Epigallocatechin Gallate in Camellia sinensis Ameliorates Skin Aging by Reducing Mitochondrial ROS Production
Abstract
1. Introduction
2. Results
2.1. Effect of C. sinensis Extract on Reducing Mitochondrial ROS Levels
2.2. C. sinensis Extract Selectively Kills Senescent Fibroblasts by Inducing Apoptosis
2.3. C. sinensis Extract Decreases Mitochondrial ROS Production by Enhancing OXPHOS Efficiency
2.4. Senescence-Associated Phenotypes Are Ameliorated by C. sinensis Extract
2.5. C. sinensis Extract Improves Skin Aging Through Collagen Synthesis and Remodeling
2.6. C. sinensis Extract Improves Skin Aging Through Enhancing Cell-Induced Collagen Contractility
2.7. C. sinensis Extract Restores the Skin Barrier Function
2.8. Identification of Epigallocatechin Gallate (EGCG) as the Active Ingredient in C. sinensis Extract
2.9. EGCG, the Active Ingredient in C. sinensis Extract, Exhibits Similar Effects to C. sinensis Extract
2.10. C. Sinensis Extracts and EGCG Reverse Skin Aging in Artificial Skin Models
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Preparation of Extract Powder
4.3. Flow Cytometric Analysis of Reactive Oxygen Species (ROS), Mitochondrial Mass, and Lipofuscin
4.4. Cell Proliferation Assay
4.5. Determination of Cell Viability
4.6. Apoptosis Assay
4.7. Measurement of Oxygen Consumption Rate (OCR)
4.8. Measurement of Mitochondrial Membrane Potential (MMP) and Lipofuscin
4.9. Quantitative Polymerase Chain Reaction (qPCR)
4.10. Analysis of Collagen Synthesis
4.11. Analysis of Collagen Remodeling
4.12. Analysis of Cell-Induced Contractility of Collagen
4.13. Western Blot Analysis
4.14. Measurement of Calpain 1 Protein Expression
4.15. Dermal–Epidermal Junction (DEJ) Analysis
4.16. Dehydroethidium (DHE) and Masson’s Trichrome (MT) Staining
4.17. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Baumann, L. Skin ageing and its treatment. J. Pathol. 2007, 211, 241–251. [Google Scholar] [CrossRef] [Scilit]
- Payeras, M.R.; Cherubini, K.; Figueiredo, M.A.; Salum, F.G. Oral lichen planus: Focus on etiopathogenesis. Arch. Oral Biol. 2013, 58, 1057–1069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haltaufderhyde, K.; Ozdeslik, R.N.; Wicks, N.L.; Najera, J.A.; Oancea, E. Opsin Expression in Human Epidermal Skin. Photochem. Photobiol. 2015, 91, 117–123. [Google Scholar] [CrossRef] [Scilit]
- Zorina, A.; Zorin, V.; Kudlay, D.; Kopnin, P. Age-Related Changes in the Fibroblastic Differon of the Dermis: Role in Skin Aging. Int. J. Mol. Sci. 2022, 23, 6135. [Google Scholar] [CrossRef] [Scilit]
- Sreedhar, A.; Aguilera-Aguirre, L.; Singh, K.K. Mitochondria in skin health, aging, and disease. Cell Death Dis. 2020, 11, 444. [Google Scholar] [CrossRef] [Scilit]
- Correia-Melo, C.; Marques, F.D.M.; Anderson, R.; Hewitt, G.; Hewitt, R.; Cole, J.; Carroll, B.M.; Miwa, S.; Birch, J.; Merz, A.; et al. Mitochondria are required for pro-ageing features of the senescent phenotype. EMBO J. 2016, 35, 724–742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, H.-C.; Yin, P.-H.; Chi, C.-W.; Wei, Y.-H. Increase in mitochondrial mass in human fibroblasts under oxidative stress and during replicative cell senescence. J. Biomed. Sci. 2002, 9, 517–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giorgi, C.; Marchi, S.; Simoes, I.C.M.; Ren, Z.; Morciano, G.; Perrone, M.; Patalas-Krawczyk, P.; Borchard, S.; Jędrak, P.; Pierzynowska, K.; et al. Mitochondria and Reactive Oxygen Species in Aging and Age-Related Diseases. Int. Rev. Cell Mol. Biol. 2018, 340, 209–344. [Google Scholar] [CrossRef] [Scilit]
- Papaccio, F.; D′Arino, A.; Caputo, S.; Bellei, B. Focus on the Contribution of Oxidative Stress in Skin Aging. Antioxidants 2022, 11, 1121. [Google Scholar] [CrossRef] [Scilit]
- Turrens, J.F. Mitochondrial formation of reactive oxygen species. J. Physiol. 2003, 552, 335–344. [Google Scholar] [CrossRef]
- Lee, Y.H.; Kuk, M.U.; So, M.K.; Song, E.S.; Lee, H.; Ahn, S.K.; Kwon, H.W.; Park, J.T.; Park, S.C. Targeting Mitochondrial Oxidative Stress as a Strategy to Treat Aging and Age-Related Diseases. Antioxidants 2023, 12, 934. [Google Scholar] [CrossRef] [Scilit]
- Mailloux, R.J. Teaching the fundamentals of electron transfer reactions in mitochondria and the production and detection of reactive oxygen species. Redox Biol. 2015, 4, 381–398. [Google Scholar] [CrossRef] [Scilit]
- Farage, M.A.; Miller, K.W.; Elsner, P.; Maibach, H.I. Characteristics of the Aging Skin. Adv. Wound Care 2013, 2, 5–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quan, T.; Fisher, G.J. Role of Age-Associated Alterations of the Dermal Extracellular Matrix Microenvironment in Human Skin Aging: A Mini-Review. Gerontology 2015, 61, 427–434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, D.; Rai, V.; Agrawal, D.K. Regulation of Collagen I and Collagen III in Tissue Injury and Regeneration. Cardiol. Cardiovasc. Med. 2023, 7, 5–16. [Google Scholar] [CrossRef] [Scilit]
- Boudko, S.P.; Danylevych, N.; Hudson, B.G.; Pedchenko, V.K. Basement membrane collagen IV: Isolation of functional domains. Methods Cell Biol. 2018, 143, 171–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aquino-Martinez, R.; Eckhardt, B.A.; Rowsey, J.L.; Fraser, D.G.; Khosla, S.; Farr, J.N.; Monroe, D.G. Senescent cells exacerbate chronic inflammation and contribute to periodontal disease progression in old mice. J. Periodontol. 2021, 92, 1483–1495. [Google Scholar] [CrossRef] [Scilit]
- Kim, E.C.; Kim, J.R. Senotherapeutics: Emerging strategy for healthy aging and age-related disease. BMB Rep. 2019, 52, 47–55. [Google Scholar] [CrossRef] [Scilit]
- Kirkland, J.L.; Tchkonia, T. Senolytic drugs: From discovery to translation. J. Intern. Med. 2020, 288, 518–536. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; He, Y.; Rayman, M.P.; Zhang, J. Prospective Selective Mechanism of Emerging Senolytic Agents Derived from Flavonoids. J. Agric. Food Chem. 2021, 69, 12418–12423. [Google Scholar] [CrossRef] [Scilit]
- Zoico, E.; Nori, N.; Darra, E.; Tebon, M.; Rizzatti, V.; Policastro, G.; De Caro, A.; Rossi, A.P.; Fantin, F.; Zamboni, M. Senolytic effects of quercetin in an in vitro model of pre-adipocytes and adipocytes induced senescence. Sci. Rep. 2021, 11, 23237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yousefzadeh, M.J.; Zhu, Y.; McGowan, S.J.; Angelini, L.; Fuhrmann-Stroissnigg, H.; Xu, M.; Ling, Y.Y.; Melos, K.I.; Pirtskhalava, T.; Inman, C.L.; et al. Fisetin is a senotherapeutic that extends health and lifespan. EBioMedicine 2018, 36, 18–28. [Google Scholar] [CrossRef] [Scilit]
- Aboulwafa, M.M.; Youssef, F.S.; Gad, H.A.; Altyar, A.E.; Al-Azizi, M.M.; Ashour, M.L. A Comprehensive Insight on the Health Benefits and Phytoconstituents of Camellia sinensis and Recent Approaches for Its Quality Control. Antioxidants 2019, 8, 455. [Google Scholar] [CrossRef] [Scilit]
- Kaihatsu, K.; Yamabe, M.; Ebara, Y. Antiviral Mechanism of Action of Epigallocatechin-3-O-gallate and Its Fatty Acid Esters. Molecules 2018, 23, 2475. [Google Scholar] [CrossRef] [Scilit]
- Reygaert, W.C. The antimicrobial possibilities of green tea. Front. Microbiol. 2014, 5, 434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koch, W.; Zagórska, J.; Marzec, Z.; Kukula-Koch, W. Applications of Tea (Camellia sinensis) and its Active Constituents in Cosmetics. Molecules 2019, 24, 4277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, C.; Choi, S.H.; Jeong, J.-W.; Han, M.H.; Lee, H.; Hong, S.H.; Kim, G.-Y.; Moon, S.-K.; Kim, W.-J.; Choi, Y.H. Honokiol ameliorates oxidative stress-induced DNA damage and apoptosis of c2c12 myoblasts by ROS generation and mitochondrial pathway. Anim. Cells Syst. 2020, 24, 60–68. [Google Scholar] [CrossRef] [Scilit]
- Chou, P.Y.; Chang, W.C.; Liu, F.C.; Lan, S.J.; Sheu, M.J.; Chen, J.S. Honokiol, an active compound of Magnolia officinalis, is involved in restoring normal baroreflex sensitivity in hypercholesterolemic rabbits. Food Sci. Nutr. 2020, 8, 1093–1103. [Google Scholar] [CrossRef] [Scilit]
- Huang, K.; Chen, Y.; Zhang, R.; Wu, Y.; Ma, Y.; Fang, X.; Shen, S. Honokiol induces apoptosis and autophagy via the ROS/ERK1/2 signaling pathway in human osteosarcoma cells in vitro and in vivo. Cell Death Dis. 2018, 9, 157. [Google Scholar] [CrossRef] [Scilit]
- Ou, H.C.; Chou, F.P.; Lin, T.M.; Yang, C.H.; Sheu, W.H. Protective effects of honokiol against oxidized LDL-induced cytotoxicity and adhesion molecule expression in endothelial cells. Chem. Biol. Interact. 2006, 161, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Ortega-Villasante, C.; Burén, S.; Blázquez-Castro, A.; Barón-Sola, Á.; Hernández, L.E. Fluorescent in vivo imaging of reactive oxygen species and redox potential in plants. Free Radic. Biol. Med. 2018, 122, 202–220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henderson, L.M.; Chappell, J.B. Dihydrorhodamine 123: A fluorescent probe for superoxide generation? Eur. J. Biochem. 1993, 217, 973–980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dickinson, B.C.; Srikun, D.; Chang, C.J. Mitochondrial-targeted fluorescent probes for reactive oxygen species. Curr. Opin. Chem. Biol. 2010, 14, 50–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salehi, B.; Mishra, A.P.; Nigam, M.; Sener, B.; Kilic, M.; Sharifi-Rad, M.; Fokou, P.V.T.; Martins, N.; Sharifi-Rad, J. Resveratrol: A Double-Edged Sword in Health Benefits. Biomedicines 2018, 6, 91. [Google Scholar] [CrossRef] [Scilit]
- Sweeney, G.D. Variability in the human drug response. Thromb. Res. 1983, 29, 3–15. [Google Scholar] [CrossRef] [Scilit]
- Tohma, H.; Hepworth, A.R.; Shavlakadze, T.; Grounds, M.D.; Arthur, P.G. Quantification of Ceroid and Lipofuscin in Skeletal Muscle. J. Histochem. Cytochem. 2011, 59, 769–779. [Google Scholar] [CrossRef] [Scilit]
- Brand, M.D.; Nicholls, D.G. Assessing mitochondrial dysfunction in cells. Biochem. J. 2011, 435, 297–312. [Google Scholar] [CrossRef] [Scilit]
- Sherratt, H.S. Mitochondria: Structure and function. Rev. Neurol. 1991, 147, 417–430. [Google Scholar]
- Lee, Y.H.; Park, J.Y.; Lee, H.; Song, E.S.; Kuk, M.U.; Joo, J.; Oh, S.; Kwon, H.W.; Park, J.T.; Park, S.C. Targeting Mitochondrial Metabolism as a Strategy to Treat Senescence. Cells 2021, 10, 3003. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.; Hickson, L.J.; Eirin, A.; Kirkland, J.L.; Lerman, L.O. Cellular senescence: The good, the bad and the unknown. Nat. Rev. Nephrol. 2022, 18, 611–627. [Google Scholar] [CrossRef] [Scilit]
- González-Gualda, E.; Baker, A.G.; Fruk, L.; Muñoz-Espín, D. A guide to assessing cellular senescence in vitro and in vivo. FEBS J. 2021, 288, 56–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palma, F.R.; He, C.; Danes, J.M.; Paviani, V.; Coelho, D.R.; Gantner, B.N.; Bonini, M.G. Mitochondrial Superoxide Dismutase: What the Established, the Intriguing, and the Novel Reveal About a Key Cellular Redox Switch. Antioxid. Redox Signal 2020, 32, 701–714. [Google Scholar] [CrossRef] [Scilit]
- Ichimura, H.; Parthasarathi, K.; Quadri, S.; Issekutz, A.C.; Bhattacharya, J. Mechano-oxidative coupling by mitochondria induces proinflammatory responses in lung venular capillaries. J. Clin. Investig. 2003, 111, 691–699. [Google Scholar] [CrossRef]
- Naik, E.; Dixit, V.M. Mitochondrial reactive oxygen species drive proinflammatory cytokine production. J. Exp. Med. 2011, 208, 417–420. [Google Scholar] [CrossRef] [Scilit]
- Nelson, G.; Kucheryavenko, O.; Wordsworth, J.; von Zglinicki, T. The senescent bystander effect is caused by ROS-activated NF-κB signalling. Mech. Ageing Dev. 2018, 170, 30–36. [Google Scholar] [CrossRef] [Scilit]
- Lopez-Castejon, G.; Brough, D. Understanding the mechanism of IL-1β secretion. Cytokine Growth Factor Rev. 2011, 22, 189–195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Montecinos, V.; Guzmán, P.; Barra, V.; Villagrán, M.; Muñoz-Montesino, C.; Sotomayor, K.; Escobar, E.; Godoy, A.; Mardones, L.; Sotomayor, P.; et al. Vitamin C Is an Essential Antioxidant That Enhances Survival of Oxidatively Stressed Human Vascular Endothelial Cells in the Presence of a Vast Molar Excess of Glutathione. J. Biol. Chem. 2007, 282, 15506–15515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaur, A.; Ecker, B.L.; Douglass, S.M.; Kugel, C.H., 3rd; Webster, M.R.; Almeida, F.V.; Somasundaram, R.; Hayden, J.; Ban, E.; Ahmadzadeh, H.; et al. Remodeling of the Collagen Matrix in Aging Skin Promotes Melanoma Metastasis and Affects Immune Cell Motility. Cancer Discov. 2019, 9, 64–81. [Google Scholar] [CrossRef] [Scilit]
- Melander, M.C.; Jürgensen, H.J.; Madsen, D.H.; Engelholm, L.H.; Behrendt, N. The collagen receptor uPARAP/Endo180 in tissue degradation and cancer (Review). Int. J. Oncol. 2015, 47, 1177–1188. [Google Scholar] [CrossRef] [Scilit]
- Tang, S.; Lucius, R.; Wenck, H.; Gallinat, S.; Weise, J.M. UV-mediated downregulation of the endocytic collagen receptor, Endo180, contributes to accumulation of extracellular collagen fragments in photoaged skin. J. Dermatol. Sci. 2013, 70, 42–48. [Google Scholar] [CrossRef] [Scilit]
- Perez-Aso, M.; Fernandez, P.; Mediero, A.; Chan, E.S.; Cronstein, B.N. Adenosine 2A receptor promotes collagen production by human fibroblasts via pathways involving cyclic AMP and AKT but independent of Smad2/3. FASEB J. 2014, 28, 802–812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, T.; Day, J.H.; Su, X.; Guadarrama, A.G.; Sandbo, N.K.; Esnault, S.; Denlinger, L.C.; Berthier, E.; Theberge, A.B. Investigating Fibroblast-Induced Collagen Gel Contraction Using a Dynamic Microscale Platform. Front. Bioeng. Biotechnol. 2019, 7, 196. [Google Scholar] [CrossRef] [Scilit]
- Brembilla, N.C.; Senra, L.; Boehncke, W.H. The IL-17 Family of Cytokines in Psoriasis: IL-17A and Beyond. Front. Immunol. 2018, 9, 1682. [Google Scholar] [CrossRef] [Scilit]
- Gutowska-Owsiak, D.; Schaupp, A.L.; Salimi, M.; Selvakumar, T.A.; McPherson, T.; Taylor, S.; Ogg, G.S. IL-17 downregulates filaggrin and affects keratinocyte expression of genes associated with cellular adhesion. Exp. Dermatol. 2012, 21, 104–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clausen, M.-L.; Kezic, S.; Olesen, C.M.; Agner, T. Cytokine concentration across the stratum corneum in atopic dermatitis and healthy controls. Sci. Rep. 2020, 10, 21895. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, H.L.; Lo, C.H.; Huang, C.C.; Lu, M.P.; Hu, P.Y.; Chen, C.S.; Chueh, D.Y.; Chen, P.; Lin, T.N.; Lo, Y.H.; et al. Galectin-7 downregulation in lesional keratinocytes contributes to enhanced IL-17A signaling and skin pathology in psoriasis. J. Clin. Investig. 2021, 131, e130740. [Google Scholar] [CrossRef] [Scilit]
- Jeon, S.; Song, J.; Lee, D.; Kim, G.T.; Park, S.H.; Shin, D.Y.; Shin, K.O.; Park, K.; Shim, S.M.; Park, T.S. Inhibition of sphingosine 1-phosphate lyase activates human keratinocyte differentiation and attenuates psoriasis in mice. J. Lipid Res. 2020, 61, 20–32. [Google Scholar] [CrossRef] [Scilit]
- Coderch, L.; López, O.; de la Maza, A.; Parra, J.L. Ceramides and skin function. Am. J. Clin. Dermatol. 2003, 4, 107–129. [Google Scholar] [CrossRef] [Scilit]
- Nishiyama, T.; Amano, S.; Tsunenaga, M.; Kadoya, K.; Takeda, A.; Adachi, E.; Burgeson, R.E. The importance of laminin 5 in the dermal-epidermal basement membrane. J. Dermatol. Sci. 2000, 24 (Suppl 1), S51–S59. [Google Scholar] [CrossRef] [Scilit]
- Aleemardani, M.; Trikić, M.Z.; Green, N.H.; Claeyssens, F. The Importance of Mimicking Dermal-Epidermal Junction for Skin Tissue Engineering: A Review. Bioengineering 2021, 8, 148. [Google Scholar] [CrossRef] [Scilit]
- Iriyama, S.; Yasuda, M.; Nishikawa, S.; Takai, E.; Hosoi, J.; Amano, S. Decrease of laminin-511 in the basement membrane due to photoaging reduces epidermal stem/progenitor cells. Sci. Rep. 2020, 10, 12592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsuji, T.; Kawada, Y.; Kai-Murozono, M.; Komatsu, S.; Han, S.A.; Takeuchi, K.; Mizushima, H.; Miyazaki, K.; Irimura, T. Regulation of melanoma cell migration and invasion by laminin-5 and alpha3beta1 integrin (VLA-3). Clin. Exp. Metastasis 2002, 19, 127–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stipp, C.S.; Kolesnikova, T.V.; Hemler, M.E. EWI-2 regulates alpha3beta1 integrin-dependent cell functions on laminin-5. J. Cell Biol. 2003, 163, 1167–1177. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.; Higginbotham, E.J.; Yue, B.Y. Effects of ascorbic acid on levels of fibronectin, laminin and collagen type 1 in bovine trabecular meshwork in organ culture. Curr. Eye Res. 1998, 17, 211–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roig-Rosello, E.; Rousselle, P. The Human Epidermal Basement Membrane: A Shaped and Cell Instructive Platform That Aging Slowly Alters. Biomolecules 2020, 10, 1607. [Google Scholar] [CrossRef] [Scilit]
- Natsuga, K.; Watanabe, M.; Nishie, W.; Shimizu, H. Life before and beyond blistering: The role of collagen XVII in epidermal physiology. Exp. Dermatol. 2019, 28, 1135–1141. [Google Scholar] [CrossRef] [Scilit]
- Xiang, Y.; Liu, Y.; Yang, Y.; Yan, Y.; Kim, A.J.; Guo, C.; Fisher, G.J.; Quan, T. Reduced expression of Collagen 17A1 in naturally aged, photoaged, and UV-irradiated human skin in vivo: Potential links to epidermal aging. J. Cell Commun. Signal. 2022, 16, 421–432. [Google Scholar] [CrossRef] [Scilit]
- DePhillipo, N.N.; Aman, Z.S.; Kennedy, M.I.; Begley, J.P.; Moatshe, G.; LaPrade, R.F. Efficacy of Vitamin C Supplementation on Collagen Synthesis and Oxidative Stress After Musculoskeletal Injuries: A Systematic Review. Orthop. J. Sports Med. 2018, 6, 2325967118804544. [Google Scholar] [CrossRef] [Scilit]
- Nain, C.W.; Mignolet, E.; Herent, M.-F.; Quetin-Leclercq, J.; Debier, C.; Page, M.M.; Larondelle, Y. The Catechins Profile of Green Tea Extracts Affects the Antioxidant Activity and Degradation of Catechins in DHA-Rich Oil. Antioxidants 2022, 11, 1844. [Google Scholar] [CrossRef] [Scilit]
- Grzesik, M.; Naparło, K.; Bartosz, G.; Sadowska-Bartosz, I. Antioxidant properties of catechins: Comparison with other antioxidants. Food Chem. 2018, 241, 480–492. [Google Scholar] [CrossRef] [Scilit]
- Song, D.; Park, H.; Lee, S.H.; Kim, M.J.; Kim, E.J.; Lim, K.M. PAL-12, a new anti-aging hexa-peptoid, inhibits UVB-induced photoaging in human dermal fibroblasts and 3D reconstructed human full skin model, Keraskin-FTTM. Arch. Dermatol. Res. 2017, 309, 697–707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, K.-M.; Lee, S.-H.; Jang, W.-H.; Jung, H.-S.; Heo, Y.; Park, Y.-H.; Bae, S.; Lim, K.-M.; Seok, S.H. KeraSkin™-VM: A novel reconstructed human epidermis model for skin irritation tests. Toxicol. In Vitro 2014, 28, 742–750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahn, J.H.; Kim, D.W.; Park, C.W.; Kim, B.; Sim, H.; Kim, H.S.; Lee, T.K.; Lee, J.C.; Yang, G.E.; Her, Y.; et al. Laminarin Attenuates Ultraviolet-Induced Skin Damage by Reducing Superoxide Anion Levels and Increasing Endogenous Antioxidants in the Dorsal Skin of Mice. Mar. Drugs 2020, 18, 345. [Google Scholar] [CrossRef] [Scilit]
- Adtani, P.; Malathi, N.; Ranganathan, K.; Lokeswari, S.; Punnoose, A.M. Antifibrotic effect of Ocimum basilicum L. and linalool on arecoline-induced fibrosis in human buccal fibroblasts: An in vitro study. Transl. Res. Oral Oncol. 2018, 3, 2057178X18764471. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Pitcher, L.E.; Prahalad, V.; Niedernhofer, L.J.; Robbins, P.D. Targeting cellular senescence with senotherapeutics: Senolytics and senomorphics. FEBS J. 2023, 290, 1362–1383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmitt, C.A.; Wang, B.; Demaria, M. Senescence and cancer role and therapeutic opportunities. Nat. Rev. Clin. Oncol. 2022, 19, 619–636. [Google Scholar] [CrossRef] [Scilit]
- Robbins, P.D.; Jurk, D.; Khosla, S.; Kirkland, J.L.; LeBrasseur, N.K.; Miller, J.D.; Passos, J.F.; Pignolo, R.J.; Tchkonia, T.; Niedernhofer, L.J. Senolytic Drugs: Reducing Senescent Cell Viability to Extend Health Span. Annu. Rev. Pharmacol. Toxicol. 2021, 61, 779–803. [Google Scholar] [CrossRef] [Scilit]
- Yosef, R.; Pilpel, N.; Tokarsky-Amiel, R.; Biran, A.; Ovadya, Y.; Cohen, S.; Vadai, E.; Dassa, L.; Shahar, E.; Condiotti, R.; et al. Directed elimination of senescent cells by inhibition of BCL-W and BCL-XL. Nat. Commun. 2016, 7, 11190. [Google Scholar] [CrossRef] [Scilit]
- Kowald, A.; Kirkwood, T.B.L. Senolytics and the compression of late-life mortality. Exp. Gerontol. 2021, 155, 111588. [Google Scholar] [CrossRef] [Scilit]
- Choksi, K.B.; Nuss, J.E.; Deford, J.H.; Papaconstantinou, J. Age-related alterations in oxidatively damaged proteins of mouse skeletal muscle mitochondrial electron transport chain complexes. Free Radic. Biol. Med. 2008, 45, 826–838. [Google Scholar] [CrossRef] [Scilit]
- Choksi, K.B.; Boylston, W.H.; Rabek, J.P.; Widger, W.R.; Papaconstantinou, J. Oxidatively damaged proteins of heart mitochondrial electron transport complexes. Biochim. Biophys. Acta 2004, 1688, 95–101. [Google Scholar] [CrossRef] [Scilit]
- Nakai, K.; Tsuruta, D. What Are Reactive Oxygen Species, Free Radicals, and Oxidative Stress in Skin Diseases? Int. J. Mol. Sci. 2021, 22, 10799. [Google Scholar] [CrossRef] [Scilit]
- Stout, R.; Birch-Machin, M.A. Mitochondria’s Role in Skin Ageing. Biology 2019, 8, 29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, R.Z.; Jiang, S.; Zhang, L.; Yu, Z.B. Mitochondrial electron transport chain, ROS generation and uncoupling (Review). Int. J. Mol. Med. 2019, 44, 3–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoang, H.T.; Moon, J.-Y.; Lee, Y.-C. Natural Antioxidants from Plant Extracts in Skincare Cosmetics: Recent Applications, Challenges and Perspectives. Cosmetics 2021, 8, 106. [Google Scholar] [CrossRef] [Scilit]
- Hęś, M.; Dziedzic, K.; Górecka, D.; Jędrusek-Golińska, A.; Gujska, E. Aloe vera (L.) Webb.: Natural Sources of Antioxidants—A Review. Plant Foods Hum. Nutr. 2019, 74, 255–265. [Google Scholar] [CrossRef] [Scilit]
- Singh, O.; Khanam, Z.; Misra, N.; Srivastava, M.K. Chamomile (Matricaria chamomilla L.): An overview. Pharmacogn. Rev. 2011, 5, 82–95. [Google Scholar] [CrossRef] [Scilit]
- He, X.; Wan, F.; Su, W.; Xie, W. Research Progress on Skin Aging and Active Ingredients. Molecules 2023, 28, 5556. [Google Scholar] [CrossRef] [Scilit]
- Brickel, J.A.; Matulka, R.A.; Burdock, G.A. The explosion in the use of natural substances and the need for new comprehensive risk assessments. Curr. Opin. Food Sci. 2018, 24, 56–61. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.-K. Natural products in cosmetics. Nat. Prod. Bioprospecting 2022, 12, 40. [Google Scholar] [CrossRef] [Scilit]
- Emerald, M.; Emerald, A.; Emerald, L.; Kumar, V. Perspective of Natural Products in Skincare. Pharm. Pharmacol. Int. J. 2016, 4, 72–75. [Google Scholar] [CrossRef] [Scilit]
- Soltani, S.; Boutin, Y.; Couture, F.; Biron, E.; Subirade, M.; Fliss, I. In vitro assessment of skin sensitization, irritability and toxicity of bacteriocins and reuterin for possible topical applications. Sci. Rep. 2022, 12, 4570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ng, W.L.; Yeong, W.Y. The future of skin toxicology testing—Three-dimensional bioprinting meets microfluidics. Int. J. Bioprint 2019, 5, 237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Y.Q.; Yang, X.; Wu, X.F.; Fan, Y.B. Enhancing Permeation of Drug Molecules Across the Skin via Delivery in Nanocarriers: Novel Strategies for Effective Transdermal Applications. Front. Bioeng. Biotechnol. 2021, 9, 646554. [Google Scholar] [CrossRef] [Scilit]
- Gorzelanny, C.; Mess, C.; Schneider, S.W.; Huck, V.; Brandner, J.M. Skin Barriers in Dermal Drug Delivery: Which Barriers Have to Be Overcome and How Can We Measure Them? Pharmaceutics 2020, 12, 684. [Google Scholar] [CrossRef] [Scilit]
- Hmingthansanga, V.; Singh, N.; Banerjee, S.; Manickam, S.; Velayutham, R.; Natesan, S. Improved Topical Drug Delivery: Role of Permeation Enhancers and Advanced Approaches. Pharmaceutics 2022, 14, 2818. [Google Scholar] [CrossRef] [Scilit]
- van Hoogevest, P.; Fahr, A. Phospholipids in Cosmetic Carriers. In Nanocosmetics: From Ideas to Products; Cornier, J., Keck, C.M., Van de Voorde, M., Eds.; Springer International Publishing: Cham, Switzerland, 2019; pp. 95–140. [Google Scholar]
- Lavilla, I.; Cabaleiro, N.; Bendicho, C. Chapter 14—Main Chemical Contaminants in Cosmetics: Regulatory Aspects and Analytical Methods. In Analysis of Cosmetic Products, 2nd ed.; Salvador, A., Chisvert, A., Eds.; Elsevier: Boston, MA, USA, 2018; pp. 331–383. [Google Scholar]
- Yoon, J.H.; Kim, Y.H.; Jeong, E.Y.; Lee, Y.H.; Byun, Y.; Shin, S.S.; Park, J.T. Senescence Rejuvenation through Reduction in Mitochondrial Reactive Oxygen Species Generation by Polygonum cuspidatum Extract: In Vitro Evidence. Antioxidants 2024, 13, 1110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Y.H.; Choi, D.; Jang, G.; Park, J.Y.; Song, E.S.; Lee, H.; Kuk, M.U.; Joo, J.; Ahn, S.K.; Byun, Y.; et al. Targeting regulation of ATP synthase 5 alpha/beta dimerization alleviates senescence. Aging 2022, 14, 678–707. [Google Scholar] [CrossRef] [Scilit]
- Huang, L.C.; Lin, W.; Yagami, M.; Tseng, D.; Miyashita-Lin, E.; Singh, N.; Lin, A.; Shih, S.J. Validation of cell density and viability assays using Cedex automated cell counter. Biologicals 2010, 38, 393–400. [Google Scholar] [CrossRef] [Scilit]
- Kang, H.T.; Park, J.T.; Choi, K.; Kim, Y.; Choi, H.J.C.; Jung, C.W.; Lee, Y.S.; Park, S.C. Chemical screening identifies ATM as a target for alleviating senescence. Nat. Chem. Biol. 2017, 13, 616–623. [Google Scholar] [CrossRef] [Scilit]
- Kuk, M.U.; Lee, H.; Song, E.S.; Lee, Y.H.; Park, J.Y.; Jeong, S.; Kwon, H.W.; Byun, Y.; Park, S.C.; Park, J.T. Functional restoration of lysosomes and mitochondria through modulation of AKT activity ameliorates senescence. Exp. Gerontol. 2023, 173, 112091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuk, M.U.; Park, J.Y.; Song, E.S.; Lee, H.; Lee, Y.H.; Joo, J.; Kwon, H.W.; Park, J.T. Bacterial Artificial Chromosome-based Protein Expression Platform Using the Tol2 Transposon System. Biotechnol. Bioprocess Eng. 2022, 27, 344–352. [Google Scholar] [CrossRef] [Scilit]
- Rajan, N.; Habermehl, J.; Coté, M.-F.; Doillon, C.J.; Mantovani, D. Preparation of ready-to-use, storable and reconstituted type I collagen from rat tail tendon for tissue engineering applications. Nat. Protoc. 2006, 1, 2753–2758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Y.H.; Kim, M.; Park, H.J.; Park, J.Y.; Song, E.S.; Lee, H.; Ko, G.; Ahn, S.; Kwon, H.W.; Byun, Y.; et al. Chemical screening identifies the anticancer properties of Polyporous parvovarius. J. Cancer 2023, 14, 50–60. [Google Scholar] [CrossRef] [Scilit]










| Target | Orientation | Sequence (5′–3′) | Size (bp) |
|---|---|---|---|
| 36B4 (Accession number: NM_053275) | Forward | CAGCAAGTGGGAAGGTGTAATCC | 23 |
| Reverse | CCCATTCTATCATCAACGGGTACAA | 25 | |
| p21 (Accession number: NM_000077.5) | Forward | AGGTGGACCTGGAGACTCTCAG | 22 |
| Reverse | TCCTCTTGGAGAAGATCAGCCG | 22 | |
| IL-1β (Accession number: NM_000576.3) | Forward | CCACAGACCTTCCAGGAGAATG | 22 |
| Reverse | GTGCAGTTCAGTGATCGTACAGG | 23 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, J.H.; Jeong, E.Y.; Kim, Y.H.; Cha, S.Y.; Kim, H.Y.; Nam, Y.K.; Park, J.S.; Kim, S.Y.; Lee, Y.J.; Yoon, J.H.; et al. Epigallocatechin Gallate in Camellia sinensis Ameliorates Skin Aging by Reducing Mitochondrial ROS Production. Pharmaceuticals 2025, 18, 612. https://doi.org/10.3390/ph18050612
Park JH, Jeong EY, Kim YH, Cha SY, Kim HY, Nam YK, Park JS, Kim SY, Lee YJ, Yoon JH, et al. Epigallocatechin Gallate in Camellia sinensis Ameliorates Skin Aging by Reducing Mitochondrial ROS Production. Pharmaceuticals. 2025; 18(5):612. https://doi.org/10.3390/ph18050612
Chicago/Turabian StylePark, Ji Ho, Eun Young Jeong, Ye Hyang Kim, So Yoon Cha, Ha Yeon Kim, Yeon Kyung Nam, Jin Seong Park, So Yeon Kim, Yoo Jin Lee, Jee Hee Yoon, and et al. 2025. "Epigallocatechin Gallate in Camellia sinensis Ameliorates Skin Aging by Reducing Mitochondrial ROS Production" Pharmaceuticals 18, no. 5: 612. https://doi.org/10.3390/ph18050612
APA StylePark, J. H., Jeong, E. Y., Kim, Y. H., Cha, S. Y., Kim, H. Y., Nam, Y. K., Park, J. S., Kim, S. Y., Lee, Y. J., Yoon, J. H., So, B., Kim, D., Kim, M., Byun, Y., Lee, Y. H., Shin, S. S., & Park, J. T. (2025). Epigallocatechin Gallate in Camellia sinensis Ameliorates Skin Aging by Reducing Mitochondrial ROS Production. Pharmaceuticals, 18(5), 612. https://doi.org/10.3390/ph18050612

