miRNome Characterization of Milk-Derived Extracellular Vesicles in Recombinant Somatotropin-Treated Dairy Cows
Abstract
1. Introduction
2. Results
2.1. Sample Selection and Quality Assessment
2.2. Small RNA Sequencing
Sample_ID | Total Seq | Mapped | rbST | Sampling Time | Animal ID |
---|---|---|---|---|---|
s1T0c | 3,828,519 | 208,063 | control | T0 | 1 * |
s1T1t | 3,085,517 | 122,773 | treated | T1 | 1 |
s1T2t | 4,316,225 | 471,009 | treated | T2 | 1 |
s1T3t | 29,983,329 | 2,695,040 | treated | T3 | 1 |
s1T4t | 9,019,457 | 1,050,819 | treated | T4 | 1 |
s1T5t | 2,869,470 | 153,915 | treated | T5 | 1 |
s1T6t | 10,494,740 | 1,473,190 | treated | T6 | 1 |
s2T0c | 4,796,779 | 105,297 | control | T0 | 2 * |
s2T1t | 188,968 | 6997 | treated | T1 | 2 |
s2T2t | 9,381,548 | 1,005,499 | treated | T2 | 2 |
s2T3t | 22,133,967 | 2,934,448 | treated | T3 | 2 |
s2T4t | 30,356,677 | 1,647,234 | treated | T4 | 2 |
s2T5t | 8,165,814 | 571,127 | treated | T5 | 2 |
s2T6t | 7,895,100 | 1,421,498 | treated | T6 | 2 |
s3T0c | 4,105,600 | 153,699 | control | T0 | 3 * |
s3T1t | 4,238,014 | 129,415 | treated | T1 | 3 |
s3T2t | 5,682,647 | 598,925 | treated | T2 | 3 |
s3T3t | 15,537,934 | 2,187,094 | treated | T3 | 3 |
s3T4t | 11,499,701 | 1,765,815 | treated | T4 | 3 |
s3T5t | 7,786,629 | 357,732 | treated | T5 | 3 |
s3T6t | 13,280,173 | 1,449,837 | treated | T6 | 3 |
s4T0c | 2,303,125 | 83,933 | control | T0 | 4 * |
s4T1t | 5,577,948 | 149,493 | treated | T1 | 4 |
s4T2t | 5,504,047 | 495,298 | treated | T2 | 4 |
s4T3t | 33,127,593 | 3,162,873 | treated | T3 | 4 |
s4T4t | 14,886,381 | 1,353,519 | treated | T4 | 4 |
s4T5t | 11,285,114 | 1,445,212 | treated | T5 | 4 |
s4T6t | 10,188,989 | 1,588,432 | treated | T6 | 4 |
s5T0c | 2,671,228 | 56,547 | control | T0 | 5 * |
s5T1t | 4,437,871 | 158,497 | treated | T1 | 5 |
s5T2t | 5,712,065 | 655,868 | treated | T2 | 5 |
s5T3t | 38,259,506 | 3,205,486 | treated | T3 | 5 |
s5T4t | 8,952,112 | 904,927 | treated | T4 | 5 |
s5T5t | 9,481,162 | 507,158 | treated | T5 | 5 |
s5T6t | 1,056,805 | 78,917 | treated | T6 | 5 |
s6T0c | 5,337,415 | 304,115 | control | T0 | 6 |
s6T1c | 3,868,419 | 242,346 | control | T1 | 6 |
s6T2c | 9,156,540 | 987,353 | control | T2 | 6 |
s6T3c | 24,636,864 | 4,299,933 | control | T3 | 6 |
s6T4c | 8,479,445 | 1,117,713 | control | T4 | 6 |
s6T5c | 33,312,826 | 697,921 | control | T5 | 6 |
s6T6c | 21,510,851 | 4,221,042 | control | T6 | 6 |
s7T0c | 7,458,017 | 669,561 | control | T0 | 7 * |
s7T1t | 5,744,949 | 357,546 | treated | T1 | 7 |
s7T2t | 23,118,617 | 2,514,111 | treated | T2 | 7 |
s7T3t | 23,170,624 | 2,014,974 | treated | T3 | 7 |
s7T4t | 17,362,628 | 2,029,080 | treated | T4 | 7 |
s7T5t | 20,218,176 | 3,189,136 | treated | T5 | 7 |
s7T6t | 25,071,924 | 3,863,181 | treated | T6 | 7 |
s8T0c | 2,995,090 | 92,222 | control | T0 | 8 |
s8T1c | 4,362,023 | 83,093 | control | T1 | 8 |
s8T2c | 7,924,546 | 362,089 | control | T2 | 8 |
s8T3c | 3,860,580 | 304,426 | control | T3 | 8 |
s8T4c | 4,349,526 | 246,852 | control | T4 | 8 |
s8T5c | 8,111,221 | 867,770 | control | T5 | 8 |
s8T6c | 4,994,429 | 593,879 | control | T6 | 8 |
s9T0c | 4,247,464 | 182,306 | control | T0 | 9 |
s9T1c | 5,136,754 | 123,945 | control | T1 | 9 |
s9T2c | 10,299,719 | 668,682 | control | T2 | 9 |
s9T3c | 20,247,505 | 1,402,433 | control | T3 | 9 |
s9T4c | 9,949,579 | 861,363 | control | T4 | 9 |
s9T5c | 10,247,184 | 1,266,658 | control | T5 | 9 |
s9T6c | 5,161,508 | 805,228 | control | T6 | 9 |
2.3. qPCR Validation Study
3. Discussion
4. Materials and Methods
4.1. Sample Selection
4.1.1. Experimental Samples
- T0: 6 days before first rbST dose
- T1: 1 day after first rbST dose
- T2: 3 days after second rbST dose (i.e., 17 days after first rbST dose)
- T3: 7 days before fourth rbST dose (i.e., 35 days after first rbST dose)
- T4: 14 days before sixth rbST dose (i.e., 70 days after first rbST dose)
- T5: On the day of the sixth rbST dose (i.e., 84 days after first rbST dose)
- T6: 4 days after the sixth rbST dose (i.e., 88 days after first rbST dose)
4.1.2. Field Samples and Milk Quality Evaluations
4.2. EVs Isolation from Milk Samples
4.3. Nanoparticle Tracking Analysis (NTA)
4.4. Total RNA Purification
4.5. Small RNA Sequencing Workflow
4.6. Biomarker Validation Study
4.7. Bioinformatics and Statistical Analysis
- -
- Detection and filtering out of all miRNAs perturbations linked to expected physiological variations, that are known to be present during different phases of lactation, by using Anova-like function from edgeR package. This analysis compared only untreated samples from each T1–T6 sampling times versus T0 sampling time.
- -
- Differential analysis (DESeq2 package) for identification of DE-miRNAs potentially related to rbST exposure, by merging six separate rbST-treated vs. untreated comparisons, considering each sampling times (T1–T6). DE-miRNAs were defined by recorded fold changes (|log2FC| ≥1) and statistical significance (p < 0.05).
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jiang, H.; Ge, X. Meat science and muscle biology symposium-mechanism of growth hormone stimulation of skeletal muscle growth in cattle. J. Anim. Sci. 2014, 92, 21–29. [Google Scholar] [CrossRef] [PubMed]
- Collier, R.J.; Romagnolo, D.; Baumgard, L.H. Lactation: Galactopoiesis, Seasonal Effects. In Encyclopedia of Dairy Sciend, 2nd ed.; Academic Press: Cambridge, MA, USA, 2011; pp. 38–44. [Google Scholar] [CrossRef]
- Soderholm, C.G.; Otterby, D.E.; Linn, J.G.; Ehle, F.R.; Wheaton, J.E.; Hansen, W.P.; Annexstad, R.J. Effects of Recombinant Bovine Somatotropin on Milk Production, Body Composition, and Physiological Parameters. J. Dairy Sci. 1988, 71, 355–365. [Google Scholar] [CrossRef] [PubMed]
- Johnson, H.D.; Li, R.; Manalu, W.; Spencer-Johnson, K.J.; Ann Becker, B.; Collier, R.J.; Baile, C.A. Effects of Somatotropin on Milk Yield and Physiological Responses During Summer Farm and Hot Laboratory Conditions. J. Dairy Sci. 1991, 74, 1250–1262. [Google Scholar] [CrossRef]
- Raux, A.; Bichon, E.; Benedetto, A.; Pezzolato, M.; Bozzetta, E.; Le Bizec, B.; Dervilly, G. The Promise and Challenges of Determining Recombinant Bovine Growth Hormone in Milk. Foods 2022, 11, 274. [Google Scholar] [CrossRef]
- Le Breton, M.H.; Rochereau-Roulet, S.; Pinel, G.; Cesbron, N.; Le Bizec, B. Elimination kinetic of recombinant somatotropin in bovine. Anal. Chim. Acta 2009, 637, 121–127. [Google Scholar] [CrossRef]
- FDA. Report on the Food and Drug Administration’s Review of the Safety of Recombinant Bovine Somatotropin; FDA: Silver Spring, MD, USA, 2009. [Google Scholar]
- Hemilä, K. COUNCIL DECISION of 17 December 1999 concerning the placing on the market and administration of bovine somatotrophin (BST) and repealing Decision 90/218/EEC. Off. J. 1999, L 331, 71–72. [Google Scholar]
- European Commission. Commission Delegated Regulation (EU) 2022/1644 of 7 July 2022 supplementing Regulation (EU) 2017/625 of the European Parliament and of the Council withspecific requirements for the performance of official controls on the use of pharmacologically actives. Off. J. Eur. Union 2022, L 248, 3–17. [Google Scholar]
- EUROPOL Illicit Trafficking in Hormonal Substances and Other Growth Promoters. Available online: https://www.europol.europa.eu/crime-areas/illicit-trafficking-in-hormonal-substances-and-other-growth-promoters (accessed on 11 June 2023).
- European Commission. Commission Implementing Regulation (EU) 2021/808 of 22 March 2021 on the performance of analytical methods for residues of pharmacologically active substances used in food-producing animals and on the interpretation of results as well as on the methods to used for sampling and repealing Decisions 2002/657/EC and 98/179/EC. Off. J. Eur. Union 2021, L 180, 84–109. [Google Scholar]
- EU. REGULATION (EU) 2017/625 OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 15 March 2017 on official controls and other official activities performed to ensure the application of food and feed law, rules on animal health and welfare, plant health and plant protection products, amending Regulations (EC) No 999/2001, (EC) No 396/2005, (EC) No 1069/2009, (EC) No 1107/2009, (EU) No 1151/2012, (EU) No 652/2014, (EU) 2016/429 and (EU) 2016/2031 of the European Parliament and of the Council, Council Regulations (EC) No 1/2005 and (EC) No 1099/2009 and Council Directives 98/58/EC, 1999/74/EC, 2007/43/EC, 2008/119/EC and 2008/120/EC, and repealing Regulations (EC) No 854/2004 and (EC) No 882/2004 of the European Parliament and of the Council, Council Directives 89/608/EEC, 89/662/EEC, 90/425/EEC, 91/496/EEC, 96/23/EC, 96/93/EC and 97/78/EC and Council Decision 92/438/EEC (Official Controls Regulation) (Text with EEA relevance). Off. J. Eur. Union 2017, L 95, 1–142. [Google Scholar]
- Ludwig, S.K.J.; Smits, N.G.E.; van der Veer, G.; Bremer, M.G.E.G.; Nielen, M.W.F. Multiple Protein Biomarker Assessment for Recombinant Bovine Somatotropin (rbST) Abuse in Cattle. PLoS ONE 2012, 7, e52917. [Google Scholar] [CrossRef]
- Rochereau-Roulet, S.; Gaudin, I.; Chéreau, S.; Prévost, S.; André-Fontaine, G.; Pinel, G.; Le Bizec, B. Development and validation of an enzyme-linked immunosorbent assay for the detection of circulating antibodies raised against growth hormone as a consequence of rbST treatment in cows. Anal. Chim. Acta 2011, 700, 189–193. [Google Scholar] [CrossRef] [PubMed]
- Smits, N.G.E.; Blokland, M.H.; Wubs, K.L.; Bovee, T.F.H.; Albada, B.; van Ginkel, L.A.; Nielen, M.W.F. Detection of methionine- and alanine-recombinant bovine somatotropins and their induced antibodies in serum and milk of cows suggests blood-milk barrier specificity for these compounds. J. Dairy Sci. 2021, 104, 5069–5078. [Google Scholar] [CrossRef] [PubMed]
- Smits, N.G.E.; Blokland, M.H.; Wubs, K.L.; Nessen, M.A.; Van Ginkel, L.A.; Nielen, M.W.F. Monolith immuno-affinity enrichment liquid chromatography tandem mass spectrometry for quantitative protein analysis of recombinant bovine somatotropin in serum. Anal. Bioanal. Chem. 2015, 407, 6041–6050. [Google Scholar] [CrossRef] [PubMed]
- Robert, C.; Huet, A.C.; Suárez-Pantaleón, C.; Brasseur, A.; Delahaut, P.; Gillard, N. Development of a confirmatory method for detecting recombinant bovine somatotropin in plasma by immunomagnetic precipitation followed by ultra-high performance liquid chromatography coupled to tandem mass spectrometry. Food Addit. Contam. Part A Chem. Anal. Control Expo. Risk Assess. 2017, 34, 1925–1934. [Google Scholar] [CrossRef]
- Dervilly-Pinel, G.; Prévost, S.; Monteau, F.; Le Bizec, B. Analytical strategies to detect use of recombinant bovine somatotropin in food-producing animals. TrAC—Trends Anal. Chem. 2014, 53, 1–10. [Google Scholar] [CrossRef]
- Regal, P.; Lamas, A.; Fente, C.A.; Franco, C.M.; Cepeda, A. Tracing (r)bST in cattle: Liquid-based options for extraction and separation. J. Liq. Chromatogr. Relat. Technol. 2017, 40, 541–548. [Google Scholar] [CrossRef]
- Arrizabalaga Larranaga, A.; Groot, M.J.; Blokland, M.H.; Barbu, I.M.; Smits, N.G.E.; Sterk, S.S. EURL Reflection Paper 2.0: Natural Growth Promoting Substances in Biological Samples: Presence—And Formation—Of Hormones and Other Growth Promoting Substances in Food Producing Animals; Wageningen Food Safety Research: Wageningen, Germany, 2022. [Google Scholar]
- Benedetto, A.; Pezzolato, M.; Biasibetti, E.; Bozzetta, E. Omics applications in the fight against abuse of anabolic substances in cattle: Challenges, perspectives and opportunities. Curr. Opin. Food Sci. 2021, 40, 112–120. [Google Scholar] [CrossRef]
- Lamas, A.; Regal, P.; Vazquez, B.; Miranda, J.M.; Cepeda, A.; Franco, C.M. Tracing recombinant bovine somatotropin ab(use) through gene expression in blood, hair follicles, and milk somatic cells: A matrix comparison. Molecules 2018, 23, 1708. [Google Scholar] [CrossRef]
- Lamas, A.; Regal, P.; Vázquez, B.; Miranda, J.M.; Cepeda, A.; Franco, C.M. Tracing recombinant bovine somatotropin ab(use) through transcriptomics: The potential of bovine somatic cells in a multi-dose longitudinal study. Sci. Rep. 2019, 9, 4788. [Google Scholar] [CrossRef]
- Benmoussa, A.; Laugier, J.; Beauparlant, C.J.; Lambert, M.; Droit, A.; Provost, P. Complexity of the microRNA transcriptome of cow milk and milk-derived extracellular vesicles isolated via differential ultracentrifugation. J. Dairy Sci. 2020, 103, 16–29. [Google Scholar] [CrossRef]
- Izumi, H.; Tsuda, M.; Sato, Y.; Kosaka, N.; Ochiya, T.; Iwamoto, H.; Namba, K.; Takeda, Y. Bovine milk exosomes contain microRNA and mRNA and are taken up by human macrophages. J. Dairy Sci. 2015, 98, 2920–2933. [Google Scholar] [CrossRef] [PubMed]
- Melnik, B.C.; Schmitz, G. Exosomes of pasteurized milk: Potential pathogens of Western diseases 06 Biological Sciences 0601 Biochemistry and Cell Biology. J. Transl. Med. 2019, 17, 3. [Google Scholar] [CrossRef]
- Van Arendonk, J.A.M.; Liinamo, A.E. Dairy cattle production in Europe. Theriogenology 2003, 59, 563–569. [Google Scholar] [CrossRef]
- Barreiro, R.; Lamas, A.; Miranda, J.M.; Franco, C.M.; Cepeda, A.; Regal, P. Impact of Recombinant Bovine Somatotropin on Bovine Milk Composition and Fatty Acidome: A Multidose Longitudinal Study. Foods 2022, 11, 3477. [Google Scholar] [CrossRef] [PubMed]
- Mooney, M.H.; Situ, C.; Cacciatore, G.; Hutchinson, T.; Elliott, C.; Bergwerff, A.A. Plasma biomarker profiling in the detection of growth promoter use in calves. Biomarkers 2008, 13, 246–256. [Google Scholar] [CrossRef] [PubMed]
- Cacciatore, G.; Eisenberg, S.W.F.; Situ, C.; Mooney, M.H.; Delahaut, P.; Klarenbeek, S.; Huet, A.C.; Bergwerff, A.A.; Elliott, C.T. Effect of growth-promoting 17β-estradiol, 19-nortestosterone and dexamethasone on circulating levels of nine potential biomarker candidates in veal calves. Anal. Chim. Acta 2009, 637, 351–359. [Google Scholar] [CrossRef]
- Pinel, G.; Weigel, S.; Antignac, J.P.; Mooney, M.H.; Elliott, C.; Nielen, M.W.F.; Le Bizec, B. Targeted and untargeted profiling of biological fluids to screen for anabolic practices in cattle. TrAC—Trends Anal. Chem. 2010, 29, 1269–1280. [Google Scholar] [CrossRef]
- Vrijens, K.; Bollati, V.; Nawrot, T.S. MicroRNAs as potential signatures of environmental exposure or effect: A systematic review. Environ. Health Perspect. 2015, 123, 399–411. [Google Scholar] [CrossRef]
- Luoreng, Z.M.; Wang, X.P.; Mei, C.G.; Zan, L. Sen Comparison of microRNA profiles between bovine mammary glands infected with Staphylococcus aureus and Escherichia coli. Int. J. Biol. Sci. 2018, 14, 87–99. [Google Scholar] [CrossRef]
- Miretti, S.; Lecchi, C.; Ceciliani, F.; Baratta, M. MicroRNAs as Biomarkers for Animal Health and Welfare in Livestock. Front. Vet. Sci. 2020, 7, 578193. [Google Scholar] [CrossRef]
- Howard, K.M.; Jati Kusuma, R.; Baier, S.R.; Friemel, T.; Markham, L.; Vanamala, J.; Zempleni, J. Loss of miRNAs during processing and storage of cow’s (Bos taurus) milk. J. Agric. Food Chem. 2015, 63, 588–592. [Google Scholar] [CrossRef] [PubMed]
- Benmoussa, A.; Provost, P. Milk MicroRNAs in Health and Disease. Compr. Rev. Food Sci. Food Saf. 2019, 18, 703–722. [Google Scholar] [CrossRef] [PubMed]
- Samuel, M.; Chisanga, D.; Liem, M.; Keerthikumar, S.; Anand, S.; Ang, C.S.; Adda, C.G.; Versteegen, E.; Jois, M.; Mathivanan, S. Bovine milk-derived exosomes from colostrum are enriched with proteins implicated in immune response and growth. Sci. Rep. 2017, 7, 5933. [Google Scholar] [CrossRef]
- Sanwlani, R.; Fonseka, P.; Chitti, S.V.; Mathivanan, S. Milk-derived extracellular vesicles in inter-organism, cross-species communication and drug delivery. Proteomes 2020, 8, 11. [Google Scholar] [CrossRef]
- Saenz-de-Juano, M.D.; Silvestrelli, G.; Ulbrich, S.E. Circadian Rhythm Does Not Affect the miRNA Cargo of Bovine Raw Milk Extracellular Vesicles. Int. J. Mol. Sci. 2023, 24, 10210. [Google Scholar] [CrossRef]
- Leduc, A.; Le Guillou, S.; Laloë, D.; Herve, L.; Laubier, J.; Poton, P.; Faulconnier, Y.; Pires, J.; Gele, M.; Martin, P.; et al. MiRNome variations in milk fractions during feed restrictions of different intensities in dairy cows. BMC Genom. 2023, 24, 680. [Google Scholar] [CrossRef]
- Do, D.N.; Li, R.; Dudemaine, P.L.; Ibeagha-Awemu, E.M. MicroRNA roles in signalling during lactation: An insight from differential expression, time course and pathway analyses of deep sequence data. Sci. Rep. 2017, 7, 44605. [Google Scholar] [CrossRef]
- Lee, J.; Lee, S.; Son, J.; Lim, H.; Kim, E.; Kim, D.; Ha, S.; Hur, T.; Lee, S.; Choi, I. Analysis of circulating-microRNA expression in lactating Holstein cows under summer heat stress. PLoS ONE 2020, 15, e0231125. [Google Scholar] [CrossRef]
- Benedetto, A.; Biasibetti, E.; Robotti, E.; Marengo, E.; Audino, V.; Bozzetta, E.; Pezzolato, M. Transcriptional Biomarkers and Immunohistochemistry for Detection of Illicit Dexamethasone Administration in Veal Calves. Foods 2022, 11, 1810. [Google Scholar] [CrossRef]
- Hu, C.; Feng, X.; Ma, Y.; Wei, D.; Zhang, L.; Wang, S.; Ma, Y. CircADAMTS16 Inhibits Differentiation and Promotes Proliferation of Bovine Adipocytes by Targeting miR-10167-3p. Cells 2023, 12, 1175. [Google Scholar] [CrossRef]
- Wang, P.; Li, X.; Zhu, Y.; Wei, J.; Zhang, C.; Kong, Q.; Nie, X.; Zhang, Q.; Wang, Z. Genome-wide association analysis of milk production, somatic cell score, and body conformation traits in Holstein cows. Front. Vet. Sci. 2022, 9, 932034. [Google Scholar] [CrossRef]
- Hu, C.; Yang, M.; Feng, X.; Wang, S.; Ma, Y.; Ma, Y. miR-10167-3p targets TCF7L1 to inhibit bovine adipocyte differentiation and promote bovine adipocyte proliferation. Genomics 2024, 116, 110903. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.M.; Nakanishi, R.; Tsukada, F.; Takashima, S.; Wakihara, Y.; Kamatari, Y.O.; Shimizu, K.; Okada, A.; Inoshima, Y. Identification of Suitable Internal Control miRNAs in Bovine Milk Small Extracellular Vesicles for Normalization in Quantitative Real-Time Polymerase Chain Reaction. Membranes 2023, 13, 185. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Beccuti, M.; Cordero, F.; Arigoni, M.; Panero, R.; Amparore, E.G.; Donatelli, S.; Calogero, R.A. SeqBox: RNAseq/ChIPseq reproducible analysis on a consumer game computer. Bioinformatics 2018, 34, 871–872. [Google Scholar] [CrossRef]
miRNA | miRbase Accession | Sequence | Taqman Assay ID |
---|---|---|---|
bta-miR-29a | MIMAT0003518 | CUAGCACCAUCUGAAAUCGGUUA | 007600 |
bta-miR-200a | MIMAT0003822 | UAACACUGUCUGGUAACGAUGUU | 006209 |
bta-miR-26b | MIMAT0003531 | UUCAAGUAAUUCAGGAUAGGUU | 000406 |
bta-miR-27b | MIMAT0003546 | UUCACAGUGGCUAAGUUCUGC | 000409 |
bta-miR-30b-5p | MIMAT0003547 | UGUAAACAUCCUACACUCAGCU | 000602 |
bta-miR-10167-3p | MIMAT0040914 | CGGGUGGUCGGGGCGGGUCAG | CS7FHME |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Benedetto, A.; Giaccio, N.; Arigoni, M.; Calogero, R.A.; Regal, P.; Lamas, A.; Martucci, F.; Audino, V.; Dervilly, G.; Pezzolato, M.; et al. miRNome Characterization of Milk-Derived Extracellular Vesicles in Recombinant Somatotropin-Treated Dairy Cows. Int. J. Mol. Sci. 2025, 26, 2437. https://doi.org/10.3390/ijms26062437
Benedetto A, Giaccio N, Arigoni M, Calogero RA, Regal P, Lamas A, Martucci F, Audino V, Dervilly G, Pezzolato M, et al. miRNome Characterization of Milk-Derived Extracellular Vesicles in Recombinant Somatotropin-Treated Dairy Cows. International Journal of Molecular Sciences. 2025; 26(6):2437. https://doi.org/10.3390/ijms26062437
Chicago/Turabian StyleBenedetto, Alessandro, Nunzia Giaccio, Maddalena Arigoni, Raffaele Adolfo Calogero, Patricia Regal, Alexandre Lamas, Francesca Martucci, Valentina Audino, Gaud Dervilly, Marzia Pezzolato, and et al. 2025. "miRNome Characterization of Milk-Derived Extracellular Vesicles in Recombinant Somatotropin-Treated Dairy Cows" International Journal of Molecular Sciences 26, no. 6: 2437. https://doi.org/10.3390/ijms26062437
APA StyleBenedetto, A., Giaccio, N., Arigoni, M., Calogero, R. A., Regal, P., Lamas, A., Martucci, F., Audino, V., Dervilly, G., Pezzolato, M., & Bozzetta, E. (2025). miRNome Characterization of Milk-Derived Extracellular Vesicles in Recombinant Somatotropin-Treated Dairy Cows. International Journal of Molecular Sciences, 26(6), 2437. https://doi.org/10.3390/ijms26062437