Evaluation of the Effects of Ag, Cu, ZnO and TiO2 Nanoparticles on the Expression Level of Oxidative Stress-Related Genes and the Activity of Antioxidant Enzymes in Escherichia coli, Bacillus cereus and Staphylococcus epidermidis
Abstract
1. Introduction
2. Results
2.1. Analysis of the Expression Level of Tested Genes in Bacteria under NPs Exposure
2.2. Activity of CAT, PER and SOD in Bacteria Exposed to NPs
2.3. Statistical Data Exploration
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains, Nanoparticles and Culture Conditions
4.2. Extraction of Total RNA and cDNA Synthesis
4.3. Preparation of Primers
4.4. Study of the Expression Level of Genes Encoding Antioxidant Proteins
4.5. Determining the Activity of CAT, PER and SOD
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Martínez, G.; Merinero, M.; Pérez-Aranda, M.; Pérez-Soriano, E.M.; Ortiz, T.; Villamor, E.; Begines, B.; Alcudia, A. Environmental impact of nanoparticles’ application as an emerging technology: A review. Materials 2020, 14, 166. [Google Scholar] [CrossRef]
- Gaviria, J.; Alcudia, A.; Begines, B.; Beltrán, A.M.; Rodríguez-Ortiz, J.A.; Trueba, P.; Villarraga, J.; Torres, Y. Biofunctionalization of porous Ti substrates coated with Ag nanoparticles for potential antibacterial behavior. Metals 2021, 11, 692. [Google Scholar] [CrossRef]
- Alcudia, A.; Begines, B.; Rodriguez-Lejarraga, P.; Greyer, V.; Godinho, V.C.F.; Pajuelo, E.; Torres, Y. Development of porous silver nanoparticle/polycaprolactone/polyvinyl alcohol coatings for prophylaxis in titanium interconnected samples for dental implants. Colloids Interface Sci. Commun. 2022, 48, 100621. [Google Scholar] [CrossRef]
- Khanna, K.; Kohli, S.K.; Handa, N.; Kaur, H.; Ohri, P.; Bhardwaj, R.; Yousaf, B.; Rinklebe, J.; Ahmad, P. Enthralling the impact of engineered nanoparticles on soil microbiome: A concentric approach towards environmental risks and cogitation. Ecotoxicol. Environ. Saf. 2021, 222, 112459. [Google Scholar] [CrossRef] [PubMed]
- Mammari, N.; Lamouroux, E.; Boudier, A.; Duval, R.E. Current knowledge on the oxidative-stress-mediated antimicrobial properties of metal-based nanoparticles. Microorganisms 2022, 10, 437. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Hu, C.; Shao, L. The antimicrobial activity of nanoparticles: Present situation and prospects for the future. Int. J. Nanomed. 2017, 12, 1227–1249. [Google Scholar] [CrossRef] [PubMed]
- Singh, J.; Vishwakarma, K.; Ramawat, N.; Rai, P.; Singh, V.K.; Mishra, R.K.; Kumar, V.; Tripathi, D.K.; Sharma, S. Nanomaterials and microbes’ interactions: A contemporary overview. 3 Biotech 2019, 9, 68. [Google Scholar] [CrossRef]
- Borisov, V.B.; Siletsky, S.A.; Nastasi, M.R.; Forte, E. ROS defense systems and terminal oxidases in bacteria. Antioxidants 2021, 10, 839. [Google Scholar] [CrossRef]
- Seixas, A.F.; Quendera, A.P.; Sousa, J.P.; Silva, A.F.Q.; Arraiano, C.M.; Andrade, J.M. Bacterial response to oxidative stress and RNA oxidation. Front. Genet. 2022, 12, 821535. [Google Scholar] [CrossRef]
- Liao, S.; Zhang, Y.; Pan, X.; Zhu, F.; Jiang, C.; Liu, Q.; Cheng, Z.; Dai, G.; Wu, G.; Wang, L.; et al. Antibacterial activity and mechanism of silver nanoparticles against multidrug-resistant Pseudomonas aeruginosa. Int. J. Nanomed. 2019, 14, 1469–1487. [Google Scholar] [CrossRef]
- Choi, Y.; Kim, H.-A.; Kim, K.-W.; Lee, B.-T. Comparative toxicity of silver nanoparticles and silver ions to Escherichia coli. J. Environ. Sci. 2018, 66, 50–60. [Google Scholar] [CrossRef] [PubMed]
- Simonin, M.; Richaume, A. Impact of engineered nanoparticles on the activity, abundance, and diversity of soil microbial communities: A review. Environ. Sci. Pollut. Res. 2015, 22, 13710–13723. [Google Scholar] [CrossRef] [PubMed]
- Karimi, E.; Mohseni Fard, E. Nanomaterial effects on soil microorganisms. In Nanoscience and Plant-Soil Systems. Soil Biology; Ghorbanpour, M., Khanuja, M., Varma, A., Eds.; Springer: Cham, Switzerland, 2017; Volume 48, pp. 137–200. [Google Scholar]
- Zhang, Y.; Gu, A.Z.; Xie, S.; Li, X.; Cen, T.; Li, D.; Chen, J. Nano-metal oxides induce antimicrobial resistance via radical-mediated mutagenesis. Environ. Int. 2018, 121, 1162–1171. [Google Scholar] [CrossRef] [PubMed]
- Brandelli, A. The interaction of nanostructured antimicrobials with biological systems: Cellular uptake, trafficking and potential toxicity. Food Sci. Hum. Wellness 2020, 9, 8–20. [Google Scholar] [CrossRef]
- Wang, X.; Yang, F.; Zhao, J.; Xu, Y.; Mao, D.; Zhu, X.; Luo, Y.; Alvarez, P.J.J. Bacterial exposure to ZnO nanoparticles facilitates horizontal transfer of antibiotic resistance genes. NanoImpact 2018, 10, 61–67. [Google Scholar] [CrossRef]
- Zhang, S.; Wang, Y.; Song, H.; Lu, J.; Yuan, Z.; Guo, J. Copper nanoparticles and copper ions promote horizontal transfer of plasmid-mediated multi-antibiotic resistance genes across bacterial genera. Environ. Int. 2019, 129, 478–487. [Google Scholar] [CrossRef]
- Lu, J.; Wang, Y.; Jin, M.; Yuan, Z.; Bond, P.; Guo, J. Both silver ions and silver nanoparticles facilitate the horizontal transfer of plasmid-mediated antibiotic resistance genes. Water Res. 2020, 169, 115229. [Google Scholar] [CrossRef]
- Joshi, A.S.; Singh, P.; Mijakovic, I. Interactions of gold and silver nanoparticles with bacterial biofilms: Molecular interactions behind inhibition and resistance. Int. J. Mol. Sci. 2020, 21, 7658. [Google Scholar] [CrossRef]
- Abarca-Cabrera, L.; Fraga-García, P.; Berensmeier, S. Bio-nano interactions: Binding proteins, polysaccharides, lipids and nucleic acids onto magnetic nanoparticles. Biomater. Res. 2021, 25, 12. [Google Scholar] [CrossRef]
- Singh, B.R.; Singh, B.N.; Singh, A.; Khan, W.; Naqvi, A.H.; Singh, H.B. Mycofabricated biosilver nanoparticles interrupt Pseudomonas aeruginosa quorum sensing systems. Sci. Rep. 2015, 5, 13719. [Google Scholar] [CrossRef]
- Ouyang, K.; Mortimer, M.; Holden, P.A.; Cai, P.; Wu, Y.; Gao, C.; Huang, Q. Towards a better understanding of Pseudomonas putida biofilm formation in the presence of ZnO nanoparticles (NPs): Role of NP concentration. Environ. Int. 2020, 137, 105485. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Wu, L.; Si, Y.; Shu, K. Size-dependent cytotoxicity of silver nanoparticles to Azotobacter vinelandii: Growth inhibition, cell injury, oxidative stress and internalization. PLoS ONE 2018, 13, e0209020. [Google Scholar] [CrossRef]
- Yan, X.; He, B.; Liu, L.; Qu, G.; Shi, J.; Hu, L.; Jiang, G. Antibacterial mechanism of silver nanoparticles in Pseudomonas aeruginosa: Proteomics approach. Metallomics 2018, 10, 557–564. [Google Scholar] [CrossRef] [PubMed]
- de Celis, M.; Belda, I.; Marquina, D.; Santos, A. Phenotypic and transcriptional study of the antimicrobial activity of silver and zinc oxide nanoparticles on a wastewater biofilm-forming Pseudomonas aeruginosa strain. Sci. Total Environ. 2022, 826, 153915. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Cheng, S.; Singh, S. Oxidative stress-mediated genotoxic effect of zinc oxide nanoparticles on Deinococcus radiodurans. 3 Biotech 2020, 10, 66. [Google Scholar] [CrossRef] [PubMed]
- Reimhult, E. Nanoparticle risks and identification in a world where small things do not survive. Nanoethics 2017, 11, 283–290. [Google Scholar] [CrossRef] [PubMed]
- Ameen, F.; Alsamhary, K.; Alabdullatif, J.A.; AlNadhari, S. A review on metal-based nanoparticles and their toxicity to beneficial soil bacteria and fungi. Ecotoxicol. Environ. Saf. 2021, 213, 112027. [Google Scholar] [CrossRef] [PubMed]
- Mortimer, M.; Wang, Y.; Holden, P.A. Molecular mechanisms of nanomaterial-bacterial interactions revealed by omics—the role of nanomaterial effect level. Front. Bioeng. Biotechnol. 2021, 9, 683520. [Google Scholar] [CrossRef]
- Leung, Y.H.; Xu, X.; Ma, A.P.; Liu, F.; Ng, A.M.; Shen, Z.; Gethings, L.A.; Guo, M.Y.; Djurišić, A.B.; Lee, P.K.; et al. Toxicity of ZnO and TiO2 to Escherichia coli cells. Sci. Rep. 2016, 6, 35243. [Google Scholar] [CrossRef]
- Khan, I.; Saeed, K.; Khan, I. Nanoparticles: Properties, applications and toxicities. Arab. J. Chem. 2019, 12, 908–931. [Google Scholar] [CrossRef]
- Jin, R.; Higaki, T. Open questions on the transition between nanoscale and bulk properties of metals. Commun. Chem. 2021, 4, 28. [Google Scholar] [CrossRef]
- Arendsen, L.P.; Thakar, R.; Sultan, A.H. The use of copper as an antimicrobial agent in health care, including obstetrics and gynecology. Clin. Microbiol. Rev. 2019, 32, e00125-18. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.; Yahia, L.; Sacher, E. Antimicrobial properties of the Ag, Cu nanoparticle system. Biology 2021, 10, 137. [Google Scholar] [CrossRef] [PubMed]
- Peszke, J.; Dulski, M.; Nowak, A.; Balin, K.; Zubko, M.; Sułowicz, S.; Nowak, B.; Piotrowska-Seget, Z.; Talik, E.; Wojtyniak, M.; et al. Unique properties of silver and copper silica-based nanocomposites as antimicrobial agents. RSC Adv. 2017, 7, 28092–28104. [Google Scholar] [CrossRef]
- Moore, J.D.; Avellan, A.; Noack, C.W.; Guo, Y.; Lowry, G.V.; Gregory, K.B. Time-dependent bacterial transcriptional response to CuO nanoparticles differs from that of Cu2+ and provides insights into CuO nanoparticle toxicity mechanisms. Environ. Sci. Nano 2017, 4, 2321–2335. [Google Scholar] [CrossRef]
- Schellhorn, H.E. Regulation of hydroperoxidase (catalase) expression in Escherichia coli. FEMS Microbiol. Lett. 1995, 131, 113–119. [Google Scholar] [CrossRef]
- Loewen, P. Probing the structure of catalase HPII of Escherichia coli—A review. Gene 1996, 179, 39–44. [Google Scholar] [CrossRef]
- Switala, J.; O’Neil, J.O.; Loewen, P.C. Catalase HPII from Escherichia coli exhibits enhanced resistance to denaturation. Biochemistry 1999, 38, 3895–3901. [Google Scholar] [CrossRef]
- Metryka, O.; Wasilkowski, D.; Mrozik, A. Insight into the antibacterial activity of selected metal nanoparticles and alterations within the antioxidant defence system in Escherichia coli, Bacillus cereus and Staphylococcus epidermidis. Int. J. Mol. Sci. 2021, 22, 11811. [Google Scholar] [CrossRef]
- Sohm, B.; Immel, F.; Bauda, P.; Pagnout, C. Insight into the primary mode of action of TiO2 nanoparticles on Escherichia coli in the dark. Proteomics 2015, 15, 98–113. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, H.; Yang, C.-H.; Wang, Q.; Mei, R. Two distinct manganese-containing superoxide dismutase genes in Bacillus cereus: Their physiological characterizations and roles in surviving in wheat rhizosphere. FEMS Microbiol. Lett. 2007, 272, 206–213. [Google Scholar] [CrossRef][Green Version]
- Wang, Y.; Mo, X.; Zhang, L.; Wang, Q. Four superoxide dismutase (isozymes) genes of Bacillus cereus. Ann. Microbiol. 2011, 61, 355–360. [Google Scholar] [CrossRef]
- Gao, T.-T.; Ding, M.-Z.; Li, Y.; Zeng, Q.-C.; Wang, Q. Identification of genes involved in regulating MnSOD2 production and root colonization in Bacillus cereus 905. J. Integr. Agric. 2021, 20, 1570–1584. [Google Scholar] [CrossRef]
- Ganesh Babu, M.M.; Sridhar, J.; Gunasekaran, P. Global transcriptome analysis of Bacillus cereus ATCC 14579 in response to silver nitrate stress. J. Nanobiotechnology 2011, 9, 49. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Curtis, A.; Hoskins, C. Application of nanoparticle technologies in the combat against anti-microbial resistance. Pharmaceutics 2018, 10, 11. [Google Scholar] [CrossRef] [PubMed]
- Cosgrove, K.; Coutts, G.; Jonsson, I.M.; Tarkowski, A.; Kokai-Kun, J.F.; Mond, J.J.; Foster, S.J. Catalase (KatA) and alkyl hydroperoxide reductase (AhpC) have compensatory roles in peroxide stress resistance and are required for survival, persistence, and nasal colonization in Staphylococcus aureus. J. Bacteriol. 2007, 189, 1025–1035. [Google Scholar] [CrossRef] [PubMed]
- Hassan, K.A.; Pederick, V.G.; Elbourne, L.D.; Paulsen, I.T.; Paton, J.C.; McDevitt, C.A.; Eijkelkamp, B.A. Zinc stress induces copper depletion in Acinetobacter baumannii. BMC Microbiol. 2017, 17, 59. [Google Scholar] [CrossRef]
- Raghunath, A.; Perumal, E. Metal oxide nanoparticles as antimicrobial agents: A promise for the future. Int. J. Antimicrob. Agents 2017, 49, 137–152. [Google Scholar] [CrossRef]
- Chandrangsu, P.; Rensing, C.; Helmann, J.D. Metal homeostasis and resistance in bacteria. Nat. Rev. Microbiol. 2017, 15, 338–350. [Google Scholar] [CrossRef]
- Niemirowicz, K.; Swiecicka, I.; Wilczewska, A.Z.; Misztalewska, I.; Kalska-Szostko, B.; Bienias, K.; Bucki, R.; Car, H. Gold-functionalized magnetic nanoparticles restrict growth of Pseudomonas aeruginosa. Int. J. Nanomed. 2014, 9, 2217–2224. [Google Scholar]
- Karavolos, M.H.; Horsburgh, M.J.; Ingham, E.; Foster, S.J. Role and regulation of the superoxide dismutases of Staphylococcus aureus. Microbiology 2003, 149, 2749–2758. [Google Scholar] [CrossRef]
- Osonga, F.J.; Akgul, A.; Yazgan, I.; Akgul, A.; Ontman, R.; Kariuki, V.M.; Eshun, G.B.; Sadik, O.A. Flavonoid-derived anisotropic silver nanoparticles inhibit growth and change the expression of virulence genes in Escherichia coli SM10. RSC Adv. 2018, 8, 4649–4661. [Google Scholar] [CrossRef]
- Xie, Y.; He, Y.; Irwin, P.L.; Jin, T.; Shi, X. Antibacterial activity and mechanism of action of zinc oxide nanoparticles against Campylobacter jejuni. Appl. Environ. Microbiol. 2011, 77, 2325–2331. [Google Scholar] [CrossRef] [PubMed]
- Żur, J.; Piński, A.; Wojcieszyńska, D.; Smułek, W.; Guzik, U. Diclofenac degradation—Enzymes, genetic background and cellular alterations triggered in diclofenac-metabolizing strain Pseudomonas moorei KB4. Int. J. Mol. Sci. 2020, 21, 6786. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Mueller, R.; Nolan, T. Parameters for successful PCR primer design. In Quantitative Real-Time PCR. Methods in Molecular Biology; Biassoni, R., Raso, A., Eds.; Humana: New York, NY, USA, 2020; Volume 2065. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hou, Z.; Fink, R.C.; Black, E.P.; Sugawara, M.; Zhang, Z.; Diez-Gonzalez, F.; Sadowsky, M.J. Gene expression profiling of Escherichia coli in response to interactions with the lettuce rhizosphere. J. Appl. Microbiol. 2012, 113, 1076–1086. [Google Scholar] [CrossRef]
- Ko, K.S.; Kim, J.W.; Kim, J.M.; Kim, W.; Chung, S.I.; Kim, I.J.; Kook, Y.H. Population structure of the Bacillus cereus group as determined by sequence analysis of six housekeeping genes and the plcR gene. Infect. Immun. 2004, 72, 5253–5261. [Google Scholar] [CrossRef]
- Sihto, H.M.; Tasara, T.; Stephan, R.; Johler, S. Validation of reference genes for normalization of qPCR mRNA expression levels in Staphylococcus aureus exposed to osmotic and lactic acid stress conditions encountered during food production and preservation. FEMS Microbiol. Lett. 2014, 356, 134–140. [Google Scholar] [CrossRef]
- Hegeman, G.D. Synthesis of the enzymes of the mandelate pathway by Pseudomonas putida I. Synthesis of enzymes by the wild type. J. Bacteriol. 1966, 91, 1140–1154. [Google Scholar] [CrossRef]
- Banerjee, G.; Pandey, S.; Ray, A.K.; Kumar, R. Bioremediation of heavy metals by a novel bacterial strain Enterobacter cloacae and its antioxidant enzyme activity, flocculant production and protein expression in presence of lead, cadmium and nickel. Water Air Soil Pollut. 2015, 226, 91. [Google Scholar] [CrossRef]
- David, M.; Krishna, P.M.; Sangeetha, J. Elucidation of impact of heavy metal pollution on soil bacterial growth and extracellular polymeric substances flexibility. 3 Biotech 2016, 6, 172. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Bruins, M.E.; Yang, Z.Q.; Liu, S.T.; Rao, P.F. A new formula to calculate activity of superoxide dismutase in indirect assays. Anal. Biochem. 2016, 503, 65–67. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of proteins utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]










| Gene/Product | Sequence of Primer | Product Length [bp] | |
|---|---|---|---|
| Forward (5′-3′) | Reverse (5′-3′) | ||
| E. coli | |||
| Housekeeping genes | |||
| gyrA (DNA gyrase subunit A) | CTTCATCGAATAGACGCGG | TCTGCCGCACGTATTAAAG | 108 |
| gyrB (DNA gyrase subunit B) | GCAAAGAAGACCACTTCCAC | AAGATATTCGGGTGGATCGG | 91 |
| rpoE (RNA polymerase sigma-E factor) | TACAGCAATCCGATACAGCC | TCCCGATGTGGTACAAGAAG | 100 |
| Oxidative stress genes | |||
| katE (CAT HPII) | CATTCGGGAGTAGAGCAGTT | ATGATGAAGTGAGATCGGCA | 89 |
| katG (bifunctional CAT-PER) | ACGTAAATCAGGCCCATCTC | TCTGGATGTTAACTGGGGTG | 105 |
| ycdB (heme-containing PER) | CGTAATCGGGAACATCATGC | TGAAAGAGCAGCAGACGATA | 87 |
| sodA (manganese SOD) | TTATCGCCTTTTTGCACCAG | GCTATCGAACGTGATTTCGG | 110 |
| sodB (cytosolic iron-containing SOD) | CTTCAGCGACTTTTCCAGTC | TCTGAAGGTGGCGTATTCAA | 109 |
| sodC (copper-zinc SOD) | AAGCTGCCAGTGAAAAAGTC | GTTTCAGTAATGGTGACGCT | 88 |
| B. cereus | |||
| Housekeeping genes | |||
| gyrA (DNA gyrase subunit A) | TACGTTGGGCGATGAAGACC | AATCGGTGTACGCTTTCCGT | 103 |
| gyrB (DNA gyrase subunit B) | GCGTGGTATTCCGGTTGGTA | TATAACCGCCACCGCCAAAT | 104 |
| rpoB (RNA polymerase subunit beta) | ACCAGAGGGACCAAACATCG | CTGGGTCAACACGACGGTAT | 101 |
| Oxidative stress genes | |||
| katA (main CAT) | CAACAACGTGATGGTGCGAT | GTTGAATCGCGGTAAGCTGG | 110 |
| katE (CAT HPII) | GGCCCAACCTTAATGGAGGA | TAACCATGTACGCCAACCCC | 110 |
| tpx (thiol PER) | GCGCTGATTTACCATTCGCTC | GAATGAAAGGTCGCGGTGGT | 92 |
| yojM (zinc SOD-like protein) | GAAGGGTGCAGAAAACGGTG | TCAAGTGTGATGTGTGGGGC | 93 |
| sodA1 (manganese SOD) | CCAGAAGCAATCCGTACAGC | CTCCGCCGTTTGGAGATAGG | 91 |
| sodA2 (manganese SOD) | CGAAATAACGGTGGTGGTCA | TGCAACGTCTCCATTAGGCT | 90 |
| S. epidermidis | |||
| Housekeeping genes | |||
| gyrB (DNA gyrase subunit B) | GACAATGGCCGTGGTATTCCT | CCGAATTTACCTCCAGCGTG | 98 |
| rpoB (RNA polymerase subunit beta) | GGGAGCAAACATGCAACGTC | TCTCTTGCGGCTACGTGTTC | 90 |
| pyk (pyruvate kinase) | ACTGCTGGTGTACCTACTGGA | CCTCTACCAACACCTTGACCT | 98 |
| Oxidative stress genes | |||
| bsaA (glutathione peroxidase homolog) | CGCTGCTAAAGGTATGTAAACGA | TCCGGTTTCTTTTGAGGGGAG | 108 |
| katA (CAT) | AGTCGTGATGGACAAATGCG | GTGGCTTCTTGTGTTCAGGC | 109 |
| npr (NADH peroxidase) | CCAGCTACCGAGTGGCTAAA | GCCACCCGCATAGACATCTT | 105 |
| tpx (thiol PER) | ACGCTTACTTGCACGTTCGG | CAGGGTAATTCGTACCTTCGCT | 89 |
| sodA (SOD Mn/Fe) | TCAGCAGTGAAGGGACAGATT | CCACCGCCATTATTAGAACAG | 110 |
| Type of NPs (Size, nm) | E. coli | B. cereus | S. epidermidis | |||
|---|---|---|---|---|---|---|
| Toxicological Parameters [mg L−1] | ||||||
| IC50 | ½IC50 | IC50 | ½IC50 | IC50 | ½IC50 | |
| Ag-NPs (<100) | 7.84 | 3.92 | 480.10 | 240.05 | 442.20 | 221.10 |
| Cu-NPs (25) | 180.80 | 90.40 | 52.15 | 26.075 | 112.00 | 56.00 |
| TiO2-NPs (20) | 43.40 | 21.70 | 50.30 | 25.15 | 703.40 | 351.70 |
| ZnO-NPs (<50) | 176.10 | 88.05 | 319.10 | 159.55 | 201.70 | 100.85 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Metryka, O.; Wasilkowski, D.; Mrozik, A. Evaluation of the Effects of Ag, Cu, ZnO and TiO2 Nanoparticles on the Expression Level of Oxidative Stress-Related Genes and the Activity of Antioxidant Enzymes in Escherichia coli, Bacillus cereus and Staphylococcus epidermidis. Int. J. Mol. Sci. 2022, 23, 4966. https://doi.org/10.3390/ijms23094966
Metryka O, Wasilkowski D, Mrozik A. Evaluation of the Effects of Ag, Cu, ZnO and TiO2 Nanoparticles on the Expression Level of Oxidative Stress-Related Genes and the Activity of Antioxidant Enzymes in Escherichia coli, Bacillus cereus and Staphylococcus epidermidis. International Journal of Molecular Sciences. 2022; 23(9):4966. https://doi.org/10.3390/ijms23094966
Chicago/Turabian StyleMetryka, Oliwia, Daniel Wasilkowski, and Agnieszka Mrozik. 2022. "Evaluation of the Effects of Ag, Cu, ZnO and TiO2 Nanoparticles on the Expression Level of Oxidative Stress-Related Genes and the Activity of Antioxidant Enzymes in Escherichia coli, Bacillus cereus and Staphylococcus epidermidis" International Journal of Molecular Sciences 23, no. 9: 4966. https://doi.org/10.3390/ijms23094966
APA StyleMetryka, O., Wasilkowski, D., & Mrozik, A. (2022). Evaluation of the Effects of Ag, Cu, ZnO and TiO2 Nanoparticles on the Expression Level of Oxidative Stress-Related Genes and the Activity of Antioxidant Enzymes in Escherichia coli, Bacillus cereus and Staphylococcus epidermidis. International Journal of Molecular Sciences, 23(9), 4966. https://doi.org/10.3390/ijms23094966

