A Short Promoter Region Containing Conserved Regulatory Motifs Is Required for Steroidogenic Acute Regulatory Protein (Star) Gene Expression in the Mouse Testis
Abstract
1. Introduction
2. Results
2.1. The Integrity of a Short Promoter Region Harboring a Conserved GATA-Binding Motif Is Essential for Maximal Star Gene Expression in the Mouse Testis
2.2. Changes in Star mRNA and STAR Protein Levels in pStarΔ19-GATAmut Mice Are Not Correlated with Alterations in Basal or Hormone-Induce Testosterone Production
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. CRISPR/Cas9 Generation of Mouse Star Promoter Mutants
4.3. Quantitative Real-Time RT-PCR
4.4. Immunohistochemistry
4.5. Protein Extraction and Western Blot Analysis
4.6. Hormone Assay
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Miller, W.L.; Auchus, R.J. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr. Rev. 2011, 32, 81–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Mattos, K.; Viger, R.S.; Tremblay, J.J. Transcription factors in the regulation of Leydig cell gene expression and function. Front. Endocrinol. 2022, 13, 881309. [Google Scholar] [CrossRef] [Scilit]
- Tremblay, J.J. Molecular regulation of steroidogenesis in endocrine Leydig cells. Steroids 2015, 103, 3–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viger, R.S.; de Mattos, K.; Tremblay, J.J. Insights into the roles of GATA Factors in mammalian testis development and the control of fetal testis gene expression. Front. Endocrinol. 2022, 13, 902198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viger, R.S.; Taniguchi, H.; Robert, N.M.; Tremblay, J.J. Role of the GATA family of transcription factors in andrology. J. Androl. 2004, 25, 441–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tremblay, J.J.; Viger, R.S. Novel roles for GATA transcription factors in the regulation of steroidogenesis. J. Steroid Biochem. Mol. Biol. 2003, 85, 291–298. [Google Scholar] [CrossRef] [Scilit]
- Viger, R.S.; Mazaud Guittot, S.; Anttonen, M.; Wilson, D.B.; Heikinheimo, M. Role of the GATA family of transcription factors in endocrine development, function, and disease. Mol. Endocrinol. 2008, 22, 781–798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tevosian, S.G. Transgenic mouse models in the study of reproduction: Insights into GATA protein function. Reproduction 2014, 148, R1–R14. [Google Scholar] [CrossRef] [Scilit]
- Bergeron, F.; Nadeau, G.; Viger, R.S. GATA4 knockdown in MA-10 Leydig cells identifies multiple target genes in the steroidogenic pathway. Reproduction 2015, 149, 245–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schrade, A.; Kyronlahti, A.; Akinrinade, O.; Pihlajoki, M.; Hakkinen, M.; Fischer, S.; Alastalo, T.P.; Velagapudi, V.; Toppari, J.; Wilson, D.B.; et al. GATA4 is a key regulator of steroidogenesis and glycolysis in mouse Leydig cells. Endocrinology 2015, 156, 1860–1872. [Google Scholar] [CrossRef] [Scilit]
- Padua, M.B.; Jiang, T.; Morse, D.A.; Fox, S.C.; Hatch, H.M.; Tevosian, S.G. Combined loss of the GATA4 and GATA6 transcription factors in male mice disrupts testicular development and confers adrenal-like function in the testes. Endocrinology 2015, 156, 1873–1886. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alpy, F.; Tomasetto, C. START ships lipids across interorganelle space. Biochimie 2014, 96, 85–95. [Google Scholar] [CrossRef] [Scilit]
- Selvaraj, V.; Stocco, D.M.; Clark, B.J. Current knowledge on the acute regulation of steroidogenesis. Biol. Reprod. 2018, 99, 13–26. [Google Scholar] [CrossRef] [Scilit]
- Manna, P.R.; Stetson, C.L.; Slominski, A.T.; Pruitt, K. Role of the steroidogenic acute regulatory protein in health and disease. Endocrine 2016, 51, 7–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, D.; Sugawara, T.; Strauss, J.F., III; Clark, B.J.; Stocco, D.M.; Saenger, P.; Rogol, A.; Miller, W.L. Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science 1995, 267, 1828–1831. [Google Scholar] [CrossRef] [Scilit]
- Caron, K.M.; Soo, S.C.; Wetsel, W.C.; Stocco, D.M.; Clark, B.J.; Parker, K.L. Targeted disruption of the mouse gene encoding steroidogenic acute regulatory protein provides insights into congenital lipoid adrenal hyperplasia. Proc. Natl. Acad. Sci. USA 1997, 94, 11540–11545. [Google Scholar] [CrossRef] [Scilit]
- Tremblay, J.J.; Hamel, F.; Viger, R.S. Protein kinase A-dependent cooperation between GATA and C/EBP transcription factors regulates StAR promoter activity. Endocrinology 2002, 143, 3935–3945. [Google Scholar] [CrossRef] [Scilit]
- Tremblay, J.J.; Viger, R.S. GATA factors differentially activate multiple gonadal promoters through conserved GATA regulatory elements. Endocrinology 2001, 142, 977–986. [Google Scholar] [CrossRef]
- Bouchard, M.F.; Bergeron, F.; Grenier Delaney, J.; Harvey, L.M.; Viger, R.S. In vivo ablation of the conserved GATA binding motif in the Amh promoter impairs Amh expression in the male mouse. Endocrinology 2019, 160, 817–826. [Google Scholar] [CrossRef] [Scilit]
- Lavoie, H.A.; King, S.R. Transcriptional regulation of steroidogenic genes: STARD1, CYP11A1 and HSD3B. Exp. Biol. Med. 2009, 234, 880–907. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clark, B.J.; Wells, J.; King, S.R.; Stocco, D.M. The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J. Biol. Chem. 1994, 269, 28314–28322. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Rehman, S.; Tang, X.; Gu, K.; Fan, Q.; Chen, D.; Ma, W. Methodologies for improving HDR efficiency. Front. Genet. 2018, 9, 691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manna, P.R.; Dyson, M.T.; Stocco, D.M. Regulation of the steroidogenic acute regulatory protein gene expression: Present and future perspectives. Mol. Hum. Reprod. 2009, 15, 321–333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manna, P.R.; Dyson, M.T.; Eubank, D.W.; Clark, B.J.; Lalli, E.; Sassone-Corsi, P.; Zeleznik, A.J.; Stocco, D.M. Regulation of steroidogenesis and the steroidogenic acute regulatory protein by a member of the cAMP response-element binding protein family. Mol. Endocrinol. 2002, 16, 184–199. [Google Scholar] [CrossRef]
- Reinhart, A.J.; Williams, S.C.; Clark, B.J.; Stocco, D.M. SF-1 (steroidogenic factor-1) and C/EBP beta (CCAAT/enhancer binding protein-beta) cooperate to regulate the murine StAR (steroidogenic acute regulatory) promoter. Mol. Endocrinol. 1999, 13, 729–741. [Google Scholar] [CrossRef] [Scilit]
- Silverman, E.; Eimerl, S.; Orly, J. CCAAT enhancer-binding protein beta and GATA-4 binding regions within the promoter of the steroidogenic acute regulatory protein (StAR) gene are required for transcription in rat ovarian cells. J. Biol. Chem. 1999, 274, 17987–17996. [Google Scholar] [CrossRef] [Scilit]
- Hasegawa, T.; Zhao, L.; Caron, K.M.; Majdic, G.; Suzuki, T.; Shizawa, S.; Sasano, H.; Parker, K.L. Developmental roles of the steroidogenic acute regulatory protein (StAR) as revealed by StAR knockout mice. Mol. Endocrinol. 2000, 14, 1462–1471. [Google Scholar] [CrossRef]
- Reinhart, A.J.; Williams, S.C.; Stocco, D.M. Transcriptional regulation of the StAR gene. Mol. Cell. Endocrinol. 1999, 151, 161–169. [Google Scholar] [CrossRef] [Scilit]
- Haeussler, M.; Schonig, K.; Eckert, H.; Eschstruth, A.; Mianne, J.; Renaud, J.B.; Schneider-Maunoury, S.; Shkumatava, A.; Teboul, L.; Kent, J.; et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. 2016, 17, 148. [Google Scholar] [CrossRef] [Scilit]
- Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.; Jiang, W.; Marraffini, L.A.; et al. Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [Scilit]
- Truett, G.E.; Heeger, P.; Mynatt, R.L.; Truett, A.A.; Walker, J.A.; Warman, M.L. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques 2000, 29, 52–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brinkman, E.K.; Chen, T.; Amendola, M.; van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014, 42, e168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yokoyama, T.; Omotehara, T.; Hirano, T.; Kubota, N.; Yanai, S.; Hasegawa, C.; Takada, T.; Mantani, Y.; Hoshi, N. Identification of reference genes for quantitative PCR analyses in developing mouse gonads. J. Vet. Med. Sci. 2018, 80, 1534–1539. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–4088. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]







| Utility | Forward Primer | Reverse Primer |
|---|---|---|
| Guide 1 | 5′-CACCGAGTCATCAGTCATTGTGCAG-3′ | 5′-AAACCTGCACAATGACTGATGACTC-3′ |
| Guide 2 | 5′-CACCGATGATGCACAGCCTTCCAC-3′ | 5′-AAACGTGGAAGGCTGTGCATCATC-3′ |
| ssODN | 5′-AGTCTGCTCCCTCCCACCTTGGCCAGCACTGCAGGATGAGGCAATCATTCCATCCTTGACGCT CTGCACAATGACTGATGACTTTTTTcggcCAAGTGATGATGCACAGCCTTCCACGGCAAGCATTTA AGGCAGCGCACTTGATCTGCGCCACAGCTGCAGGACTCAGGACCTTGAAAGGCTC-3′ | |
| Genotyping | 5′-GCACCTCAGTTACTGGGCAT-3′ | 5′-ACACAGCTTGAACGTAGCGA-3′ |
| Gene Product | Forward Primer | Reverse Primer |
|---|---|---|
| Star | 5′-CAACTGGAAGCAACACTCTA-3′ | 5′-CCTTGACATTTGGGTTCCAC-3′ |
| Actb | 5′-CTGTCGAGTCGCGTCCACC-3′ | 5′-ATTCCCACCATCACACCCTGG-3′ |
| Gapdh | 5′-GTCGGTGTGAACGGATTTG-3′ | 5′-AAGATGGTGATGGGCTTCC-3′ |
| Polr2a | 5′-ATCAACAATCAGCTGCGGCG-3′ | 5′-GCCAGACTTCTGCATGGCAC-3′ |
| Ppia | 5′-CGCGTCTCCTTCGAGCTGTTTG-3′ | 5′-TGTAAAGTCACCACCCTGGCACAT-3′ |
| Rplp0 | 5′-AGATTCGGGATATGCTGTTGGC-3′ | 5′-TCGGGTCCTAGACCAGTGTTC-3′ |
| Tuba1b | 5′-CGCCTTCTAACCCGTTGCTA-3′ | 5′-CCTCCCCCAATGGTCTTGTC-3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bouchard, M.F.; Picard, J.; Tremblay, J.J.; Viger, R.S. A Short Promoter Region Containing Conserved Regulatory Motifs Is Required for Steroidogenic Acute Regulatory Protein (Star) Gene Expression in the Mouse Testis. Int. J. Mol. Sci. 2022, 23, 12009. https://doi.org/10.3390/ijms231912009
Bouchard MF, Picard J, Tremblay JJ, Viger RS. A Short Promoter Region Containing Conserved Regulatory Motifs Is Required for Steroidogenic Acute Regulatory Protein (Star) Gene Expression in the Mouse Testis. International Journal of Molecular Sciences. 2022; 23(19):12009. https://doi.org/10.3390/ijms231912009
Chicago/Turabian StyleBouchard, Marie France, Julia Picard, Jacques J. Tremblay, and Robert S. Viger. 2022. "A Short Promoter Region Containing Conserved Regulatory Motifs Is Required for Steroidogenic Acute Regulatory Protein (Star) Gene Expression in the Mouse Testis" International Journal of Molecular Sciences 23, no. 19: 12009. https://doi.org/10.3390/ijms231912009
APA StyleBouchard, M. F., Picard, J., Tremblay, J. J., & Viger, R. S. (2022). A Short Promoter Region Containing Conserved Regulatory Motifs Is Required for Steroidogenic Acute Regulatory Protein (Star) Gene Expression in the Mouse Testis. International Journal of Molecular Sciences, 23(19), 12009. https://doi.org/10.3390/ijms231912009

