Staining
2.9. Cell Culture, Acquisition of Medicated Serum, and Osteogenic Differentiation Induction
2.10. Alkaline Phosphatase and Alizarin Red (AR) Staining
2.11. Immunofluorescence Staining
2.12. Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR) Analysis
2.13. Western Blotting
2.14. Statistical Analysis
3. Results
3.1. ZGP and ED-71 Synergistically Reduced Blood Glucose Levels in Diabetic Mice
3.2. ZGP and ED-71 Synergistically Increased Bone Mass, Improved Osteoblasts, and Inhibited Osteoclasts in Diabetic Mice
3.3. The ZGP and ED-71 Combination Promoted Osteogenic Differentiation of the MC3T3-E1 Cells
3.4. ZGP Synergized with ED-71 to Promote the Osteogenic Differentiation of MC3T3-E1 Cells through the PI3K–AKT Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Seifu, Y.; Tsegaw, D.; Haji, Y.; Ejeso, A. Prevalence and Associated Factors of Diabetes Mellitus Among Adult Population in Hawassa Zuria Woreda, Sidama Region, Ethiopia. Diabetes Metab. Syndr. Obes. Targets Ther. 2020, 13, 4571–4579. [Google Scholar] [CrossRef] [PubMed]
- Damanik, J.; Yunir, E. Type 2 Diabetes Mellitus and Cognitive Impairment. Acta Med. Indones. 2021, 53, 213–220. [Google Scholar] [PubMed]
- Ke, C.; Narayan, K.M.V.; Chan, J.C.N.; Jha, P.; Shah, B.R. Pathophysiology, phenotypes and management of type 2 diabetes mellitus in Indian and Chinese populations. Nat. Rev. Endocrinol. 2022, 18, 413–432. [Google Scholar] [CrossRef] [PubMed]
- Sheu, A.; Greenfield, J.R.; White, C.P.; Center, J.R. Contributors to impaired bone health in type 2 diabetes. Trends Endocrinol. Metab. 2023, 34, 34–48. [Google Scholar] [CrossRef] [PubMed]
- Mohsin, S.; Baniyas, M.M.; AlDarmaki, R.S.; Tekes, K.; Kalász, H.; Adeghate, E.A. An update on therapies for the treatment of diabe-tes-induced osteoporosis. Expert Opin. Biol. Ther. 2019, 19, 937–948. [Google Scholar] [CrossRef]
- Oei, L.; Zillikens, M.C.; Dehghan, A.; Buitendijk, G.H.; Castaño-Betancourt, M.C.; Estrada, K.; Stolk, L.; Oei, E.H.; van Meurs, J.B.; Janssen, J.A.; et al. High bone mineral density and fracture risk in type 2 diabetes as skeletal complications of inadequate glucose control: The Rotterdam Study. Diabetes Care 2013, 36, 1619–1628. [Google Scholar] [CrossRef]
- Russo, V.; Chen, R.; Armamento-Villareal, R. Hypogonadism, Type-2 Diabetes Mellitus, and Bone Health: A Narrative Review. Front. Endocrinol. 2020, 11, 607240. [Google Scholar] [CrossRef]
- Chiodini, I.; Catalano, A.; Gennari, L.; Gaudio, A. Osteoporosis and Fragility Fractures in Type 2 Diabetes. J. Diabetes Res. 2020, 2020, 9342696. [Google Scholar] [CrossRef]
- Leite Duarte, M.E.; da Silva, R.D. Histomorphometric analysis of the bone tissue in patients with non-insulin-dependent diabetes (DMNID). Rev. Hosp. Clin. 1996, 51, 7–11. [Google Scholar]
- Hygum, K.; Starup-Linde, J.; Langdahl, B.L. Diabetes and bone. Osteoporos. Sarcopenia 2019, 5, 29–37. [Google Scholar] [CrossRef]
- Romero-Díaz, C.; Duarte-Montero, D.; Gutiérrez-Romero, S.A.; Mendivil, C.O. Diabetes and Bone Fragility. Diabetes Ther. 2021, 12, 71–86. [Google Scholar] [CrossRef] [PubMed]
- Ebeling, P.R.; Nguyen, H.H.; Aleksova, J.; Vincent, A.J.; Wong, P.; Milat, F. Secondary Osteoporosis. Endocr. Rev. 2022, 43, 240–313. [Google Scholar] [CrossRef] [PubMed]
- Dong, K.; Hao, P.; Xu, S.; Liu, S.; Zhou, W.; Yue, X.; Rausch-Fan, X.; Liu, Z. Alpha-Lipoic Acid Alleviates High-Glucose Suppressed Osteogenic Differ-entiation of MC3T3-E1 Cells via Antioxidant Effect and PI3K/Akt Signaling Pathway. Cell. Physiol. Biochem. 2017, 42, 1897–1906. [Google Scholar] [CrossRef] [PubMed]
- Medeiros, C.; Wallace, J.M. High glucose-induced inhibition of osteoblast like MC3T3-E1 differentiation promotes mitochondrial perturbations. PLoS ONE 2022, 17, e0270001. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Zhang, Z.; Liu, Y.; Lu, J.; Qi, X.; Fang, C.; Zhou, C. Efficacy and safety of Zuogui Pill in treating osteoporosis: Study protocol of a systematic review. Medicine 2019, 98, e13936. [Google Scholar] [CrossRef]
- Yin, H.; Wang, S.; Zhang, Y.; Wu, M.; Wang, J.; Ma, Y. Zuogui Pill improves the dexamethasone-induced osteoporosis progression in zebrafish larvae. Biomed. Pharmacother. 2018, 97, 995–999. [Google Scholar] [CrossRef]
- Jia, Y.; Sun, J.; Zhao, Y.; Tang, K.; Zhu, R.; Zhao, W.; Wang, R.; Zhang, Y.; Lin, N.; Chen, W. Chinese patent medicine for osteoporosis: A systematic review and meta-analysis. Bioengineered 2022, 13, 5581–5597. [Google Scholar] [CrossRef]
- Liu, B.; Gan, X.; Zhao, Y.; Gao, J.; Yu, H. Inhibition of HMGB1 reduced high glucose-induced BMSCs apoptosis via activation of AMPK and regulation of mitochondrial functions. J. Physiol. Biochem. 2021, 77, 227–235. [Google Scholar] [CrossRef]
- Fu, X.; Lian, Q.; Zhang, B.; Teng, X.; Chen, Y.; Qu, Y.; Cheng, Z.; Guo, L. Scanning Probe Microscopy Bone Marrow Determination of Steogenic Differentiation of Mesenchymal Stem Cells. Contrast Media Mol. Imaging 2022, 2022, 6483087. [Google Scholar] [CrossRef]
- Xu, L.-X.; Fang, W.; Guo, D.-M. Effects of zuogui pill on the gene expressions of Type-II collagen and proteoglycan during the differentiation of mesenchymal stem cells towards chondrocytes. Zhongguo Zhong Xi Yi Jie He Za Zhi Chin. J. Integr. Tradit. West. Med. 2011, 31, 1662–1668. [Google Scholar]
- Yang, A.; Yu, C.; You, F.; He, C.; Li, Z. Mechanisms of Zuogui Pill in Treating Osteoporosis: Perspective from Bone Marrow Mes-enchymal Stem Cells. Evid. Based Complement Alternat. Med. 2018, 2018, 3717391. [Google Scholar] [CrossRef]
- Liu, M.J.; Li, Y.; Pan, J.H.; Liu, H.; Wang, S.J.; Teng, J.R.; Zhao, H.Y.; Ju, D.H. Effects of zuogui pill (see text) on Wnt singal transduction in rats with glucocorticoid-induced osteoporosis. J. Tradit. Chin. Med. 2011, 31, 98–102. [Google Scholar] [CrossRef]
- Wang, Y.; Feng, Q.; Niu, X.; Liu, X.; Xu, K.; Yang, X.; Wang, H.; Li, Q. The Therapeutic Effect of Zuogui Wan in Gestational Diabetes Mellitus Rats. J. Anal. Methods Chem. 2014, 2014, 737961. [Google Scholar] [CrossRef]
- Bai, T.; Feng, Q.; Zhu, S.; Niu, X.; Wang, Y.; Xu, K. Zuogui Wan rescues the high-glucose-induced damaging effects on early embryo development. BMC Complement. Altern. Med. 2016, 16, 163. [Google Scholar] [CrossRef]
- Wang, Y.; Feng, Q.; Niu, X.; Xu, K.; Wang, Y.; Wang, J.; Li, Q.; Mao, Y.; Gao, S. The Preventive Effect of Zuogui Wan on Offspring Rats’ Impaired Glucose Tolerance Whose Mothers Had Gestational Diabetes Mellitus. Evid. Based Complement. Altern. Med. 2016, 2016, 9417362. [Google Scholar] [CrossRef]
- Hernigou, P.; Sitbon, J.; Dubory, A.; Auregan, J.C. Vitamin D history part III: The “modern times”-new questions for orthopaedic practice: Deficiency, cell therapy, osteomalacia, fractures, supplementation, infections. Int. Orthop. 2019, 43, 1755–1771. [Google Scholar] [CrossRef]
- Carmeliet, G.; Dermauw, V.; Bouillon, R. Vitamin D signaling in calcium and bone homeostasis: A delicate balance. Best Pract. Res. Clin. Endocrinol. Metab. 2015, 29, 621–631. [Google Scholar] [CrossRef]
- Zhang, J.; Li, Y.; Lai, D.; Lu, D.; Lan, Z.; Kang, J.; Xu, Y.; Cai, S. Vitamin D Status Is Negatively Related to Insulin Resistance and Bone Turnover in Chinese Non-Osteoporosis Patients with Type 2 Diabetes: A Retrospective Cross-Section Research. Front. Public Health 2022, 9, 727132. [Google Scholar] [CrossRef]
- Suzuki, T. Update on recent progress in vitamin D research. EldecalcitolR and Fall Prevention. Clin. Calcium 2017, 27, 1595–1600. [Google Scholar]
- De Freitas, P.H.L.; Hasegawa, T.; Takeda, S.; Sasaki, M.; Tabata, C.; Oda, K.; Li, M.; Saito, H.; Amizuka, N. Eldecalcitol, a second-generation vitamin D analog, drives bone minimodeling and reduces osteoclastic number in trabecular bone of ovariectomized rats. Bone 2011, 49, 335–342. [Google Scholar] [CrossRef]
- Rong, X.; Kou, Y.; Zhang, Y.; Yang, P.; Tang, R.; Liu, H.; Li, M. ED-71 Prevents Glucocorticoid-Induced Osteoporosis by Regulating Osteoblast Differentiation via Notch and Wnt/β-Catenin Pathways. Drug Des. Dev. Ther. 2022, 16, 3929–3946. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Liu, S.; Yang, P.; Kou, Y.; Li, C.; Liu, H.; Li, M. Exendin-4 and eldecalcitol synergistically promote osteogenic differentiation of bone marrow mesenchymal stem cells through M2 macrophages polarization via PI3K/AKT pathway. Stem Cell Res. Ther. 2022, 13, 113. [Google Scholar] [CrossRef] [PubMed]
- Sakai, S.; Hongo, H.; Yamamoto, T.; Hasegawa, T.; Takeda, S.; Saito, H.; Endo, K.; Yogo, K.; Amizuka, N. Sequential Treatment with Eldecalcitol After PTH Im-proves Bone Mechanical Properties of Lumbar Spine and Femur in Aged Ovariectomized Rats. Calcif. Tissue Int. 2019, 104, 251–261. [Google Scholar] [CrossRef] [PubMed]
- Xia, B.; Xu, B.; Sun, Y.; Xiao, L.; Pan, J.; Jin, H.; Tong, P. The effects of Liuwei Dihuang on canonical Wnt/β-catenin signaling pathway in osteoporosis. J. Ethnopharmacol. 2014, 153, 133–141. [Google Scholar] [CrossRef]
- Wang, N.; Liu, X.; Tang, Z.; Wei, X.; Dong, H.; Liu, Y.; Wu, H.; Wu, Z.; Li, X.; Ma, X.; et al. Increased BMSC exosomal miR-140-3p alleviates bone degradation and promotes bone restoration by targeting Plxnb1 in diabetic rats. J. Nanobiotechnol. 2022, 20, 97. [Google Scholar] [CrossRef]
- Li, Y.; Wang, X. Chrysin Attenuates High Glucose-Induced BMSC Dysfunction via the Activation of the PI3K/AKT/Nrf2 Signaling Pathway. Drug Des. Dev. Ther. 2022, 16, 165–182. [Google Scholar] [CrossRef]
- Hofbauer, L.C.; Busse, B.; Eastell, R.; Ferrari, S.; Frost, M.; Müller, R.; Burden, A.M.; Rivadeneira, F.; Napoli, N.; Rauner, M. Bone fragility in diabetes: Novel concepts and clinical im-plications. Lancet Diabetes Endocrinol. 2022, 10, 207–220. [Google Scholar] [CrossRef]
- Wang, Y.-H.; Yin, L.-T.; Yang, H.; Li, X.-L.; Wu, K.-G. Hypoglycemic and anti-depressant effects of Zuogui Jiangtang Jieyu formulation in a model of unpredictable chronic mild stress in rats with diabetes mellitus. Exp. Ther. Med. 2014, 8, 281–285. [Google Scholar] [CrossRef]
- Xu, Y.X.Z.; Xi, S.; Qian, X. Evaluating Traditional Chinese Medicine and Herbal Products for the Treatment of Gestational Diabetes Mellitus. J. Diabetes Res. 2019, 2019, 9182595. [Google Scholar] [CrossRef]
- Wang, H.; Gang, H.; Zhou, S.; Liu, L.; Ding, T.; Gui, Z.; Chu, W. Liuwei Dihuang exhibits antidiabetic effects through inhibiting α-amylase and α-glucosidase. Med. Sci. 2018, 34, 4–7. [Google Scholar] [CrossRef]
- Sun, L.; Di, Y.M.; Lu, C.; Guo, X.; Tang, X.; Zhang, A.L.; Xue, C.C.; Fan, G. Additional Benefit of Chinese Medicine Formulae Including Dioscoreae rhizome (Shanyao) for Diabetes Mellitus: Current State of Evidence. Front. Endocrinol. 2020, 11, 553288. [Google Scholar] [CrossRef]
- Samie, K.A.; Tabandeh, M.R.; Afrough, M. Betaine ameliorates impaired steroidogenesis and apoptosis in mice granulosa cells induced by high glucose concentration. Syst. Biol. Reprod. Med. 2020, 66, 400–409. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, Y.; Sheng, H.; Liang, C.; Liu, H.; Guerrero, J.A.M.; Lu, Z.; Mao, W.; Dai, Z.; Liu, X.; et al. Hyperoside Suppresses Renal Inflammation by Regulating Macrophage Polarization in Mice with Type 2 Diabetes Mellitus. Front. Immunol. 2021, 12, 733808. [Google Scholar] [CrossRef]
- Zhang, Y.; Tan, H.; Tang, J.; Li, J.; Chong, W.; Hai, Y.; Feng, Y.; Lunsford, L.D.; Xu, P.; Jia, D.; et al. Effects of Vitamin D Supplementation on Prevention of Type 2 Diabetes in Patients with Prediabetes: A Systematic Review and Meta-analysis. Diabetes Care 2020, 43, 1650–1658. [Google Scholar] [CrossRef]
- Bornstedt, M.E.; Gjerlaugsen, N.; Olstad, O.K.; Berg, J.P.; Bredahl, M.K.; Thorsby, P.M. Vitamin D metabolites influence expression of genes concerning cellular viability and function in insulin producing β-cells (INS1E). Gene 2020, 746, 144649. [Google Scholar] [CrossRef]
- Rathinavelu, S.; Guidry-Elizondo, C.; Banu, J. Molecular Modulation of Osteoblasts and Osteoclasts in Type 2 Diabetes. J. Diabetes Res. 2018, 2018, 6354787. [Google Scholar] [CrossRef]
- Gennari, L.; Merlotti, D.; Valenti, R.; Ceccarelli, E.; Ruvio, M.; Pietrini, M.G.; Capodarca, C.; Franci, M.B.; Campagna, M.S.; Calabrò, A.; et al. Circulating Sclerostin Levels and Bone Turnover in Type 1 and Type 2 Diabetes. J. Clin. Endocrinol. Metab. 2012, 97, 1737–1744. [Google Scholar] [CrossRef]
- Liu, L.; Yang, F.; Li, W.; Zhang, K.; Liu, Z.; Cheng, Y.; Yin, J.; Sun, Y. Effect of Zuogui pill and Yougui pill on osteoporosis: A randomized controlled trial. J. Tradit. Chin. Med. 2018, 38, 33–42. [Google Scholar]
- Ma, X.; He, L. The intervention effect of zuogui pill on chronic kidney disease-mineral and bone disorder regulatory factor. Biomed. Pharmacother. 2018, 106, 54–60. [Google Scholar] [CrossRef]
- Takeda, S.; Saito, M.; Sakai, S.; Yogo, K.; Marumo, K.; Endo, K. Eldecalcitol, an Active Vitamin D3 Derivative, Prevents Trabecular Bone Loss and Bone Fragility in Type I Diabetic Model Rats. Calcif. Tissue Int. 2017, 101, 433–444. [Google Scholar] [CrossRef]
- Aihara, S.; Yamada, S.; Oka, H.; Kamimura, T.; Nakano, T.; Tsuruya, K.; Harada, A. Hypercalcemia and acute kidney injury induced by eldecalcitol in patients with osteoporosis: A case series of 32 patients at a single facility. Ren. Fail. 2019, 41, 88–97. [Google Scholar] [CrossRef] [PubMed]
- An, Y.; Zhang, H.; Wang, C.; Jiao, F.; Xu, H.; Wang, X.; Luan, W.; Ma, F.; Ni, L.; Tang, X.; et al. Activation of ROS/MAPKs/NF-κB/NLRP3 and inhibition of efferocytosis in osteoclast-mediated diabetic osteoporosis. FASEB J. 2019, 33, 12515–12527. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Xu, J.; Li, S.; Cui, H.; Zhang, G.; Ni, X.; Wang, J. S-Equol enhances osteoblastic bone formation and prevents bone loss through OPG/RANKL via the PI3K/Akt pathway in streptozotocin-induced diabetic rats. Front. Nutr. 2022, 9, 986192. [Google Scholar] [CrossRef] [PubMed]
- Vimalraj, S. Alkaline phosphatase: Structure, expression and its function in bone mineralization. Gene 2020, 754, 144855. [Google Scholar] [CrossRef]
- Jiating, L.; Buyun, J.; Yinchang, Z. Role of Metformin on Osteoblast Differentiation in Type 2 Diabetes. BioMed Res. Int. 2019, 2019, 9203934. [Google Scholar] [CrossRef]
- Mizokami, A.; Kawakubo-Yasukochi, T.; Hirata, M. Osteocalcin and its endocrine functions. Biochem. Pharmacol. 2017, 132, 1–8. [Google Scholar] [CrossRef]
- Viguet-Carrin, S.; Garnero, P.; Delmas, P.D. The role of collagen in bone strength. Osteoporos. Int. 2006, 17, 319–336. [Google Scholar] [CrossRef]
- Tanaka, K.; Kanazawa, I.; Yamaguchi, T.; Yano, S.; Kaji, H.; Sugimoto, T. Active vitamin D possesses beneficial effects on the inter-action between muscle and bone. Biochem. Biophys. Res. Commun. 2014, 450, 482–487. [Google Scholar] [CrossRef]
- Guntur, A.R.; Rosen, C.J. The skeleton: A multi-functional complex organ. New insights into osteoblasts and their role in bone formation: The central role of PI3Kinase. J. Endocrinol. 2011, 211, 123–130. [Google Scholar] [CrossRef]
- Tian, L.; Ding, L.; Wang, G.; Guo, Y.; Zhao, Y.; Wei, Y.; Li, X.; Zhang, W.; Mi, J.; Li, X. Qizhi Kebitong Formula Ameliorates Streptozocin-Induced Diabetic Osteoporosis through Regulating the PI3K/Akt/NF-κB Pathway. BioMed Res. Int. 2022, 2022, 4469766. [Google Scholar] [CrossRef]
- Marie, P.J. Signaling Pathways Affecting Skeletal Health. Curr. Osteoporos. Rep. 2012, 10, 190–198. [Google Scholar] [CrossRef]
- Xing, Q.; Feng, J.; Zhang, X. Glucocorticoids suppressed osteoblast differentiation by decreasing Sema3A expression via the PIK3/Akt pathway. Exp. Cell Res. 2021, 403, 112595. [Google Scholar] [CrossRef]
- Mo, L.; Wang, Z.; Huang, H.; Li, J.; Ma, C.; Zhang, J.; Huang, F.; He, W.; Liu, Y.; Zhou, C. Integrated Analysis of Crucial Genes and miRNAs Associated with Oste-oporotic Fracture of Type 2 Diabetes. BioMed Res. Int. 2022, 2022, 3921570. [Google Scholar] [CrossRef]
- Jiang, Y.; Luo, W.; Wang, B.; Yi, Z.; Gong, P.; Xiong, Y. 1α,25-Dihydroxyvitamin D3 ameliorates diabetes-induced bone loss by attenuating FoxO1-mediated autophagy. J. Biol. Chem. 2021, 296, 100287. [Google Scholar] [CrossRef]
- Xie, X.; Hu, L.; Mi, B.; Panayi, A.C.; Xue, H.; Hu, Y.; Liu, G.; Chen, L.; Yan, C.; Zha, K.; et al. SHIP1 Activator AQX-1125 Regulates Osteogenesis and Osteoclastogenesis Through PI3K/Akt and NF-κb Signaling. Front. Cell Dev. Biol. 2022, 10, 826023. [Google Scholar] [CrossRef]






| Gene | Forward | Reverse |
|---|---|---|
| OCN | CAGAACAGACAAGTCCCACACAG | TCAGCAGAGTGAGCAGAAAGAT |
| RUNX2 | TACGACCATGAGATTGGCAGTGA | TATAGGATCTGGGTGCAGGCTGA |
| ALP | GCGACCACTTGAGCAAACATC | CGGCTGATTGGCTTCTTCTT |
| GAPDH | GCACCGTCAAGGCTGAGAAC | TGGTGAAGACGCCAGTGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, T.; Liu, T.; Kou, Y.; Rong, X.; Meng, L.; Cui, Y.; Gao, R.; Hu, S.; Li, M. The Synergistic Effect of Zuogui Pill and Eldecalcitol on Improving Bone Mass and Osteogenesis in Type 2 Diabetic Osteoporosis. Medicina 2023, 59, 1414. https://doi.org/10.3390/medicina59081414
Shi T, Liu T, Kou Y, Rong X, Meng L, Cui Y, Gao R, Hu S, Li M. The Synergistic Effect of Zuogui Pill and Eldecalcitol on Improving Bone Mass and Osteogenesis in Type 2 Diabetic Osteoporosis. Medicina. 2023; 59(8):1414. https://doi.org/10.3390/medicina59081414
Chicago/Turabian StyleShi, Tuo, Ting Liu, Yuying Kou, Xing Rong, Lingxiao Meng, Yajun Cui, Ruihan Gao, Sumin Hu, and Minqi Li. 2023. "The Synergistic Effect of Zuogui Pill and Eldecalcitol on Improving Bone Mass and Osteogenesis in Type 2 Diabetic Osteoporosis" Medicina 59, no. 8: 1414. https://doi.org/10.3390/medicina59081414
APA StyleShi, T., Liu, T., Kou, Y., Rong, X., Meng, L., Cui, Y., Gao, R., Hu, S., & Li, M. (2023). The Synergistic Effect of Zuogui Pill and Eldecalcitol on Improving Bone Mass and Osteogenesis in Type 2 Diabetic Osteoporosis. Medicina, 59(8), 1414. https://doi.org/10.3390/medicina59081414

