Selective Transcription Factor Blockade Reduces Human Retinal Endothelial Cell Expression of Intercellular Adhesion Molecule-1 and Leukocyte Binding
Abstract
1. Introduction
2. Results
2.1. Candidate Transcription Factors Induced in Cytokine-Activated Human Retinal Endothelial Cells: C2CD4B, EGR3, FOSB, IRF1, and JUNB
2.2. Priority Candidate Transcription Factor Targets for Drugging Leukocyte Interactions with Activated Human Retinal Endothelial Cells: C2CD4B and IRF1
2.3. Effect of C2CD4B and IRF1 Targeting on Leukocyte Interactions with Human Retinal Endothelial Cells
3. Discussion
4. Materials and Methods
4.1. Selection of Transcription Factor Candidates
4.2. Human Retinal Endothelial Cells
4.3. Small Interfering RNA, Recombinant Cytokines and Monoclonal Antibodies
4.4. RNA Silencing
4.5. RNA Extraction and Reverse Transcription
4.6. Real-Time Polymerase Chain Reaction
4.7. Membrane-Bound Intercellular Adhesion Molecule-1 Immunoassay
4.8. Leukocyte Binding Assay
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Smith, J.R.; Lai, T.Y.Y. Managing uveitis during the COVID-19 pandemic. Ophthalmology 2020, 127, e65–e67. [Google Scholar] [CrossRef] [PubMed]
- Durrani, O.M.; Tehrani, N.N.; Marr, J.E.; Moradi, P.; Stavrou, P.; Murray, P.I. Degree, duration, and causes of visual loss in uveitis. Br. J. Ophthalmol. 2004, 88, 1159–1162. [Google Scholar] [CrossRef] [PubMed]
- Gangaputra, S.; Newcomb, C.W.; Liesegang, T.L.; Kacmaz, R.O.; Jabs, D.A.; Levy-Clarke, G.A.; Nussenblatt, R.B.; Rosenbaum, J.T.; Suhler, E.B.; Thorne, J.E.; et al. Methotrexate for ocular inflammatory diseases. Ophthalmology 2009, 116, 2188–2198.e1. [Google Scholar] [CrossRef] [PubMed]
- Daniel, E.; Thorne, J.E.; Newcomb, C.W.; Pujari, S.S.; Kacmaz, R.O.; Levy-Clarke, G.A.; Nussenblatt, R.B.; Rosenbaum, J.T.; Suhler, E.B.; Foster, C.S.; et al. Mycophenolate mofetil for ocular inflammation. Am. J. Ophthalmol. 2010, 149, 423–432.e2. [Google Scholar] [CrossRef] [PubMed]
- Pasadhika, S.; Kempen, J.H.; Newcomb, C.W.; Liesegang, T.L.; Pujari, S.S.; Rosenbaum, J.T.; Thorne, J.E.; Foster, C.S.; Jabs, D.A.; Levy-Clarke, G.A.; et al. Azathioprine for ocular inflammatory diseases. Am. J. Ophthalmol. 2009, 148, 500–509.e2. [Google Scholar] [CrossRef]
- Kacmaz, R.O.; Kempen, J.H.; Newcomb, C.; Daniel, E.; Gangaputra, S.; Nussenblatt, R.B.; Rosenbaum, J.T.; Suhler, E.B.; Thorne, J.E.; Jabs, D.A.; et al. Cyclosporine for ocular inflammatory diseases. Ophthalmology 2010, 117, 576–584. [Google Scholar] [CrossRef]
- Ferreira, L.B.; Smith, A.J.; Smith, J.R. Biologic drugs for the treatment of noninfectious uveitis. Asia. Pac. J. Ophthalmol. 2021, 10, 63–73. [Google Scholar] [CrossRef]
- Nourshargh, S.; Alon, R. Leukocyte migration into inflamed tissues. Immunity 2014, 41, 694–707. [Google Scholar] [CrossRef]
- Wang, J.; Ibrahim, M.; Turkcuoglu, P.; Hatef, E.; Khwaja, A.; Channa, R.; Do, D.V.; Nguyen, Q.D. Intercellular adhesion molecule inhibitors as potential therapy for refractory uveitic macular edema. Ocul. Immunol. Inflamm. 2010, 18, 395–398. [Google Scholar] [CrossRef]
- Faia, L.J.; Sen, H.N.; Li, Z.; Yeh, S.; Wroblewski, K.J.; Nussenblatt, R.B. Treatment of inflammatory macular edema with humanized anti-CD11a antibody therapy. Investig. Ophthalmol. Vis. Sci. 2011, 52, 6919–6924. [Google Scholar] [CrossRef]
- Shirani, A.; Stuve, O. Natalizumab for multiple sclerosis: A case in point for the impact of translational neuroimmunology. J. Immunol. 2017, 198, 1381–1386. [Google Scholar] [CrossRef] [PubMed]
- Major, E.O. Progressive multifocal leukoencephalopathy in patients on immunomodulatory therapies. Annu. Rev. Med. 2010, 61, 35–47. [Google Scholar] [CrossRef] [PubMed]
- Bharadwaj, A.S.; Appukuttan, B.; Wilmarth, P.A.; Pan, Y.; Stempel, A.J.; Chipps, T.J.; Benedetti, E.E.; Zamora, D.O.; Choi, D.; David, L.L.; et al. Role of the retinal vascular endothelial cell in ocular disease. Prog. Retin. Eye Res. 2013, 32, 102–180. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.R.; Choi, D.; Chipps, T.J.; Pan, Y.; Zamora, D.O.; Davies, M.H.; Babra, B.; Powers, M.R.; Planck, S.R.; Rosenbaum, J.T. Unique gene expression profiles of donor-matched human retinal and choroidal vascular endothelial cells. Investig. Ophthalmol. Vis. Sci. 2007, 48, 2676–2684. [Google Scholar] [CrossRef]
- Smith, J.R.; David, L.L.; Appukuttan, B.; Wilmarth, P.A. Angiogenic and immunologic proteins identified by deep proteomic profiling of human retinal and choroidal vascular endothelial cells: Potential targets for new biologic drugs. Am. J. Ophthalmol. 2018, 193, 197–229. [Google Scholar] [CrossRef]
- Singh, M.; Thakur, M.; Mishra, M.; Yadav, M.; Vibhuti, R.; Menon, A.M.; Nagda, G.; Dwivedi, V.P.; Dakal, T.C.; Yadav, V. Gene regulation of intracellular adhesion molecule-1 (ICAM-1): A molecule with multiple functions. Immunol. Lett. 2021, 240, 123–136. [Google Scholar] [CrossRef]
- Ashander, L.M.; Appukuttan, B.; Ma, Y.; Gardner-Stephen, D.; Smith, J.R. Targeting endothelial adhesion molecule transcription for treatment of inflammatory disease: A proof-of-concept study. Mediators Inflamm. 2016, 2016, 7945848. [Google Scholar] [CrossRef]
- Ryan, F.J.; Ma, Y.; Ashander, L.M.; Kvopka, M.; Appukuttan, B.; Lynn, D.J.; Smith, J.R. Transcriptomic responses of human retinal vascular endothelial cells to inflammatory cytokines. Transl. Vis. Sci. Technol. 2022, 11, 27. [Google Scholar] [CrossRef]
- Warton, K.; Foster, N.C.; Gold, W.A.; Stanley, K.K. A novel gene family induced by acute inflammation in endothelial cells. Gene 2004, 342, 85–95. [Google Scholar] [CrossRef] [PubMed]
- Wieland, G.D.; Nehmann, N.; Muller, D.; Eibel, H.; Siebenlist, U.; Suhnel, J.; Zipfel, P.F.; Skerka, C. Early growth response proteins EGR-4 and EGR-3 interact with immune inflammatory mediators NF-kappaB p50 and p65. J. Cell Sci. 2005, 118, 3203–3212. [Google Scholar] [CrossRef] [PubMed]
- Franscini, N.; Bachli, E.B.; Blau, N.; Leikauf, M.S.; Schaffner, A.; Schoedon, G. Gene expression profiling of inflamed human endothelial cells and influence of activated protein C. Circulation 2004, 110, 2903–2909. [Google Scholar] [CrossRef] [PubMed]
- Wildner, G.; Kaufmann, U. What causes relapses of autoimmune diseases? The etiological role of autoreactive T cells. Autoimmun. Rev. 2013, 12, 1070–1075. [Google Scholar] [CrossRef]
- Papavassiliou, A.G. Molecular medicine. Transcription factors. N. Engl. J. Med. 1995, 332, 45–47. [Google Scholar] [CrossRef] [PubMed]
- Papavassiliou, K.A.; Papavassiliou, A.G. Transcription factor drug targets. J. Cell. Biochem. 2016, 117, 2693–2696. [Google Scholar] [CrossRef] [PubMed]
- Su, B.G.; Henley, M.J. Drugging fuzzy complexes in transcription. Front. Mol. Biosci. 2021, 8, 795743. [Google Scholar] [CrossRef] [PubMed]
- Henley, M.J.; Koehler, A.N. Advances in targeting “undruggable” transcription factors with small molecules. Nat. Rev. Drug Discov. 2021, 20, 669–688. [Google Scholar] [CrossRef] [PubMed]
- Das, S.; Bano, S.; Kapse, P.; Kundu, G.C. CRISPR based therapeutics: A new paradigm in cancer precision medicine. Mol. Cancer 2022, 21, 85. [Google Scholar] [CrossRef]
- Bushweller, J.H. Targeting transcription factors in cancer—From undruggable to reality. Nat. Rev. Cancer 2019, 19, 611–624. [Google Scholar] [CrossRef]
- Dupuis, J.; Langenberg, C.; Prokopenko, I.; Saxena, R.; Soranzo, N.; Jackson, A.U.; Wheeler, E.; Glazer, N.; Bouatia-Naji, N.; Gloyn, A.; et al. New genetic loci implicated in fasting glucose homeostasis and their impact on type 2 diabetes risk. Nat. Genet. 2010, 42, 105–116. [Google Scholar] [CrossRef]
- Kycia, I.; Wolford, B.N.; Huyghe, J.R.; Fuchsberger, C.; Vadlamudi, S.; Kursawe, R.; Welch, R.P.; Albanus, R.O.; Uyar, A.; Khetan, S.; et al. A common type 2 diabetes risk variant potentiates activity of an evolutionarily conserved islet stretch enhancer and increases C2CD4A and C2CD4B expression. Am. J. Hum. Genet. 2018, 102, 620–635. [Google Scholar] [CrossRef] [PubMed]
- Mousavy Gharavy, S.N.; Owen, B.M.; Millership, S.J.; Chabosseau, P.; Pizza, G.; Martinez-Sanchez, A.; Tasoez, E.; Georgiadou, E.; Hu, M.; Fine, N.H.F.; et al. Sexually dimorphic roles for the type 2 diabetes-associated C2cd4b gene in murine glucose homeostasis. Diabetologia 2021, 64, 850–864. [Google Scholar] [CrossRef] [PubMed]
- Sabater-Lleal, M.; Huffman, J.E.; de Vries, P.S.; Marten, J.; Mastrangelo, M.A.; Song, C.; Pankratz, N.; Ward-Caviness, C.K.; Yanek, L.R.; Trompet, S.; et al. Genome-wide association transethnic meta-analyses identifies novel associations regulating coagulation factor VIII and von Willebrand factor plasma levels. Circulation 2019, 139, 620–635. [Google Scholar] [CrossRef] [PubMed]
- Duh, E.J.; Sun, J.K.; Stitt, A.W. Diabetic retinopathy: Current understanding, mechanisms, and treatment strategies. JCI Insight 2017, 2, e93751. [Google Scholar] [CrossRef] [PubMed]
- Roubeix, C.; Dominguez, E.; Raoul, W.; Guillonneau, X.; Paques, M.; Sahel, J.A.; Sennlaub, F. Mo-derived perivascular macrophage recruitment protects against endothelial cell death in retinal vein occlusion. J. Neuroinflammation 2019, 16, 157. [Google Scholar] [CrossRef] [PubMed]
- Dou, L.; Liang, H.F.; Geller, D.A.; Chen, Y.F.; Chen, X.P. The regulation role of interferon regulatory factor-1 gene and clinical relevance. Hum. Immunol. 2014, 75, 1110–1114. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.J.; Kang, S.W.; Song, J.K.; Baek, H.J.; Choi, H.J.; Bae, Y.D.; Ryu, H.J.; Lee, E.Y.; Lee, E.B.; Song, Y.W. Associations between interferon regulatory factor-1 polymorphisms and Behcet’s disease. Hum. Immunol. 2007, 68, 770–778. [Google Scholar] [CrossRef]
- Guo, Y.; Gu, R.; Gan, D.; Hu, F.; Li, G.; Xu, G. Mitochondrial DNA drives noncanonical inflammation activation via cGAS-STING signaling pathway in retinal microvascular endothelial cells. Cell. Commun. Signal 2020, 18, 172. [Google Scholar] [CrossRef]
- Gun, S.Y.; Claser, C.; Teo, T.H.; Howland, S.W.; Poh, C.M.; Chye, R.R.Y.; Ng, L.F.; Rénia, L. Interferon regulatory factor 1 is essential for pathogenic CD8+ T cell migration and retention in the brain during experimental cerebral malaria. Cell. Microbiol. 2018, 20, e12819. [Google Scholar] [CrossRef]
- Yan, R.; van Meurs, M.; Popa, E.R.; Jongman, R.M.; Zwiers, P.J.; Niemarkt, A.E.; Kuiper, T.; Kamps, J.A.; Heeringa, P.; Zijlstra, J.G.; et al. Endothelial interferon regulatory factor 1 regulates lipopolysaccharide-induced VCAM-1 expression independent of NFkappaB. J. Innate. Immun. 2017, 9, 546–560. [Google Scholar] [CrossRef]
- Lin, S.; Lin, Y.; Nery, J.R.; Urich, M.A.; Breschi, A.; Davis, C.A.; Dobin, A.; Zaleski, C.; Beer, M.A.; Chapman, W.C.; et al. Comparison of the transcriptional landscapes between human and mouse tissues. Proc. Natl. Acad. Sci. USA 2014, 111, 17224–17229. [Google Scholar] [CrossRef]
- Zundler, S.; Becker, E.; Schulze, L.L.; Neurath, M.F. Immune cell trafficking and retention in inflammatory bowel disease: Mechanistic insights and therapeutic advances. Gut 2019, 68, 1688–1700. [Google Scholar] [CrossRef] [PubMed]
- Sohail, A.; Mushtaq, A.; Iftikhar, A.; Warraich, Z.; Kurtin, S.E.; Tenneti, P.; McBride, A.; Anwer, F. Emerging immune targets for the treatment of multiple myeloma. Immunotherapy 2018, 10, 265–282. [Google Scholar] [CrossRef] [PubMed]
- Wei, H.; Wang, Z.; Kuang, Y.; Wu, Z.; Zhao, S.; Zhang, Z.; Li, H.; Zheng, M.; Zhang, N.; Long, C.; et al. Intercellular adhesion molecule-1 as target for CAR-T-cell therapy of triple-negative breast cancer. Front. Immunol. 2020, 11, 573823. [Google Scholar] [CrossRef] [PubMed]
- Roki, N.; Tsinas, Z.; Solomon, M.; Bowers, J.; Getts, R.C.; Muro, S. Unprecedently high targeting specificity toward lung ICAM-1 using 3DNA nanocarriers. J. Control. Release 2019, 305, 41–49. [Google Scholar] [CrossRef]
- Muller, W.A. Mechanisms of leukocyte transendothelial migration. Annu. Rev. Pathol. 2011, 6, 323–344. [Google Scholar] [CrossRef] [PubMed]
- Bharadwaj, A.S.; Schewitz-Bowers, L.P.; Wei, L.; Lee, R.W.; Smith, J.R. Intercellular adhesion molecule 1 mediates migration of Th1 and Th17 cells across human retinal vascular endothelium. Investig. Ophthalmol. Vis. Sci. 2013, 54, 6917–6925. [Google Scholar] [CrossRef]
- Bharadwaj, A.S.; Stempel, A.J.; Olivas, A.; Franzese, S.E.; Ashander, L.M.; Ma, Y.; Lie, S.; Appukuttan, B.; Smith, J.R. Molecular signals involved in human B cell migration into the retina: In vitro investigation of ICAM-1, VCAM-1, and CXCL13. Ocul. Immunol. Inflamm. 2017, 25, 811–819. [Google Scholar] [CrossRef]
- Smith, J.R.; Chipps, T.J.; Ilias, H.; Pan, Y.; Appukuttan, B. Expression and regulation of activated leukocyte cell adhesion molecule in human retinal vascular endothelial cells. Exp. Eye Res. 2012, 104, 89–93. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
- Benjamini, Y.H.Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Series B Stat. Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Sayers, E.W.; Bolton, E.E.; Brister, J.R.; Canese, K.; Chan, J.; Comeau, D.C.; Connor, R.; Funk, K.; Kelly, C.; Kim, S.; et al. Database resources of the national center for biotechnology information. Nucleic Acids Res. 2022, 50, D20–D26. [Google Scholar] [CrossRef] [PubMed]
- McKusick, V.A. Meddelian Inheritance in Man, 12th ed.; Johns Hopkins University Press: Baltimore, MD, USA, 1998. [Google Scholar]
- Smith, J.R.; Ashander, L.M.; Ma, Y.; Rochet, E.; Furtado, J.M. Model systems for studying mechanisms of ocular toxoplasmosis. Methods Mol. Biol. 2020, 2071, 297–321. [Google Scholar] [CrossRef] [PubMed]
- Halbert, C.L.; Demers, G.W.; Galloway, D.A. The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. J. Virol. 1991, 65, 473–478. [Google Scholar] [CrossRef] [PubMed]
- Brown, G.R.; Hem, V.; Katz, K.S.; Ovetsky, M.; Wallin, C.; Ermolaeva, O.; Tolstoy, I.; Tatusova, T.; Pruitt, K.D.; Maglott, D.R.; et al. Gene: A gene-centered information resource at NCBI. Nucleic Acids Res. 2015, 43, D36–D42. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Xie, J.; Liu, X.; Li, Y.; Liu, Y.; Su, G. Validation of RT-qPCR reference genes and determination of Robo4 expression levels in human retinal endothelial cells under hypoxia and/or hyperglycemia. Gene 2016, 585, 135–142. [Google Scholar] [CrossRef]
- Turkyilmaz, E.; Guner, H.; Erdem, M.; Erdem, A.; Biri, A.A.; Konac, E.; Alp, E.; Onen, H.I.; Menevse, S. NLF2 gene expression in the endometrium of patients with implantation failure after IVF treatment. Gene 2012, 508, 140–143. [Google Scholar] [CrossRef]
- Zhang, S.; Xia, C.; Xu, C.; Liu, J.; Zhu, H.; Yang, Y.; Xu, F.; Zhao, J.; Chang, Y.; Zhao, Q. Early growth response 3 inhibits growth of hepatocellular carcinoma cells via upregulation of Fas ligand. Int. J. Oncol. 2017, 50, 805–814. [Google Scholar] [CrossRef]
- Holmes, D.I.; Zachary, I. Placental growth factor induces FosB and c-Fos gene expression via Flt-1 receptors. FEBS Lett. 2004, 557, 93–98. [Google Scholar] [CrossRef]
- Lu, Y.; Fukuda, K.; Nakamura, Y.; Kimura, K.; Kumagai, N.; Nishida, T. Inhibitory effect of triptolide on chemokine expression induced by proinflammatory cytokines in human corneal fibroblasts. Investig. Ophthalmol. Vis. Sci. 2005, 46, 2346–2352. [Google Scholar] [CrossRef]
- Moon, J.W.; Kong, S.K.; Kim, B.S.; Kim, H.J.; Lim, H.; Noh, K.; Kim, Y.; Choi, J.W.; Lee, J.H.; Kim, Y.S. IFNγ induces PD-L1 overexpression by JAK2/STAT1/IRF-1 signaling in EBV-positive gastric carcinoma. Sci. Rep. 2017, 7, 17810. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.F.; Li, R. JunB potentiates function of BRCA1 activation domain 1 (AD1) through a coiled-coil-mediated interaction. Genes Dev. 2002, 16, 1509–1517. [Google Scholar] [CrossRef] [PubMed]
- Lie, S.; Rochet, E.; Segerdell, E.; Ma, Y.; Ashander, L.M.; Shadforth, A.M.A.; Blenkinsop, T.A.; Michael, M.Z.; Appukuttan, B.; Wilmot, B.; et al. Immunological molecular responses of human retinal pigment epithelial cells to infection with Toxoplasma gondii. Front. Immunol. 2019, 10, 708. [Google Scholar] [CrossRef] [PubMed]
Ensembl Gene ID | Gene Symbol | Description | Treatment with IL-1β | Treatment with TNF-α | ||
---|---|---|---|---|---|---|
log2 Fold Change | FDR | log2 Fold Change | FDR | |||
ENSG00000226380 | AC016831.1 | novel transcript | 1.38 | 1.81 × 10−7 | 1.06 | 1.83 × 10−5 |
ENSG00000253837 | AC090197.1 | novel transcript | 1.51 | 2.74 × 10−7 | 1.55 | 2.51 × 10−7 |
ENSG00000269902 | AC234772.2 | novel transcript | 1.52 | 2.65 × 10−4 | 1.23 | 5.35 × 10−3 |
ENSG00000269906 | AL606834.1 | novel transcript, sense intronic to SAV1 | 1.19 | 8.21 × 10−4 | 1.14 | 1.93 × 10−3 |
ENSG00000279903 | AP006248.3 | SLC7A2 intronic transcript 1 | 2.88 | 2.28 × 10−5 | 2.69 | 8.16 × 10−5 |
ENSG00000279932 | AP006248.4 | novel transcript, sense intronic SLC7A2 | 2.37 | 3.32 × 10−4 | 2.31 | 6.35 × 10−4 |
ENSG00000162772 | ATF3 | activating transcription factor 3 | 1.87 | 5.22 × 10−4 | 1.50 | 7.87 × 10−3 |
ENSG00000095739 | BAMBI | BMP and activin membrane bound inhibitor | 1.36 | 2.73 × 10−3 | 1.16 | 1.89 × 10−2 |
ENSG00000140379 | BCL2A1 | BCL2 related protein A1 | 2.49 | 1.77 × 10−4 | 1.98 | 5.17 × 10−3 |
ENSG00000023445 | BIRC3 | baculoviral IAP repeat containing 3 | 3.13 | 4.15 × 10−6 | 2.61 | 6.87 × 10−5 |
ENSG00000159388 | BTG2 | BTG anti-proliferation factor 2 | 1.60 | 2.07 × 10−5 | 1.18 | 1.74 × 10−3 |
ENSG00000205502 | C2CD4B | C2 calcium dependent domain containing 4B | 3.56 | 7.38 × 10−9 | 3.34 | 3.14 × 10−8 |
ENSG00000108691 | CCL2 | C-C motif chemokine ligand 2 | 1.95 | 1.87 × 10−3 | 1.82 | 5.51 × 10−3 |
ENSG00000115009 | CCL20 | C-C motif chemokine ligand 20 | 6.15 | 7.28 × 10−9 | 5.14 | 2.06 × 10−7 |
ENSG00000110848 | CD69 | CD69 molecule | 4.10 | 1.83 × 10−9 | 3.69 | 1.40 × 10−8 |
ENSG00000112149 | CD83 | CD83 molecule | 3.29 | 8.88 × 10−8 | 2.69 | 2.95 × 10−6 |
ENSG00000179862 | CITED4 | Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 | 1.47 | 1.72 × 10−2 | 1.52 | 2.04 × 10−2 |
ENSG00000164400 | CSF2 | colony stimulating factor 2 | 7.54 | 2.74 × 10−7 | 6.32 | 7.27 × 10−6 |
ENSG00000006210 | CX3CL1 | C-X3-C motif chemokine ligand 1 | 1.18 | 2.68 × 10−2 | 1.24 | 2.80 × 10−2 |
ENSG00000163739 | CXCL1 | C-X-C motif chemokine ligand 1 | 3.08 | 3.27 × 10−6 | 2.78 | 1.89 × 10−5 |
ENSG00000081041 | CXCL2 | C-X-C motif chemokine ligand 2 | 5.97 | 2.73 × 10−9 | 5.07 | 3.05 × 10−8 |
ENSG00000163734 | CXCL3 | C-X-C motif chemokine ligand 3 | 6.15 | 2.12 × 10−11 | 5.36 | 2.52 × 10−10 |
ENSG00000169429 | CXCL8 | C-X-C motif chemokine ligand 8 | 3.11 | 1.50 × 10−5 | 2.87 | 5.41 × 10−5 |
ENSG00000169242 | EFNA1 | ephrin A1 | 2.44 | 8.23 × 10−7 | 2.34 | 2.64 × 10−6 |
ENSG00000235947 | EGOT | eosinophil granule ontogeny transcript | 3.34 | 2.46 × 10−7 | 2.73 | 9.42 × 10−6 |
ENSG00000179388 | EGR3 | early growth response 3 | 1.60 | 7.94 × 10−3 | 1.40 | 3.28 × 10−2 |
ENSG00000117525 | F3 | coagulation factor III, tissue factor | 2.39 | 4.24 × 10−3 | 2.07 | 2.28 × 10−2 |
ENSG00000125740 | FOSB | FosB proto-oncogene, AP-1 transcription factor subunit | 2.09 | 3.44 × 10−3 | 1.78 | 2.25 × 10−2 |
ENSG00000164949 | GEM | GTP binding protein overexpressed in skeletal muscle | 2.80 | 3.87 × 10−7 | 1.98 | 1.05 × 10−4 |
ENSG00000090339 | ICAM1 | intercellular adhesion molecule 1 | 1.52 | 1.57 × 10−3 | 1.31 | 9.16 × 10−3 |
ENSG00000137331 | IER3 | immediate early response 3 | 2.17 | 3.52 × 10−5 | 1.68 | 1.26 × 10−3 |
ENSG00000162783 | IER5 | immediate early response 5 | 1.25 | 1.31 × 10−3 | 1.09 | 7.95 × 10−3 |
ENSG00000115604 | IL18R1 | interleukin 18 receptor 1 | 2.22 | 4.07 × 10−5 | 1.95 | 3.22 × 10−4 |
ENSG00000115008 | IL1A | interleukin 1 alpha | 3.11 | 4.29 × 10−6 | 2.70 | 4.97 × 10−5 |
ENSG00000136244 | IL6 | interleukin 6 | 2.79 | 8.46 × 10−5 | 2.29 | 1.30 × 10−3 |
ENSG00000125347 | IRF1 | interferon regulatory factor 1 | 3.21 | 3.32 × 10−8 | 2.96 | 2.06 × 10−7 |
ENSG00000171223 | JUNB | JunB proto-oncogene, AP-1 transcription factor subunit | 1.37 | 3.66 × 10−3 | 1.21 | 1.87 × 10−2 |
ENSG00000132510 | KDM6B | lysine demethylase 6B | 1.93 | 3.54 × 10−6 | 1.65 | 5.32 × 10−5 |
ENSG00000237892 | KLF7-IT1 | KLF7 intronic transcript 1 | 1.57 | 2.34 × 10−7 | 1.62 | 2.14 × 10−7 |
ENSG00000128342 | LIF | LIF interleukin 6 family cytokine | 3.19 | 1.78 × 10−7 | 2.26 | 4.42 × 10−5 |
ENSG00000261618 | LINC02605 | long intergenic non-protein coding RNA 2605 | 4.54 | 1.42 × 10−8 | 3.42 | 4.85 × 10−6 |
ENSG00000107968 | MAP3K8 | mitogen-activated protein kinase kinase kinase 8 | 1.31 | 5.19 × 10−3 | 1.26 | 1.01 × 10−2 |
ENSG00000234883 | MIR155HG | MIR155 host gene | 2.59 | 9.02 × 10−6 | 2.32 | 7.05 × 10−5 |
ENSG00000253522 | MIR3142HG | MIR3142 host gene | 3.00 | 2.42 × 10−8 | 2.66 | 2.51 × 10−7 |
ENSG00000163121 | NEURL3 | neuralized E3 ubiquitin protein ligase 3 | 1.92 | 2.65 × 10−3 | 2.16 | 7.87 × 10−4 |
ENSG00000100906 | NFKBIA | NFKB inhibitor alpha | 3.06 | 1.83 × 10−9 | 2.63 | 1.93 × 10−8 |
ENSG00000144802 | NFKBIZ | NFKB inhibitor zeta | 2.77 | 7.63 × 10−10 | 1.78 | 4.53 × 10−7 |
ENSG00000151014 | NOCT | nocturnin | 1.91 | 3.54 × 10−6 | 1.73 | 2.20 × 10−5 |
ENSG00000163545 | NUAK2 | NUAK family kinase 2 | 3.63 | 2.97 × 10−9 | 3.48 | 1.40 × 10−8 |
ENSG00000141682 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | 1.11 | 8.77 × 10−4 | 1.03 | 2.82 × 10−3 |
ENSG00000087074 | PPP1R15A | protein phosphatase 1 regulatory subunit 15A | 1.26 | 7.28 × 10−9 | 1.04 | 2.51 × 10−7 |
ENSG00000073756 | PTGS2 | prostaglandin-endoperoxide synthase 2 | 1.49 | 1.81 × 10−4 | 1.23 | 2.54 × 10−3 |
ENSG00000159200 | RCAN1 | regulator of calcineurin 1 | 1.54 | 4.15 × 10−6 | 1.24 | 1.23 × 10−4 |
ENSG00000104312 | RIPK2 | receptor interacting serine/threonine kinase 2 | 1.33 | 1.43 × 10−6 | 1.22 | 9.05 × 10−6 |
ENSG00000172602 | RND1 | Rho family GTPase 1 | 2.90 | 3.68 × 10−9 | 2.78 | 1.40 × 10−8 |
ENSG00000007908 | SELE | selectin E | 3.31 | 1.92 × 10−3 | 3.21 | 3.67 × 10−3 |
ENSG00000145365 | TIFA | TRAF interacting protein with forkhead associated domain | 1.84 | 8.22 × 10−7 | 1.82 | 1.51 × 10−6 |
ENSG00000133069 | TMCC2 | transmembrane and coiled-coil domain family 2 | 1.91 | 1.75 × 10−4 | 2.00 | 1.21 × 10−4 |
ENSG00000232810 | TNF | tumor necrosis factor | 5.92 | 3.92 × 10−5 | 4.79 | 1.16 × 10−3 |
ENSG00000185215 | TNFAIP2 | TNF alpha induced protein 2 | 1.92 | 2.00 × 10−4 | 1.36 | 1.29 × 10−2 |
ENSG00000118503 | TNFAIP3 | TNF alpha induced protein 3 | 4.91 | 4.96 × 10−9 | 4.41 | 3.14 × 10−8 |
ENSG00000050730 | TNIP3 | TNFAIP3 interacting protein 3 | 1.85 | 1.37 × 10−3 | 1.53 | 1.72 × 10−2 |
ENSG00000056558 | TRAF1 | TNF receptor associated factor 1 | 2.48 | 7.32 × 10−4 | 2.07 | 6.07 × 10−3 |
ENSG00000173334 | TRIB1 | tribbles pseudokinase 1 | 1.22 | 5.86 × 10−3 | 1.05 | 3.28 × 10−2 |
ENSG00000163874 | ZC3H12A | zinc finger CCCH-type containing 12A | 2.33 | 8.22 × 10−7 | 1.94 | 1.89 × 10−5 |
ENSG00000128016 | ZFP36 | ZFP36 ring finger protein | 2.73 | 2.02 × 10−6 | 2.51 | 9.42 × 10−6 |
Target Transcript | Gene ID | Sequence (5′-3′) |
---|---|---|
C2CD4B | 388125 | Sense: AGAAAGGAAGUACACCCAUTT Antisense: AUGGGUGUACUUCCUUUCUCT |
EGR3 | 1960 | Sense: CCAUCAAGGCAUUCAAAGATT Antisense: UCUUUGAAUGCCUUGAUGGTC |
FOSB | 2354 | Sense: ACUUCUUCGUUUGUCCUCATT Antisense: UGAGGACAAACGAAGAAGUGT |
IRF1 | 3659 | Sense: CCUCUGAAGCUACAACAGATT Antisense: UCUGUUGUAGCUUCAGAGGTG |
JUNB | 3726 | Sense: CUCUCUACACGACUACAAATT Antisense: UUUGUAGUCGUGUAGAGAGAG |
Gene Transcript [Reference] | Primer Pair | Product Size (bp) |
---|---|---|
ALAS1 [57] | Forward 5′- GGCAGCACAGATGAATCAGA-3′ Reverse 5′- CCTCCATCGGTTTTCACACT-3′ | 150 |
C2CD4B [58] | Forward 5′- GCTTGCAACCAGATCCAGAG-3′ Reverse 5′- GGCCGAGGAACAGAGTTTC-3′ | 113 |
EGR3 [59] | Forward 5′- GACATCGGTCTGACCAACGAG-3′ Reverse 5′- GGCGAACTTTCCCAAGTAGGT-3′ | 105 |
FOSB [60] | Forward 5′- TTCTGACTGTCCCTGCCAAT-3′ Reverse 5′- CGGGGTCAGATGCAAAATAC-3′ | 249 |
ICAM-1 [61] | Forward 5′- TAAGCCAAGAGGAAGGAGCA-3′ Reverse 5′- CATATCATCAAGGGTTGGGG-3′ | 289 |
IRF1 [62] | Forward 5′- AAAGTCGAAGTCCAGCCGAG-3′ Reverse 5′- CAGAGTGGAGCTGCTGAGTC-3′ | 103 |
JUNB [63] | Forward 5′- ACTCATACACAGCTACGGGATACG-3′ Reverse 5′- GGCTCGGTTTCAGGAGTTTG-3′ | 78 |
PPIA [64] | Forward 5′- GAGCACTGGAGAGAAAGGATTT-3′ Reverse 5′- GGTGATCTTCTTGCTGGTCTT-3′ | 355 |
RPLP0 [64] | Forward 5′- GCAGCATCTACAACCCTGAA-3′ Reverse 5′- GCAGATGGATCAGCCAAGAA-3′ | 235 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, Y.; Ashander, L.M.; Appukuttan, B.; Ryan, F.J.; Tan, A.C.R.; Matthews, J.M.; Michael, M.Z.; Lynn, D.J.; Smith, J.R. Selective Transcription Factor Blockade Reduces Human Retinal Endothelial Cell Expression of Intercellular Adhesion Molecule-1 and Leukocyte Binding. Int. J. Mol. Sci. 2023, 24, 3304. https://doi.org/10.3390/ijms24043304
Ma Y, Ashander LM, Appukuttan B, Ryan FJ, Tan ACR, Matthews JM, Michael MZ, Lynn DJ, Smith JR. Selective Transcription Factor Blockade Reduces Human Retinal Endothelial Cell Expression of Intercellular Adhesion Molecule-1 and Leukocyte Binding. International Journal of Molecular Sciences. 2023; 24(4):3304. https://doi.org/10.3390/ijms24043304
Chicago/Turabian StyleMa, Yuefang, Liam M. Ashander, Binoy Appukuttan, Feargal J. Ryan, Alwin C. R. Tan, Janet M. Matthews, Michael Z. Michael, David J. Lynn, and Justine R. Smith. 2023. "Selective Transcription Factor Blockade Reduces Human Retinal Endothelial Cell Expression of Intercellular Adhesion Molecule-1 and Leukocyte Binding" International Journal of Molecular Sciences 24, no. 4: 3304. https://doi.org/10.3390/ijms24043304
APA StyleMa, Y., Ashander, L. M., Appukuttan, B., Ryan, F. J., Tan, A. C. R., Matthews, J. M., Michael, M. Z., Lynn, D. J., & Smith, J. R. (2023). Selective Transcription Factor Blockade Reduces Human Retinal Endothelial Cell Expression of Intercellular Adhesion Molecule-1 and Leukocyte Binding. International Journal of Molecular Sciences, 24(4), 3304. https://doi.org/10.3390/ijms24043304