The Role of Interferon Regulatory Factor 1 in Regulating Microglial Activation and Retinal Inflammation
Abstract
:1. Introduction
2. Results
2.1. Increased IRF1 Protein Expression Levels in Activated Retinal Microglia
2.2. IRF1 Knockout (KO) Defers BV2 Microglial Proliferation
2.3. IRF1′s Involvement in Microglial Migration
2.4. IRF1′s Role in the Phagocytosis of Activated Microglia
2.5. IRF1-KO Alters the Gene Expression Profile of M1 vs. M2 Activation State
2.6. IRF1 KO Reduces Microglial Cytotoxicity to Retinal Cells in Cultures
2.7. IRF1 Knockdown Reduces Retinal Microglial Activation and Inflammation In Vivo
3. Discussion
4. Materials and Methods
4.1. Experimental Animals
4.2. Intravitreal Injection of LPS and siRNA in Mice
4.3. Retinal Flat Mounts and Immunofluorescent Stain
4.4. Cell Cultures and Treatments
4.5. IRF1 Knockdown (KD) and Overexpression (OE) in BV2 Microglial Cells
4.6. IRF1 Knockout (KO) from BV2 Cells with the CRISPR/Cas9 Method
4.7. Cell Live and Death Assays
4.8. Cell Migration Assay
4.9. Microglia Phagocytosis of Zymosan Bioparticles
4.10. Flow Cytometry
4.11. Real-Time Quantification PCR
4.12. Western Blots and Densitometry Analysis
4.13. Immunohistochemistry and Immunofluorescence
4.14. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Prinz, M.; Jung, S.; Priller, J. Microglia Biology: One Century of Evolving Concepts. Cell 2019, 179, 292–311. [Google Scholar] [CrossRef] [PubMed]
- Saddala, M.S.; Lennikov, A.; Mukwaya, A.; Yang, Y.; Hill, M.A.; Lagali, N.; Huang, H. Discovery of novel L-type voltage-gated calcium channel blockers and application for the prevention of inflammation and angiogenesis. J. Neuroinflamm. 2020, 17, 132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sarlus, H.; Heneka, M.T. Microglia in Alzheimer’s disease. J. Clin. Investig. 2017, 127, 3240–3249. [Google Scholar] [CrossRef] [PubMed]
- Rashid, K.; Akhtar-Schaefer, I.; Langmann, T. Microglia in Retinal Degeneration. Front. Immunol. 2019, 10, 1975. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mulfaul, K.; Ozaki, E.; Fernando, N.; Brennan, K.; Chirco, K.R.; Connolly, E.; Greene, C.; Maminishkis, A.; Salomon, R.G.; Linetsky, M.; et al. Toll-like Receptor 2 Facilitates Oxidative Damage-Induced Retinal Degeneration. Cell Rep. 2020, 30, 2209–2224.e5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.-J.; Wang, P.-W.; Yang, I.-H.; Huang, H.-M.; Chang, C.-S.; Wu, C.-L.; Chuang, J.-H. High-fat diet induces toll-like receptor 4-dependent macrophage/microglial cell activation and retinal impairment. Investig. Opthalmol. Vis. Sci. 2015, 56, 3041–3050. [Google Scholar] [CrossRef] [Green Version]
- Ma, W.; Zhao, L.; Wong, W.T. Microglia in the outer retina and their relevance to pathogenesis of age-related macular degeneration. Retin. Degener. Dis. 2012, 723, 37–42. [Google Scholar]
- Amici, S.A.; Dong, J.; Guerau-de-Arellano, M. Molecular Mechanisms Modulating the Phenotype of Macrophages and Microglia. Front. Immunol. 2017, 8, 1520. [Google Scholar] [CrossRef] [Green Version]
- Willis, E.F.; MacDonald, K.P.; Nguyen, Q.H.; Garrido, A.L.; Gillespie, E.R.; Harley, S.B.; Bartlett, P.F.; Schroder, W.A.; Yates, A.G.; Anthony, D.C.; et al. Repopulating Microglia Promote Brain Repair in an IL-6-Dependent Manner. Cell 2020, 180, 833–846.e816. [Google Scholar] [CrossRef]
- Saddala, M.S.; Yang, X.; Tang, S.; Huang, H. Transcriptome-wide analysis reveals core sets of transcriptional regulators of sensome and inflammation genes in retinal microglia. Genomics 2021, 113, 3058–3071. [Google Scholar] [CrossRef]
- Hickman, S.E.; El Khoury, J. Analysis of the Microglial Sensome. In Microglia; Garaschuk, O., Verkhratsky, A., Eds.; Humana: New York, NY, USA, 2019; Volume 2034, pp. 305–323. [Google Scholar]
- O’Koren, E.G.; Yu, C.; Klingeborn, M.; Wong, A.Y.; Prigge, C.L.; Mathew, R.; Kalnitsky, J.; Msallam, R.A.; Silvin, A.; Kay, J.N.; et al. Microglial Function Is Distinct in Different Anatomical Locations during Retinal Homeostasis and Degeneration. Immunity 2019, 50, 723–737.e727. [Google Scholar] [CrossRef]
- Thion, M.S.; Low, D.; Silvin, A.; Chen, J.; Grisel, P.; Schulte-Schrepping, J.; Blecher, R.; Ulas, T.; Squarzoni, P.; Hoeffel, G.; et al. Microbiome Influences Prenatal and Adult Microglia in a Sex-Specific Manner. Cell 2018, 172, 500–516.e516. [Google Scholar] [CrossRef] [Green Version]
- Holtman, I.R.; Skola, D.; Glass, C.K. Transcriptional control of microglia phenotypes in health and disease. J. Clin. Investig. 2017, 127, 3220–3229. [Google Scholar] [CrossRef] [Green Version]
- Fujita, T.; Sakakibara, J.; Sudo, Y.; Miyamoto, M.; Kimura, Y.; Taniguchi, T. Evidence for a nuclear factor(s), IRF-1, mediating induction and silencing properties to human IFN-beta gene regulatory elements. EMBO J. 1988, 7, 3397–3405. [Google Scholar] [CrossRef]
- Miyamoto, M.; Fujita, T.; Kimura, Y.; Maruyama, M.; Harada, H.; Sudo, Y.; Miyata, T.; Taniguchi, T. Regulated expression of a gene encoding a nuclear factor, IRF-1, that specifically binds to IFN-beta gene regulatory elements. Cell 1988, 54, 903–913. [Google Scholar] [CrossRef]
- Antonczyk, A.; Krist, B.; Sajek, M.; Michalska, A.; Piaszyk-Borychowska, A.; Plens-Galaska, M.; Wesoly, J.; Bluyssen, H.A.R. Direct Inhibition of IRF-Dependent Transcriptional Regulatory Mechanisms Associated With Disease. Front. Immunol. 2019, 10, 1176. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, Y.; Yasuike, M.; Kondo, H.; Aoki, T.; Hirono, I. Molecular cloning and expression analysis of interferon regulatory factor 10 (IRF10) in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immunol. 2011, 30, 67–76. [Google Scholar] [CrossRef]
- Masuda, T.; Iwamoto, S.; Mikuriya, S.; Tozaki-Saitoh, H.; Tamura, T.; Tsuda, M.; Inoue, K. Transcription factor IRF1 is responsible for IRF8-mediated IL-1beta expression in reactive microglia. J. Pharmacol. Sci. 2015, 128, 216–220. [Google Scholar] [CrossRef] [Green Version]
- Gao, T.; Jernigan, J.; Raza, S.A.; Dammer, E.B.; Xiao, H.; Seyfried, N.T.; Levey, A.I.; Rangaraju, S. Transcriptional regulation of homeostatic and disease-associated-microglial genes by IRF1, LXRbeta, and CEBPalpha. Glia 2019, 67, 1958–1975. [Google Scholar]
- Wu, J.; Li, Y.; Chen, A.; Hong, C.; Zhang, C.; Wang, H.; Zhou, Y.; Li, P.; Wang, Y.; Mao, L.; et al. Inhibition of Sema4D/PlexinB1 signaling alleviates vascular dysfunction in diabetic retinopathy. EMBO Mol. Med. 2020, 12, e10154. [Google Scholar] [CrossRef]
- Baek, M.; Yoo, E.; Choi, H.I.; An, G.Y.; Chai, J.C.; Lee, Y.S.; Jung, K.H.; Chai, Y.G. The BET inhibitor attenuates the inflammatory response and cell migration in human microglial HMC3 cell line. Sci. Rep. 2021, 11, 8828. [Google Scholar] [CrossRef] [PubMed]
- Lennikov, A.; Mukwaya, A.; Saddala, M.S.; Huang, H. Deficiency of C-X-C chemokine receptor type 5 (CXCR5) gene causes dysfunction of retinal pigment epithelium cells. Lab. Investig. 2021, 101, 228–244. [Google Scholar] [CrossRef] [PubMed]
- Kierdorf, K.; Prinz, M. Factors regulating microglia activation. Front. Cell. Neurosci. 2013, 7, 44. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kimura, T.; Nakayama, K.; Penninger, J.; Kitagawa, M.; Harada, H.; Matsuyama, T.; Tanaka, N.; Kamijo, R.; Vilček, J.; Mak, T.W.; et al. Involvement of the IRF-1 transcription factor in antiviral responses to interferons. Science 1994, 264, 1921–1924. [Google Scholar] [CrossRef] [PubMed]
- Qiao, Y.; Prabhakar, S.; Coccia, E.M.; Weiden, M.; Canova, A.; Giacomini, E.; Pine, R. Host defense responses to infection by Mycobacterium tuberculosis. Induction of IRF-1 and a serine protease inhibitor. J. Biol. Chem. 2002, 277, 22377–22385. [Google Scholar] [CrossRef] [Green Version]
- Yamada, H.; Mizuno, S.; Sugawara, I. Interferon regulatory factor 1 in mycobacterial infection. Microbiol. Immunol. 2002, 46, 751–760. [Google Scholar] [CrossRef] [Green Version]
- AbuSara, N.; Razavi, S.; Derwish, L.; Komatsu, Y.; Licursi, M.; Hirasawa, K. Restoration of IRF1-dependent anticancer effects by MEK inhibition in human cancer cells. Cancer Lett. 2015, 357, 575–581. [Google Scholar] [CrossRef]
- Tanaka, N.; Ishihara, M.; Taniguchi, T. Suppression of c-myc or fosB-induced cell transformation by the transcription factor IRF-1. Cancer Lett. 1994, 83, 191–196. [Google Scholar] [CrossRef]
- Tanaka, N.; Ishihara, M.; Kitagawa, M.; Harada, H.; Kimura, T.; Matsuyama, T.; Lamphier, M.S.; Aizawa, S.; Mak, T.W.; Taniguchi, T. Cellular commitment to oncogene-induced transformation or apoptosis is dependent on the transcription factor IRF-1. Cell 1994, 77, 829–839. [Google Scholar] [CrossRef]
- Wessely, R.; Hengst, L.; Jaschke, B.; Wegener, F.; Richter, T.; Lupetti, R.; Paschalidis, M.; Schömig, A.; Brandl, R.; Neumann, F. A central role of interferon regulatory factor-1 for the limitation of neointimal hyperplasia. Hum. Mol. Genet. 2003, 12, 177–187. [Google Scholar] [CrossRef]
- Blanco, J.C.; Contursi, C.; Salkowski, C.A.; DeWitt, D.L.; Ozato, K.; Vogel, S.N. Interferon regulatory factor (IRF)-1 and IRF-2 regulate interferon gamma-dependent cyclooxygenase 2 expression. J. Exp. Med. 2000, 191, 2131–2144. [Google Scholar] [CrossRef] [Green Version]
- Merrill, J.E.; Ignarro, L.J.; Sherman, M.P.; Melinek, J.; Lane, T.E. Microglial cell cytotoxicity of oligodendrocytes is mediated through nitric oxide. J. Immunol. 1993, 151, 2132–2141. [Google Scholar]
- Boje, K.M.; Arora, P.K. Microglial-produced nitric oxide and reactive nitrogen oxides mediate neuronal cell death. Brain Res. 1992, 587, 250–256. [Google Scholar] [CrossRef]
- Chao, C.C.; Hu, S.; Molitor, T.W.; Shaskan, E.G.; Peterson, P.K. Activated microglia mediate neuronal cell injury via a nitric oxide mechanism. J. Immunol. 1992, 149, 2736–2741. [Google Scholar]
- Kamijo, R.; Harada, H.; Matsuyama, T.; Bosland, M.; Gerecitano, J.; Shapiro, D.; Le, J.; Koh, S.I.; Kimura, T.; Green, S.J.; et al. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 1994, 263, 1612–1615. [Google Scholar] [CrossRef]
- Martin, E.; Nathan, C.; Xie, Q.W. Role of interferon regulatory factor 1 in induction of nitric oxide synthase. J. Exp. Med. 1994, 180, 977–984. [Google Scholar] [CrossRef]
- Palikhe, S.; Ohashi, W.; Sakamoto, T.; Hattori, K.; Kawakami, M.; Andoh, T.; Yamazaki, H.; Hattori, Y. Regulatory Role of GRK2 in the TLR Signaling-Mediated iNOS Induction Pathway in Microglial Cells. Front. Pharmacol. 2019, 10, 59. [Google Scholar] [CrossRef]
- Faure, V.; Hecquet, C.; Courtois, Y.; Goureau, O. Role of interferon regulatory factor-1 and mitogen-activated protein kinase pathways in the induction of nitric oxide synthase-2 in retinal pigmented epithelial cells. J. Biol. Chem. 1999, 274, 4794–4800. [Google Scholar] [CrossRef] [Green Version]
- Spink, J.; Evans, T. Binding of the transcription factor interferon regulatory factor-1 to the inducible nitric-oxide synthase promoter. J. Biol. Chem. 1997, 272, 24417–24425. [Google Scholar] [CrossRef] [Green Version]
- Du, Q.; Luo, J.; Yang, M.-Q.; Liu, Q.; Heres, C.; Yan, Y.-H.; Stolz, D.; Geller, D.A. iNOS/NO is required for IRF1 activation in response to liver ischemia-reperfusion in mice. Mol. Med. 2020, 26, 56. [Google Scholar] [CrossRef]
- Zhang, P.; Schlecht, A.; Wolf, J.; Boneva, S.; Laich, Y.; Koch, J.; Ludwig, F.; Boeck, M.; Thien, A.; Härdtner, C.; et al. The role of interferon regulatory factor 8 for retinal tissue homeostasis and development of choroidal neovascularisation. J. Neuroinflamm. 2021, 18, 215. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhu, J.; Chen, X.; Jie-Qiong, Z.; Li, X.; Luo, L.; Huang, H.; Liu, W.; Zhou, X.; Yan, J.; et al. Interferon Regulatory Factor 3 Deficiency Induces Age-Related Alterations of the Retina in Young and Old Mice. Front. Cell. Neurosci. 2019, 13, 272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, Z.; Zhao, S.; Zhu, Y.; Li, Z.; Liu, Z.; Yan, Y.; Tian, J.; Chen, Y.; Zhang, B. Interferon Regulatory Factor 5 Mediates Lipopolysaccharide-Induced Neuroinflammation. Front. Immunol. 2020, 11, 600479. [Google Scholar] [CrossRef] [PubMed]
- Al Mamun, A.; Chauhan, A.; Qi, S.; Ngwa, C.; Xu, Y.; Sharmeen, R.; Hazen, A.L.; Li, J.; Aronowski, J.A.; McCullough, L.D.; et al. Microglial IRF5-IRF4 regulatory axis regulates neuroinflammation after cerebral ischemia and impacts stroke outcomes. Proc. Natl. Acad. Sci. USA 2020, 117, 1742–1752. [Google Scholar] [CrossRef]
- Seigel, G.M. Review: R28 retinal precursor cells: The first 20 years. Mol. Vis. 2014, 20, 301–306. [Google Scholar]
- Tan, E.; Ding, X.-Q.; Saadi, A.; Agarwal, N.; Naash, M.I.; Al-Ubaidi, M.R. Expression of cone-photoreceptor-specific antigens in a cell line derived from retinal tumors in transgenic mice. Investig. Ophthalmol. Vis. Sci. 2004, 45, 764–768. [Google Scholar] [CrossRef] [Green Version]
- Crawford, M.J.; Krishnamoorthy, R.R.; Rudick, V.L.; Collier, R.J.; Kapin, M.; Aggarwal, B.B.; Al-Ubaidi, M.R.; Agarwal, N. Bcl-2 overexpression protects photooxidative stress-induced apoptosis of photoreceptor cells via NF-kappaB preservation. Biochem. Biophys. Res. Commun. 2001, 281, 1304–1312. [Google Scholar] [CrossRef]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [Green Version]
- Lennikov, A.; Saddala, M.S.; Mukwaya, A.; Tang, S.; Huang, H. Autoimmune-Mediated Retinopathy in CXCR5-Deficient Mice as the Result of Age-Related Macular Degeneration Associated Proteins Accumulation. Front. Immunol. 2019, 10, 1903. [Google Scholar] [CrossRef]
Target Protein & Secondary Antibody (2 Ab) | Produced by | Catalog Number | Host | WB Dilution | IF Dilution |
---|---|---|---|---|---|
IRF1 | CST | #8478 | rabbit | 1:1000 | - |
inos | abcam | ab283655 | rabbit | - | 1:100 |
GAPDH | arigo | ARG10112 | mouse | 1:1000 | - |
actin | arigo | ARG62346 | mouse | 1:1000 | - |
Iba1 | wako | 019-19741 | rabbit | - | 1:500 |
GFAP | Thermo | 13-0300 | Rat | - | 1:100 |
DAPI | Thermo | C0060 | - | 1:5000 | |
Goat anti-Mouse IgG antibody (HRP) | arigo | ARG65350 | Goat | 1:5000 | - |
Goat anti-Rabbit IgG antibody(HRP) | arigo | ARG65351 | Goat | 1:5000 | - |
Goat anti-Mouse IgG 2 Ab, Alexa Fluor 488 | thermo | A-11001 | Goat | - | 1:500 |
Donkey anti-Rat IgG 2 Ab, Alexa Fluor Plus 488 | thermo | A48269 | Donkey | - | 1:500 |
Goat anti-Rabbit IgG 2 Ab, Cyanine3 | thermo | A10520 | Goat | - | 1:500 |
Oligo Name | Sequence |
---|---|
IRF1-siRNA-01 | GCACCACTGATCTGTATAA |
IRF1-siRNA-02 | CCAAGACATGGAAGGCAAA |
IRF1-siRNA-03 | GGACATTGGGATAGGCATA |
IRF1-sgDNA | CCATGCCAATCACTCGAATG |
CCL5-Forward | TGCCCACGTCAAGGAGTATT |
CCL5-Reverse | GCGGTTCCTTCGAGTGACA |
iNOS-Forward | GGTGAAGGGACTGAGCTGTT |
iNOS-Reverse | CGTTCTCCGTTCTCTTGCAGT |
COX2-Forward | GCGAGCTAAGAGCTTCAGGA |
COX2-Reverse | TCATACATTCCCCACGGTTT |
CCL2-Forward | TTAAAAACCTGGATCGGAACCAA |
CCL2-Reverse | GCATTAGCTTCAGATTTACGGGT |
IL-6-Forward | TAGTCCTTCCTACCCCAATTTCC |
IL-6-Reverse | TTGGTCCTTAGCCACTCCTTC |
CD47-Forward | GGTGGGAAACTACACTTGCGAAG |
CD47-Reverse | CTCCTCGTAAGAACAGGCTGATC |
Arg1-Forward | ACTGGAACCCAGAGAGAGCA |
Arg1-Reverse | ACAGACCGTGGGTTCTTCAC |
CD206-Forward | TTCAGCTATTGGACGCGAGG |
CD206-Reverse | GAATCTGACACCCAGCGGAA |
TGF-b-Forward | AGCCCGAAGCGGACTACTAT |
TGF-b-Reverse | TCCACATGTTGCTCCACACT |
Actin-Forward | AGGCGGACTGTTACTGAGC |
Actin-Reverse | CGCCTTCACCGTTCCAGTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, X.; Diaz, V.; Huang, H. The Role of Interferon Regulatory Factor 1 in Regulating Microglial Activation and Retinal Inflammation. Int. J. Mol. Sci. 2022, 23, 14664. https://doi.org/10.3390/ijms232314664
Yang X, Diaz V, Huang H. The Role of Interferon Regulatory Factor 1 in Regulating Microglial Activation and Retinal Inflammation. International Journal of Molecular Sciences. 2022; 23(23):14664. https://doi.org/10.3390/ijms232314664
Chicago/Turabian StyleYang, Xu, Valeria Diaz, and Hu Huang. 2022. "The Role of Interferon Regulatory Factor 1 in Regulating Microglial Activation and Retinal Inflammation" International Journal of Molecular Sciences 23, no. 23: 14664. https://doi.org/10.3390/ijms232314664
APA StyleYang, X., Diaz, V., & Huang, H. (2022). The Role of Interferon Regulatory Factor 1 in Regulating Microglial Activation and Retinal Inflammation. International Journal of Molecular Sciences, 23(23), 14664. https://doi.org/10.3390/ijms232314664