Artesunate Dry Emulsion Formulation Combined with Antibiotics for Treatment of Helicobacter pylori Infections: In Vitro/In Vivo Evaluation
Abstract
:1. Introduction
2. Results and Discussion
2.1. Characterization of Artesunate Dry Emulsion Formulation
2.1.1. Solubility
2.1.2. FTIR Analysis
2.1.3. X-ray Diffraction
2.1.4. SEM Analysis
2.2. In Vitro Study
2.2.1. Determination Antibacterial Activity of Native Artesunate and ADEF via Agar Disk Diffusion Assay
2.2.2. Determination of Inhibitory Concentration
2.3. In Vivo Study
2.3.1. Pharmacokinetic of ADEF
2.3.2. In Vivo Efficacy of ADEF against H. pylori
- Side effects caused by excessive and high dose of antibioticsThe present treatment regimen for H. pylori infection involves a high dosage (amoxicillin 1000 mg and clarithromycin 500 mg) administered two or three times a day over an extended period, typically 14 days [27,28]. Common antibiotic side effects encompass rash, dizziness, nausea, and diarrhea among others. Notably, more severe reactions may include the development of yeast infection, resulting in diarrhea that can potentially lead to severe colon damage and even death [29]. Additionally, in rare instances, myelotoxicity represents the most notable adverse effect associated with rifabutin [30];
- Emergence of antibiotic resistanceExcessive use of antibiotics can result in the emergence of antibiotic resistance, making the treatment of bacterial infections more challenging. A meta-analysis conducted in 2018 [31] revealed that H. pylori has surpassed the recommended threshold for resistance to clarithromycin, levofloxacin, and metronidazole, as outlined in the Maastricht-V consensus. In numerous regions across the globe, there is a prevalent high resistance rate (15%), while certain areas exhibit dual resistance rates exceeding 15% for clarithromycin and metronidazole. Conversely, resistance rates for amoxicillin and tetracycline remain low. As for rifabutin, its current resistance rate is minimal. However, the extensive utilization of rifabutin for eradicating H. pylori in individuals infected with mycobacterium tuberculosis could contribute to the development of antibiotic resistance [32];
- High costTriple or quadruple therapy can pose a significant financial burden, particularly in regions without accessible or subsidized healthcare. Consequently, this expense becomes a formidable barrier for numerous patients unable to bear the treatment’s cost;
- Oral antibiotics induced changes in the human gastrointestinal microbiota
3. Materials and Methods
3.1. Reagent
3.2. Characterization of Artesunate Dry Emulsion Formulation (ADEF)
3.2.1. Solubility
3.2.2. Fourier-Transform Infrared (FTIR) Analysis
3.2.3. X-ray Diffraction
3.2.4. Scanning Electron Microscopy (SEM) Analysis
3.3. In Vitro Study
3.3.1. Agar Disk Diffusion Assay
3.3.2. Determination of Inhibitory Concentrations
- Bacterium inoculum: a suspension of approximately 105 cfu/mL is prepared in brucella broth from a 48 h culture grown at 37 °C in microaerobic conditions;
- Culture medium: Mueller–Hinton containing sheep blood with globular extract (10%);
- Sample preparation: Starting with a stock solution of ADEF at a concentration of 2 mg/mL, suitable dilutions were made using sterile distilled water (200 µL). These dilutions were then added to a plate containing 39.8 mL of culture medium to create a range of final concentrations from 0.6 to 1250 µg/mL. For each of the 30 H. pylori strains, duplicate samples were prepared;
- Inoculation: the inoculation was performed with a multiple inoculator, and the plates were incubated for 48 h at 37 °C in a workstation containing a microaerobic atmosphere (5% O2, 10% CO2, 85% N2). Double replicate assays were carried out to ensure the reproducibility of results. The minimum inhibitory concentration (MIC) is determined as the lowest concentration of the bioactive agent which inhibits the growth of the H. pylori strain.
3.4. In Vivo Study
3.4.1. Pharmacokinetic Parameter Determination
- Low dose: 25 and 50 mg/kg of ADEF;
- Mid dose: 100 mg/kg of ADEF;
- High dose: 150 mg/kg of ADEF.
3.4.2. In Vivo Efficacy of ADEF against H. pylori
- Group-1
- (n = 10): mice not infected (NI)
- Group-2
- (n = 10): mice infected with PremSS1
- Group-3
- (n = 10): mice infected with PremSS1 + PPI
- Group-4
- (n = 10): mice infected with PremSS1 + Amox
- Group-5
- (n = 10): mice infected with PremSS1 + PPI + Amox
- Group-6
- (n = 10): mice infected with PremSS1 + ADEF
- Group-7
- (n = 10): mice infected with PremSS1 + PPI + ADEF
- Group-8
- (n = 10): mice infected with PremSS1 + PPI + ADEF + Amox
- Bacterial culture to enumerate viable count of H. pylori
- Relative quantification of H. pylori by qPCR
- HPY-S (AGGTTAAGAGGATGCGTCAGTC) (SEQ ID NO:5);
- HPY-A (CGCATGATATTCCCATTAGCAGT) (SEQ ID NO:6).
- mGapdh1for (CTGCAGGTTCTCCACACCTATG) (SEQ ID NO:1);
- mGapdh1rev (GAATTTGCCGTGAGTGGAGTC) (SEQ ID NO:2);
- mActb2for (GACAGGATGCAGAAGGAGATTACTG) (SEQ ID NO:3);
- mActb2rev (ACATCTGCTGGAAGGTGGACA) (SEQ ID NO:4).
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Hooi, J.K.; Lai, W.Y.; Ng, W.K.; Suen, M.M.; Underwood, F.E.; Tanyingoh, D.; Malfertheiner, P.; Graham, D.Y.; Wong, V.W.; Wu, J.C. Global prevalence of Helicobacter pylori infection: Systematic review and meta-analysis. Gastroenterology 2017, 153, 420–429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tempera, P.J.; Michael, M.; Tageldin, O.; Hasak, S. Gastric Cancer Due to Chronic H. pylori Infection: What We Know and Where We Are Going. Diseases 2022, 10, 57. [Google Scholar] [CrossRef] [PubMed]
- Mubaraki, M.A.; Alalhareth, A.S.; Aldawood, E.; Albouloshi, A.; Aljarah, M.S.; Hafiz, T.A.; Alkhudhayri, A.; Thagfan, F.A.; El-khadragy, M.F.; Al-Megrin, W.A. The iron deficiency anemia in association to Helicobacter pylori infection in Najran city, Saudi Arabia. J. King Saud Univ.-Sci. 2022, 34, 102353. [Google Scholar] [CrossRef]
- Koseki, M.; Sheu, M.J.; Tsai, K.-T.; Ho, C.-H.; Liu, H.-H.; Lin, H.-J.; Lin, C.-L.; Huang, C.-C. Eradication therapy may decrease the risk of immune thrombocytopenia after Helicobacter pylori infection: A retrospective cohort study in Taiwan. BMC Gastroenterol. 2023, 23, 36. [Google Scholar] [CrossRef]
- Suzuki, S.; Kusano, C.; Horii, T.; Ichijima, R.; Ikehara, H. The ideal Helicobacter pylori treatment for the present and the future. Digestion 2022, 103, 62–68. [Google Scholar] [CrossRef] [PubMed]
- Kocsmár, É.; Buzás, G.M.; Szirtes, I.; Kocsmár, I.; Kramer, Z.; Szijártó, A.; Fadgyas-Freyler, P.; Szénás, K.; Rugge, M.; Fassan, M. Primary and secondary clarithromycin resistance in Helicobacter pylori and mathematical modeling of the role of macrolides. Nat. Commun. 2021, 12, 2255. [Google Scholar] [CrossRef]
- Azadbakht, S.; Moayyedkazemi, A.; Azadbakht, S.; Fard, S.A.; Soroush, S. Evaluation of antibiotic resistance of Helicobacter pylori bacteria obtained from gastric biopsy samples: A cohort study. Ann. Med. Surg. 2022, 78, 103824. [Google Scholar] [CrossRef]
- Caliskan, R.; Tokman, H.B.; Erzin, Y.; Saribas, S.; Yuksel, P.; Bolek, B.K.; Sevuk, E.O.; Demirci, M.; Yılmazli, O.; Akgul, O.; et al. Antimicrobial resistance of Helicobacter pylori strains to five antibiotics, including levofloxacin, in Northwestern Turkey. Rev. Da Soc. Bras. De Med. Trop. 2015, 48, 278–284. [Google Scholar] [CrossRef]
- Ho, J.J.C.; Argueta, E.A.; Moss, S.F. Helicobacter pylori Treatment Regimens: A US Perspective. Gastroenterol. Hepatol. 2022, 18, 313. [Google Scholar]
- Korona-Glowniak, I.; Glowniak-Lipa, A.; Ludwiczuk, A.; Baj, T.; Malm, A. The in vitro activity of essential oils against Helicobacter pylori growth and urease activity. Molecules 2020, 25, 586. [Google Scholar] [CrossRef] [Green Version]
- Sisto, F.; Scaltrito, M.M.; Masia, C.; Bonomi, A.; Coccè, V.; Marano, G.; Haynes, R.K.; Miani, A.; Farronato, G.; Taramelli, D. In vitro activity of artemisone and artemisinin derivatives against extracellular and intracellular Helicobacter pylori. Int. J. Antimicrob. Agents 2016, 48, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Su, T.; Li, F.; Guan, J.; Liu, L.; Huang, P.; Wang, Y.; Qi, X.; Liu, Z.; Lu, L.; Wang, D. Artemisinin and its derivatives prevent Helicobacter pylori-induced gastric carcinogenesis via inhibition of NF-κB signaling. Phytomedicine 2019, 63, 152968. [Google Scholar] [CrossRef] [PubMed]
- Cheong, D.H.; Tan, D.W.; Wong, F.W.; Tran, T. Anti-malarial drug, artemisinin and its derivatives for the treatment of respiratory diseases. Pharmacol. Res. 2020, 158, 104901. [Google Scholar] [CrossRef]
- World Health Organization. Guidelines for the Treatment of Malaria; World Health Organization: Geneva, Switzerland, 2006. [Google Scholar]
- Chadha, R.; Gupta, S.; Pathak, N. Artesunate-loaded chitosan/lecithin nanoparticles: Preparation, characterization, and in vivo studies. Drug Dev. Ind. Pharm. 2012, 38, 1538–1546. [Google Scholar] [CrossRef]
- Drugbank. Artesunate. Available online: http://www.iupac.org/dhtml_home.html (accessed on 24 February 2023).
- Haynes, R.K.; Chan, H.W.; Lung, C.M.; Ng, N.C.; Wong, H.N.; Shek, L.Y.; Williams, I.D.; Cartwright, A.; Gomes, M.F. Artesunate and dihydroartemisinin (DHA): Unusual decomposition products formed under mild conditions and comments on the fitness of DHA as an antimalarial drug. ChemMedChem Chem. Enabling Drug Discov. 2007, 2, 1448–1463. [Google Scholar] [CrossRef]
- Chinaeke, E.; Chime, S.; Onyishi, V.; Attama, A.; Okore, V. Formulation development and evaluation of the anti-malaria properties of sustained release artesunate-loaded solid lipid microparticles based on phytolipids. Drug Deliv. 2015, 22, 652–665. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prashanth, G.P.; Maralihalli, M.B.; Bagalkot, P.S.; Joshi, S.N. Intravenous artesunate for transfusion-transmitted Plasmodium vivax malaria in a preterm neonate. Pediatrics 2012, 130, e706–e709. [Google Scholar] [CrossRef] [Green Version]
- Parapini, S.; Olliaro, P.; Navaratnam, V.; Taramelli, D.; Basilico, N. Stability of the antimalarial drug dihydroartemisinin under physiologically relevant conditions: Implications for clinical treatment and pharmacokinetic and in vitro assays. Antimicrob. Agents Chemother. 2015, 59, 4046–4052. [Google Scholar] [CrossRef] [Green Version]
- Chung, I.-Y.; Jang, H.-J.; Yoo, Y.-J.; Hur, J.; Oh, H.-Y.; Kim, S.-H.; Cho, Y.-H. Artemisinin displays bactericidal activity via copper-mediated DNA damage. Virulence 2022, 13, 149–159. [Google Scholar] [CrossRef]
- Goswami, S.; Bhakuni, R.S.; Chinniah, A.; Pal, A.; Kar, S.K.; Das, P.K. Anti-Helicobacter pylori potential of artemisinin and its derivatives. Antimicrob. Agents Chemother. 2012, 56, 4594–4607. [Google Scholar] [CrossRef] [Green Version]
- Tanner, J.-A.; Tyndale, R.F. Variation in CYP2A6 activity and personalized medicine. J. Pers. Med. 2017, 7, 18. [Google Scholar] [CrossRef] [Green Version]
- Scott, D.R.; Sachs, G.; Marcus, E.A. The role of acid inhibition in Helicobacter pylori eradication. F1000Research 2016, 5, 1747. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- FDA. Food and Drug Administration. FDA Approves Only Drug in U.S. to Treat Severe Malaria. Available online: https://www.fda.gov/news-events/press-announcements/fda-approves-only-drug-us-treat-severe-malaria (accessed on 10 March 2023).
- Tao, A.; Song, Z.; Feng, X.; Zhang, A.; He, H.; Chen, Y. Antibacterial and antiviral activities of Artemisia Annua aqueous extract in vitro. In Proceedings of the IOP Conference Series: Earth and Environmental Science, Dali, China, 18–20 September 2020; p. 012053. [Google Scholar]
- Myran, L.; Zarbock, S.D. Management of Helicobacter pylori infection. US Pharm. 2018, 43, 27–32. [Google Scholar]
- Roberts, L.T.; Issa, P.P.; Sinnathamby, E.S.; Granier, M.; Mayeux, H.; Eubanks, T.N.; Malone, K.; Ahmadzadeh, S.; Cornett, E.M.; Shekoohi, S. Helicobacter Pylori: A Review of Current Treatment Options in Clinical Practice. Life 2022, 12, 2038. [Google Scholar] [CrossRef]
- Mohsen, S.; Dickinson, J.A.; Somayaji, R. Update on the adverse effects of antimicrobial therapies in community practice. Can. Fam. Physician 2020, 66, 651–659. [Google Scholar] [PubMed]
- Gisbert, J.P. Rifabutin for the treatment of Helicobacter pylori infection: A review. Pathogens 2020, 10, 15. [Google Scholar] [CrossRef]
- Savoldi, A.; Carrara, E.; Graham, D.Y.; Conti, M.; Tacconelli, E. Prevalence of antibiotic resistance in Helicobacter pylori: A systematic review and meta-analysis in World Health Organization regions. Gastroenterology 2018, 155, 1372–1382.e1317. [Google Scholar] [CrossRef] [Green Version]
- Borraccino, A.V.; Celiberto, F.; Pricci, M.; Girardi, B.; Iannone, A.; Rendina, M.; Ierardi, E.; Di Leo, A.; Losurdo, G. Rifabutin as salvage therapy for Helicobacter pylori eradication: Cornerstones and novelties. World J. Gastroenterol. 2022, 28, 6356. [Google Scholar] [CrossRef]
- Elvers, K.T.; Wilson, V.J.; Hammond, A.; Duncan, L.; Huntley, A.L.; Hay, A.D.; Van Der Werf, E.T. Antibiotic-induced changes in the human gut microbiota for the most commonly prescribed antibiotics in primary care in the UK: A systematic review. BMJ Open 2020, 10, e035677. [Google Scholar] [CrossRef]
- Patangia, D.V.; Anthony Ryan, C.; Dempsey, E.; Paul Ross, R.; Stanton, C. Impact of antibiotics on the human microbiome and consequences for host health. MicrobiologyOpen 2022, 11, e1260. [Google Scholar] [CrossRef]
- Zhou, X.; Sun, W.-J.; Wang, W.-M.; Chen, K.; Zheng, J.-H.; Lu, M.-D.; Li, P.-H.; Zheng, Z.-Q. Artesunate inhibits the growth of gastric cancer cells through the mechanism of promoting oncosis both in vitro and in vivo. Anti-Cancer Drugs 2013, 24, 920–927. [Google Scholar] [CrossRef] [PubMed]
- Denny, J.E.; Schmidt, N.W. Oral Administration of Clinically Relevant Antimalarial Drugs Does Not Modify the Murine Gut Microbiota. Sci. Rep. 2019, 9, 11952. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Tested Item | Designation | Dose (mg/kg) | Cmax (ng/mL) | Tmax (min) | t½ (min) | AUC0-Tlast (h.ng/mL) |
---|---|---|---|---|---|---|
ADEF | Low dose-1 | 25 | 81 | 5 | 3.4 | 24.4 |
ADEF | Low dose-2 | 50 | 390 | 5 | 6.3 | 91.3 |
ADEF | Mid Dose | 100 | 759 | 5 | 15.0 | 140.0 |
ADEF | High Dose | 150 | 1890 | 5 | 20.0 | 402.0 |
Native Artesunate | High Dose | 150 | 701 | 15 | 18 | 211.0 |
Tested Item | Designation | Dose (mg/kg) | Cmax (ng/mL) | Tmax (min) | t½ (min) | AUC0-Tlast (h.ng/mL) |
---|---|---|---|---|---|---|
ADEF | Low dose-1 | 25 | 175 | 10 | 10.3 | 53.2 |
ADEF | Low dose-2 | 50 | 689 | 10 | 10.3 | 338.0 |
ADEF | Mid Dose | 100 | 1320 | 15 | 17.6 | 546.0 |
ADEF | High Dose | 150 | 3870 | 15 | 27.5 | 1790.0 |
Native Artesunate | High Dose | 150 | 1450 | 45 | 22.0 | 728.0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Le-Tien, C.; Blemur, L.; Baltzis, D. Artesunate Dry Emulsion Formulation Combined with Antibiotics for Treatment of Helicobacter pylori Infections: In Vitro/In Vivo Evaluation. Int. J. Mol. Sci. 2023, 24, 11008. https://doi.org/10.3390/ijms241311008
Le-Tien C, Blemur L, Baltzis D. Artesunate Dry Emulsion Formulation Combined with Antibiotics for Treatment of Helicobacter pylori Infections: In Vitro/In Vivo Evaluation. International Journal of Molecular Sciences. 2023; 24(13):11008. https://doi.org/10.3390/ijms241311008
Chicago/Turabian StyleLe-Tien, Canh, Lindsay Blemur, and Dennis Baltzis. 2023. "Artesunate Dry Emulsion Formulation Combined with Antibiotics for Treatment of Helicobacter pylori Infections: In Vitro/In Vivo Evaluation" International Journal of Molecular Sciences 24, no. 13: 11008. https://doi.org/10.3390/ijms241311008