Properties of Ginkgo biloba L.: Antioxidant Characterization, Antimicrobial Activities, and Genomic MicroRNA Based Marker Fingerprints
Abstract
1. Introduction
2. Results and Discussion
2.1. Quantitative Analysis of G. biloba Leaf Extracts
2.2. Antioxidant Activity
2.3. Total Polyphenol and Flavonoid Content
2.4. Antimicrobial Activity with Disc Diffusion Method
2.5. Minimal Inhibition Concentration (MIC)
2.6. MicroRNA-Marker Assay
3. Materials and Methods
3.1. Plant Materials and Sample Preparation
3.2. LC-MS/MS Quantitative Analysis
3.3. Analyses of Antioxidant Activity
3.3.1. Free Radical Scavenging Activity
3.3.2. Molybdenum-Reducing Antioxidant Power
3.3.3. Total Polyphenol Content
3.3.4. Total Flavonoid Content
3.4. Detection of Antimicrobial Activity
3.5. Disc Diffusion Method
3.6. Minimal Inhibitory Concentration
3.7. miRNA-marker Assay
3.8. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bhattacharjee, T.; Sen, S.; Chakraborty, R.; Maurya, P.K.; Chattopadhyay, A. Cultivation of Medicinal Plants: Special Reference to Important Medicinal Plants of India. In Herbal Medicine in India; Springer Singapore: Singapore, Singapore, 2020; pp. 101–115. [Google Scholar]
- Hedayat, K.M.; Lapraz, J.-C.; Schuff, B. Medicinal plants in clinical practice. In The Theory of Endobiogeny; Elsevier: Amsterdam, The Netherlands, 2020; pp. 57–60. [Google Scholar]
- Raji, R.N.; Vysakh, A.; Suma, D.; Preetha, M.K.; Latha, M.S. Phytochemicals from Traditional Medicinal Plants. In Phytochemicals from Medicinal Plants; Apple Academic Press: Palm Bay, FL, USA, 2019; pp. 3–32. [Google Scholar]
- Srivastava, J.P.; Lambert, J.; Vietmeyer, N. Medicinal plants; World Bank Technical Papers; The World Bank: Washington, DC, USA, 1996; ISBN 978-0-8213-3613-7. [Google Scholar]
- Wallace, R.J. Antimicrobial properties of plant secondary metabolites. Proc. Nutr. Soc. 2004, 63, 621–629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reghu, R.; Sahadevan, P.; Sugathan, S. Antimicrobial Agents from Plants. In Bioresources and Bioprocess in Biotechnology; Springer Singapore: Singapore, Singapore, 2017; pp. 271–290. [Google Scholar]
- Fazal, H.; Ahmad, N.; Ullah, I.; Inayat, H.; Khan, L.; Abbasi, B.H. Antibacterial potential in Parthenium hysterophorus, Stevia rebaudiana and ginkgo biloba. Pakistan J. Bot. 2011, 43, 1307–1313. [Google Scholar]
- Braquet, P. The ginkgolides from Chinese pharmacopeia to a new class of pharmacological agents: The antagonists of platelet activating factor. Ginkgolides Chem. Biol. Pharmacol. Chem. Perspect. 1988, 1, 15–34. [Google Scholar]
- Singh, B.; Kaur, P.; Singh, R.D.; Ahuja, P.S. Biology and chemistry of Ginkgo biloba. Fitoterapia 2008, 79, 401–418. [Google Scholar] [CrossRef] [Scilit]
- Záhradníková, L.; Schmidt, Š.; Sekretár, S.; Janáč, L. Determination of the antioxidant activity of Ginkgo biloba leaves extract. J. Food Nutr. Res. 2007, 46, 15–19. [Google Scholar]
- Ronowicz, J.; Kupcewicz, B.; Budzisz, E. Chemometric analysis of antioxidant properties of herbal products containing Ginkgo biloba extract. Open Life Sci. 2013, 8. [Google Scholar] [CrossRef] [Scilit]
- Atzori, C.; Bruno, A.; Chichino, G.; Bombardelli, E.; Scaglia, M.; Ghione, M. Activity of bilobalide, a sesquiterpene from Ginkgo biloba, on Pneumocystis carinii. Antimicrob. Agents Chemother. 1993, 37, 1492–1496. [Google Scholar] [CrossRef] [Scilit]
- Silva, A.M.; Silva, S.C.; Soares, J.P.; Martins-Gomes, C.; Teixeira, J.P.; Leal, F.; Gaivão, I. Ginkgo biloba L. Leaf Extract Protects HepG2 Cells Against Paraquat-Induced Oxidative DNA Damage. Plants 2019, 8, 556. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Li, B.; Xia, Z.M.; Tian, Y.; Zhang, D.; Rui, W.J.; Xiao, F.J. Anticancer Effects of Five Biflavonoids from Ginkgo Biloba L. Male Flowers In Vitro. Molecules 2019, 24, 1496. [Google Scholar] [CrossRef] [Scilit]
- Perry, E.K.; Pickering, A.T.; Wang, W.W.; Houghton, P.J.; Perry, N.S.L. Medicinal Plants and Alzheimer’s Disease: from Ethnobotany to Phytotherapy. J. Pharm. Pharmacol. 1999, 51, 527–534. [Google Scholar] [CrossRef] [Scilit]
- Kleijnen, J.; Knipschild, P. Ginkgo biloba. Lancet 1992, 340, 1136–1139. [Google Scholar] [CrossRef] [Scilit]
- Xie, L.; Hettiarachchy, N.S.; Jane, M.E.; Johnson, M.G. Antimicrobial activity of Ginkgo biloba leaf extract on Listeria monocytogenes. J. Food Sci. 2003, 68, 268–270. [Google Scholar] [CrossRef] [Scilit]
- Diamond, B.J.; Shiflett, S.C.; Feiwel, N.; Matheis, R.J.; Noskin, O.; Richards, J.A.; Schoenberger, N.E. Ginkgo biloba extract: Mechanisms and clinical indications. Arch. Phys. Med. Rehabil. 2000, 81, 668–678. [Google Scholar] [CrossRef] [Scilit]
- Ganie, S.A.; Mondal, T.K. Genome-wide development of novel miRNA-based microsatellite markers of rice (Oryza sativa) for genotyping applications. Mol. Breed. 2015, 35, 51. [Google Scholar] [CrossRef] [Scilit]
- Yadav, C.B.; Muthamilarasan, M.; Pandey, G.; Khan, Y.; Prasad, M. Development of novel microRNA-based genetic markers in foxtail millet for genotyping applications in related grass species. Mol. Breed. 2014, 34, 2219–2224. [Google Scholar] [CrossRef] [Scilit]
- Mondal, T.K.; Ganie, S.A. Identification and characterization of salt responsive miRNA-SSR markers in rice (Oryza sativa). Gene 2014, 535, 204–209. [Google Scholar] [CrossRef] [Scilit]
- Fu, D.; Ma, B.; Mason, A.S.; Xiao, M.; Wei, L.; An, Z. MicroRNA-based molecular markers: a novel PCR-based genotyping technique in Brassica species. Plant Breed. 2013, 132, 375–381. [Google Scholar] [CrossRef] [Scilit]
- Cordenunsi, B.R.; Oliveira do Nascimento, J.R.; Genovese, M.I.; Lajolo, F.M. Influence of Cultivar on Quality Parameters and Chemical Composition of Strawberry Fruits Grown in Brazil. J. Agric. Food Chem. 2002, 50, 2581–2586. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Balibrea, S.; Moreno, D.A.; García-Viguera, C. Influence of light on health-promoting phytochemicals of broccoli sprouts. J. Sci. Food Agric. 2008, 88, 904–910. [Google Scholar] [CrossRef] [Scilit]
- Kobus, J.; Flaczyk, E.; Siger, A.; Nogala-KaÅ‚ucka, M.; Korczak, J.; Pegg, R.B. Phenolic compounds and antioxidant activity of extracts of Ginkgo leaves. Eur. J. Lipid Sci. Technol. 2009, 111, 1150–1160. [Google Scholar] [CrossRef] [Scilit]
- Ellnain-Wojtaszek, M.; Kruczyński, Z.; Kasprzak, J. Analysis of the content of flavonoids, phenolic acids as well as free radicals from Ginkgo biloba L. leaves during the vegetative cycle. Acta Pol. Pharm. 2001, 58, 205–209. [Google Scholar] [PubMed]
- Torres de Pinedo, A.; Peñalver, P.; Morales, J.C. Synthesis and evaluation of new phenolic-based antioxidants: Structure–activity relationship. Food Chem. 2007, 103, 55–61. [Google Scholar] [CrossRef] [Scilit]
- Aliyu, A.B.; Ibrahim, M.A.; Musa, A.M.; Musa, A.O.; Kiplimo, J.J.; Oyewale, A.O. Free radical scavenging and total antioxidant capacity of root extracts of Anchomanes difformis Engl. (Araceae). Acta Pol. Pharm. 2013, 70, 115–121. [Google Scholar] [PubMed]
- Stefanovits-Bányai, É.; Szentmihályi, K.; Hegedűs, A.; Koczka, N.; Váli, L.; Taba, G.; Blázovics, A. Metal ion and antioxidant alterations in leaves between different sexes of Ginkgo biloba L. Life Sci. 2006, 78, 1049–1056. [Google Scholar] [CrossRef] [Scilit]
- Itil, T.; Martorano, D. Natural substances in psychiatry (Ginkgo biloba in dementia). Psychopharmacol. Bull. 1995, 31, 147–158. [Google Scholar] [PubMed]
- Le Bars, P.L. A Placebo-Controlled, Double-blind, Randomized Trial of an Extract of Ginkgo Biloba for Dementia. JAMA J. Am. Med. Assoc. 1997, 278, 1327. [Google Scholar] [CrossRef] [Scilit]
- Stoll, S.; Scheuer, K.; Pohl, O.; Müller, W. Ginkgo Biloba Extract (EGb 761) Independently Improves Changes in Passive Avoidance Learning and Brain Membrane Fluidity in the Aging Mouse. Pharmacopsychiatry 2007, 29, 144–149. [Google Scholar] [CrossRef] [Scilit]
- Khalili, R.M.A.; Shafekh, S.E.; Norhayati, A.H.; Fatahudin, I.M.; Rahimah, R.; Norkamalia, H.; Azimah, A.N. Total Phenolic Content and In vitro Antioxidant Activity of Winged Bean (Psophocarpus tetragonolobus). Pakistan J. Nutr. 2013, 12, 416–422. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.-G.; Wu, S.-Q.; Li, P.; Yang, H. Advancement in the chemical analysis and quality control of flavonoid in Ginkgo biloba. J. Pharm. Biomed. Anal. 2015, 113, 212–225. [Google Scholar] [CrossRef] [Scilit]
- Cowan, M.M. Plant products as antimicrobial agents. Clin. Microbiol. Rev. 1999, 12, 564–582. [Google Scholar]
- Kumar, S.; Pandey, A.K. Chemistry and Biological Activities of Flavonoids: An Overview. Sci. World J. 2013, 2013, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Yao, L.H.; Jiang, Y.M.; Shi, J.; Tomás-Barberán, F.A.; Datta, N.; Singanusong, R.; Chen, S.S. Flavonoids in food and their health benefits. Plant Foods Hum. Nutr. 2004, 59, 113–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, J.-L.; Lu, F.-L.; Liu, Y.-C.; Shih, Y.-C.; Lo, C.-F. Fingerprint Analysis of Ginkgo biloba Extract and Ginkgo semen in Preparations by LC-Q-TOF/MS. J. Food Drug Anal. 2013, 21, 27–39. [Google Scholar] [CrossRef]
- Sati, P.; Pandey, A.; Palni, L.M.S. Antimicrobial Potential of Leaf Extracts of Ginkgo biloba L., Growing in Uttarakhand, India. Natl. Acad. Sci. Lett. 2012, 35, 201–206. [Google Scholar] [CrossRef] [Scilit]
- Tao, R.; Wang, C.-Z.; Kong, Z.-W. Antibacterial/Antifungal Activity and Synergistic Interactions between Polyprenols and Other Lipids Isolated from Ginkgo Biloba L. Leaves. Molecules 2013, 18, 2166–2182. [Google Scholar] [CrossRef] [Scilit]
- Mazzanti, G.; Mascellino, M.; Battinelli, L.; Coluccia, D.; Manganaro, M.; Saso, L. Antimicrobial investigation of semipurified fractions of Ginkgo biloba leaves. J. Ethnopharmacol. 2000, 71, 83–88. [Google Scholar] [CrossRef] [Scilit]
- Adawadkar, P.D.; El Sohly, M.A. Isolation, purification and antimicrobial activity of anacardic acids from Ginkgo biloba fruits. Fitoterapia 1981, 52, 129–135. [Google Scholar]
- Choi, J.G.; Jeong, S.I.; Ku, C.S.; Sathishkumar, M.; Lee, J.J.; Mun, S.P.; Kim, S.M. Antibacterial activity of hydroxyalkenyl salicylic acids from sarcotesta of Ginkgo biloba against vancomycin-resistant Enterococcus. Fitoterapia 2009, 80, 18–20. [Google Scholar] [CrossRef] [Scilit]
- Tewari, G.; Tewari, B.L.; Kishor, K.; Nailwal, T.K.; Singh, M. Comparative phytochemical composition and antimicrobial potential of leaf and twig extracts of Ginkgo biloba L. from India. G-J. Environ. Sci. Technol. 2015, 2, 97–100. [Google Scholar]
- Bajpai, V.K.; Sharma, A.; Baek, K.-H. Antibacterial mode of action of Ginkgo biloba leaf essential oil: Effect on morphology and membrane permeability. Bangladesh J. Pharmacol. 2015, 10, 337. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.-S.; Kim, M.-J. Selective Responses of Three Ginkgo biloba Leaf-Derived Constituents on Human Intestinal Bacteria. J. Agric. Food Chem. 2002, 50, 1840–1844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sati, S.C.; Joshi, S. Antibacterial Activities of Ginkgo biloba L. Leaf Extracts. Sci. World J. 2011, 11, 2237–2242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Zhao, J.; Zhang, M.; Li, W.; Luo, K.; Lu, Z.; Zhang, C.; Jin, B. Identification and characterization of microRNA expression in Ginkgo biloba L. leaves. Tree Genet. Genomes 2015, 11, 76. [Google Scholar] [CrossRef] [Scilit]
- Xu, M.; Xu, L.A.; Cao, F.L.; Zhang, H.J.; Yu, F.X. Development of novel chloroplast microsatellite markers for Ginkgo biloba. Genet. Mol. Res. 2015, 14, 7715–7720. [Google Scholar] [CrossRef] [Scilit]
- Shen, L.; Chen, X.-Y.; Zhang, X.; Li, Y.-Y.; Fu, C.-X.; Qiu, Y.-X. Genetic variation of Ginkgo biloba L. (Ginkgoaceae) based on cpDNA PCR-RFLPs: inference of glacial refugia. Heredity Edinb. 2005, 94, 396–401. [Google Scholar] [CrossRef] [Scilit]
- Padmalatha, K.; Prasad, M. Optimization of DNA isolation and PCR protocol for RAPD analysis of selected medicinal and aromatic plants of conservation concern from Peninsular India. African J. Biotechnol. 2006, 5, 230–234. [Google Scholar]
- Vukic, M.D.; Vukovic, N.L.; Djelic, G.T.; Obradovic, A.; Kacaniova, M.M.; Markovic, S.; Popović, S.; Baskić, D. Phytochemical analysis, antioxidant, antibacterial and cytotoxic activity of different plant organs of Eryngium serbicum L. Ind. Crops Prod. 2018, 115, 88–97. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Moreno, C.; Larrauri, J.A.; Saura-Calixto, F. A procedure to measure the antiradical efficiency of polyphenols. J. Sci. Food Agric. 1998, 76, 270–276. [Google Scholar] [CrossRef]
- Prieto, P.; Pineda, M.; Aguilar, M. Spectrophotometric Quantitation of Antioxidant Capacity through the Formation of a Phosphomolybdenum Complex: Specific Application to the Determination of Vitamin E. Anal. Biochem. 1999, 269, 337–341. [Google Scholar] [CrossRef] [Scilit]
- Singleton, V.L.; Orthofer, R.; Lamuela-Raventós, R.M. Analysis of total phenols and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1999; Volume 299, pp. 152–178. [Google Scholar]
- Willett, W.C. Balancing life-style and genomics research for disease prevention. Science 2002, 296, 695–698. [Google Scholar] [CrossRef] [Scilit]
- Ražná, K.; Nôžková, J.; Hlavačková, L.; Brutch, N.; Porokhovinova, E.; Shelenga, T.; Pavlov, A. Genotyping of Flax Genetic Resources by Mirna-Based Molecular Markers and Morphology. Agriculture 2015, 61, 129–138. [Google Scholar] [CrossRef] [Scilit]
- Hlavačková, L.; Nôžková, J.; Porokhovinova, E.; Brutch, N.; Shelenga, T.; Bjelková, M.; Ražná, K. Analysis of miRNA polymorphism during the selected developmental processes of flax. J. Cent. Eur. Agric. 2016, 17, 707–724. [Google Scholar] [CrossRef] [Scilit]
- Users Guide Version 9.2 SAS/STAT; SAS Institute Inc.: Cary, NC, USA, 2009.
- Garcia-Vallve, S.; Palau, J.; Romeu, A. Horizontal gene transfer in glycosyl hydrolases inferred from codon usage in Escherichia coli and Bacillus subtilis. Mol. Biol. Evol. 1999, 16, 1125–1134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Sample Availability: Samples of Ginkgo biloba L. from selected localities of Slovakia are available from the authors. |





| No. | tR | Compound | Concentration (μg/g) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| S1 | S2 | S3 | S4 | S5 | S6 | S7 | S8 | S9 | |||
| 1 | 3.49 | Syringic acid | 149.23 ± 0.78 | 189.38 ± 0.98 | 49.33 ± 0.26 | 77.68 ± 0.54 | 38.23 ± 0.33 | 133.58 ± 0.89 | 154.56 ± 0.78 | 197.36 ± 1.23 | 111.09 ± 1.16 |
| 2 | 3.68 | Protocatechuic acid | 298.23 ± 1.69 | 111.23 ± 1.22 | 147.66 ± 1.98 | 133.28 ± 0.23 | 122.56 ± 0.28 | 97.58 ± 0.79 | 277.38 ± 2.03 | 354.68 ± 3.05 | 322.21 ± 3.66 |
| 3 | 4.69 | Chlorogenic acid | 168.65 ± 1.65 | 223.35 ± 1.98 | 109.88 ± 1.11 | 54.33 ± 0.12 | 57.69 ± 0.68 | 244.36 ± 2.68 | 111.56 ± 1.86 | 97.33 ± 1.99 | 113.05 ± 1.53 |
| 4 | 5.52 | Caffeic acid | 211.87 ± 2.02 | 165.35 ± 1.63 | 247.21 ± 2.68 | 111.28 ± 1.12 | 120.33 ± 1.56 | 168.69 ± 1.58 | 285.69 ± 2.78 | 77.89 ± 1.27 | 135.42 ± 2.01 |
| 5 | 5.72 | Quercetin-3-O-rutinoside | 366.11 ± 2.26 | 498.38 ± 2.89 | 287.23 ± 2.21 | 228.36 ± 1.99 | 211.23 ± 1.46 | 387.77 ± 4.39 | 311.12 ± 3.21 | 226.25 ± 2.60 | 289.99 ± 2.25 |
| 6 | 6.38 | p-Coumaric acid | 186.22 ± 0.58 | 97.35 ± 0.59 | 101.36 ± 1.25 | 198.88 ± 1.78 | 91.13 ± 1.43 | 94.45 ± 1.25 | 177.58 ± 1.36 | 197.23 ± 2.68 | 177.07 ± 1.63 |
| 7 | 6.47 | Quercetin-3-O-glucoside | 111.59 ± 1.19 | 199.88 ± 0.77 | 144.58 ± 1.36 | 77.21 ± 0.38 | 222.34 ± 3.01 | 146.55 ± 0.88 | 77.58 ± 1.25 | 56.28 ± 0.34 | 98.22 ± 0.47 |
| 8 | 6.57 | Kaempferol-3-O-glucoside | 44.36 ± 0.21 | 31.44 ± 0.23 | 35.88 ± 0.15 | 27.12 ± 0.18 | 14.23 ± 0.07 | 24.55 ± 0.79 | 39.88 ± 0.13 | 37.69 ± 0.45 | 29.28 ± 0.04 |
| 9 | 6.75 | Isorhamnetin-O-glucoside | 3.56 ± 0.09 | 7.58 ± 0.08 | 6.25 ± 0.04 | 7.21 ± 0.11 | 1.28 ± 0.03 | 4.54 ± 0.02 | 9.11 ± 0.04 | 3.11 ± 0.08 | 4.66 ± 0.11 |
| 10 | 6.93 | Luteolin-7-O-glucoside | 9.28 ± 0.12 | 14.46 ± 0.09 | 7.36 ± 0.08 | 1.54 ± 0.05 | 2.56 ± 0.02 | 16.68 ± 0.08 | 17.14 ± 0.05 | 7.55 ± 0.03 | 11.69 ± 0.13 |
| 11 | 7.09 | Rosmarinic acid | 59.26 ± 0.23 | 116.35 ± 1.11 | 99.89 ± 1.22 | 12.98 ± 0.03 | 7.59 ± 0.02 | 77.68 ± 0.36 | 44.39 ± 0.38 | 69.99 ± 0.37 | 49.99 ± 0.45 |
| 12 | 7.34 | Isorhamnetin | 11.29 ± 0.08 | 29.23 ± 0.16 | 7.59 ± 0.03 | 3.23 ± 0.05 | 4.26 ±0.03 | 19.66 ± 0.12 | 24.29 ± 0.11 | 2.68 ± 0.04 | 36.55 ± 0.22 |
| 13 | 8.46 | Luteolin | 41.26 ± 0.15 | 71.77 ± 1.69 | 11.23 ± 0.05 | 19.28 ± 0.14 | 17.68 ± 0.08 | 31.11 ± 0.15 | 51.36 ± 0.69 | 111.23 ± 0.77 | 41.02 ± 0.28 |
| 14 | 8.52 | Quercetin | 68.25 ± 0.14 | 223.99 ± 2.98 | 211.39 ± 1.29 | 122.44 ± 2.29 | 158.68 ± 1.57 | 199.26 ± 1.28 | 58.11 ± 0.11 | 114.44 ± 0.46 | 77.68 ± 0.43 |
| 15 | 9.50 | Kaempferol | 17.52 ± 0.13 | 84.22 ± 1.26 | 36.29 ± 0.12 | 29.56 ± 0.37 | 19.58 ± 0.08 | 56.47 ± 0.28 | 21.33 ± 0.27 | 9.35 ± 0.11 | 21.65 ± 0.16 |
| Sample/Locality | DPPH (mg TEAC/g FM) | MRP (mg TEAC/g FM) | TPC (mg GAE/g FM) | TFC (μg QE/g FM) |
|---|---|---|---|---|
| Rimavská Sobota | 0.394 ± 0.011b | 25.377 ± 0.086e | 2.428 ± 0.046b | 0.156 ± 0.015d |
| Košice | 1.545 ± 0.112a | 35.485 ± 0.464a | 2.804 ± 0.131a | 4.640 ± 0.025a |
| Budimír | 1.224 ± 0.021a | 26.226 ± 0.132d | 1.967 ± 0.031d | 2.982 ± 0.113a |
| Veľký Blh | 0.502 ± 0.012b | 26.306 ± 0.132d | 1.695 ± 0.018e | 1.193 ± 0.001bcd |
| Palárikovo | 1.338 ± 0.021a | 20.748 ± 0.418g | 2.107 ± 0.100c | 2.972 ± 0.045a |
| Lučenec | 1.333 ± 0.051a | 32.545 ± 0.177b | 2.755 ± 0.073a | 2.084 ± 0.057abc |
| Topoľčianky | 0.558 ± 0.084b | 26.266 ± 0.096d | 1.785 ± 0.079e | 0.676 ± 0.195d |
| Nová Ves | 0.395 ± 0.022b | 21.621 ± 0.298f | 1.476 ± 0.083f | 2.351 ± 0.059ab |
| Šurianky | 0.997 ± 0.026b | 26.835 ± 0.241c | 2.095 ± 0.048cd | 0.741 ± 0.015cd |
| Tested Gram-Negative Bacteria | |||||
|---|---|---|---|---|---|
| Sample Locality | EC | KP | SE | SS | YE |
| Rimavská Sobota | 6.67 ± 1.53a | 6.67 ± 1.53 | 6.67 ± 1.53a | 5.33 ± 1.53a | 6.33 ± 1.53a |
| Košice | 11.00 ± 1.00ab | 9.00 ± 1.00 | 12.33 ± 2.08ab | 12.33 ± 1.53ab | 11.00 ± 1.00ab |
| Budimír | 6.00 ± 1.00b | 7.33 ± 2.08 | 5.00 ± 1.00b | 6.00 ± 1.00b | 7.00 ± 2.65 |
| Veľký Blh | 8.00 ± 1.00c | 5.67 ± 1.53 | 5.00 ± 2.00b | 4.33 ± 0.58b | 6.67 ± 1.53 |
| Palárikovo | 4.00 ± 1.00bc | 5.00 ± 3.00 | 5.00 ± 1.00b | 4.00 ± 1.00b | 5.00 ± 1.00b |
| Lučenec | 5.00 ± 1.00b | 5.00 ± 1.00 | 6.67 ± 1.53b | 7.00 ± 1.00b | 4.00 ± 1.00b |
| Topoľčianky | 6.00 ± 1.73b | 6.67 ± 1.53 | 6.67 ± 1.53b | 6.00 ± 2.65b | 5.33 ± 1.15b |
| Nová Ves | 5.67 ± 1.53b | 5.33 ± 1.53 | 5.33 ± 0.58b | 7.00 ± 1.00b | 5.67 ± 0.58b |
| Šurianky | 3.33 ± 1.53bc | 5.00 ± 1.00 | 4.67 ± 1.53b | 5.33 ± 0.58b | 5.67 ± 2.08b |
| Tested Gram-Positive Bacteria | |||||
|---|---|---|---|---|---|
| Sample Locality | BT | CP | HI | LM | SA |
| Rimavská Sobota | 5.00 ± 1.00 | 6.00 ± 1.00 | 6.67 ± 1.53 | 6.00 ± 1.00 | 5.33 ± 1.53 |
| Košice | 8.00 ± 1.00a | 8.00 ± 2.65a | 10.00 ± 2.00a | 6.00 ± 4.58a | 8.00 ± 1.00a |
| Budimír | 3.00 ± 1.00a | 5.00 ± 1.00 | 5.33 ± 1.53a | 6.00 ± 1.00 | 6.00 ± 1.00 |
| Veľký Blh | 2.67 ± 1.53a | 3.67 ± 1.53a | 4.00 ± 1.00a | 5.00 ± 1.00 | 4.67 ± 2.08 |
| Palárikovo | 3.00 ± 1.00a | 4.00 ± 1.00 | 2.67 ± 2.08a | 5.33 ± 1.53 | 5.00 ± 1.00 |
| Lučenec | 3.33 ± 2.08a | 4.00 ± 1.00 | 3.00 ± 1.00a | 3.67 ± 1.53 | 6.67 ± 1.53 |
| Topoľčianky | 4.33 ± 1.15a | 6.00 ± 1.00 | 5.00 ± 1.00a | 5.00 ± 1.00 | 3.33 ± 1.53a |
| Nová Ves | 2.00 ± 1.00a | 6.00 ± 1.00 | 3.00 ± 1.00a | 3.00 ± 1.00a | 4.00 ± 2.00 |
| Šurianky | 3.00 ± 1.00a | 3.67 ± 1.53a | 4.00 ± 1.00a | 3.33 ± 1.53a | 4.00 ± 1.00 |
| Tested Gram-Negative Bacteria | ||||||
|---|---|---|---|---|---|---|
| Sample/Locality | EC | KP | SE | SS | YE | |
| Rimavská Sobota | MIC 50 | 263.3 | 263.3 | 130.6 | 263.3 | 128.1 |
| MIC 90 | 285.9 | 285.9 | 143.8 | 285.9 | 136.4 | |
| Košice | MIC 50 | 85.3 | 85.3 | 128.1 | 128.1 | 85.3 |
| MIC 90 | 99.6 | 99.6 | 136.4 | 136.4 | 99.6 | |
| Budimír | MIC 50 | 263.3 | 170.7 | 130.6 | 263.3 | 128.1 |
| MIC 90 | 285.9 | 192.9 | 143.8 | 285.9 | 136.4 | |
| Veľký Blh | MIC 50 | 263.3 | 170.7 | 255.8 | 263.3 | 170.7 |
| MIC 90 | 285.9 | 192.9 | 272.0 | 285.9 | 190.8 | |
| Palárikovo | MIC 50 | 130.6 | 170.7 | 128.1 | 130.6 | 128.1 |
| MIC 90 | 143.8 | 192.9 | 136.4 | 143.8 | 136.4 | |
| Lučenec | MIC 50 | 263.3 | 130.6 | 128.1 | 263.3 | 128.1 |
| MIC 90 | 285.9 | 143.8 | 136.4 | 285.9 | 136.4 | |
| Topoľčianky | MIC 50 | 130.6 | 263.3 | 263.3 | 130.6 | 263.3 |
| MIC 90 | 143.8 | 285.9 | 285.9 | 143.8 | 285.9 | |
| Nová Ves | MIC 50 | 170.7 | 128.1 | 263.3 | 170.7 | 263.3 |
| MIC 90 | 192.9 | 136.4 | 285.9 | 192.9 | 285.9 | |
| Šurianky | MIC 50 | 130.6 | 128.1 | 263.3 | 130.6 | 128.1 |
| MIC 90 | 143.8 | 136.4 | 285.9 | 143.8 | 136.4 | |
| Tested Gram-Positive Bacteria | ||||||
|---|---|---|---|---|---|---|
| Sample/Locality | BT | CP | HI | LM | SA | |
| Rimavská Sobota | MIC 50 | 263.3 | 128.1 | 128.1 | 130.6 | 130.6 |
| MIC 90 | 285.9 | 136.4 | 136.4 | 143.8 | 143.8 | |
| Košice | MIC 50 | 170.7 | 128.1 | 85.3 | 85.3 | 85.3 |
| MIC 90 | 192.9 | 136.4 | 95.4 | 99.6 | 99.6 | |
| Budimír | MIC 50 | 263.3 | 128.1 | 85.3 | 130.6 | 64.2 |
| MIC 90 | 285.9 | 136.4 | 95.4 | 143.8 | 72.2 | |
| Veľký Blh | MIC 50 | 263.3 | 130.6 | 170.7 | 130.6 | 130.6 |
| MIC 90 | 285.9 | 143.8 | 192.9 | 143.8 | 143.8 | |
| Palárikovo | MIC 50 | 130.6 | 130.6 | 130.6 | 130.6 | 130.6 |
| MIC 90 | 143.8 | 143.8 | 143.8 | 143.8 | 143.8 | |
| Lučenec | MIC 50 | 263.3 | 170.7 | 263.3 | 128.1 | 128.1 |
| MIC 90 | 285.9 | 192.9 | 285.9 | 136.4 | 136.4 | |
| Topoľčianky | MIC 50 | 130.6 | 130.6 | 341.3 | 130.6 | 170.7 |
| MIC 90 | 143.8 | 143.8 | 382.3 | 143.8 | 192.9 | |
| Nová Ves | MIC 50 | 85.3 | 240.1 | 263.3 | 240.1 | 130.6 |
| MIC 90 | 99.6 | 389.9 | 285.9 | 389.9 | 143.8 | |
| Šurianky | MIC 50 | 130.6 | 263.3 | 263.3 | 263.3 | 263.3 |
| MIC 90 | 143.8 | 285.9 | 285.9 | 285.9 | 285.9 | |
| miRNA Marker | Number of Loci | Number of Polymorphic Loci | Number of Monomorphic Loci | Number of Unique Loci | Percentage of Polymorphism | PIC |
|---|---|---|---|---|---|---|
| gb-miR160F/gb-miR75R | 14 | 3 | 9 | 2 | 21.43 | 0.91 |
| gb-miR482F/gb-miR482R | 14 | 9 | 1 | 4 | 64.29 | 0.90 |
| gb-miR5261F/gb-miR5261R | 8 | 3 | 5 | 0 | 37.5 | 0.83 |
| Compound | MS/MS Parameters | ||||
|---|---|---|---|---|---|
| tR | Fragmentor Voltage (V) | Precursor Ion (m/z) | Product Ion (m/z) | Collision Energy (V) | |
| Syringic acid | 3.49 | 90 | 197 | 182 | 6 |
| Protocatechuic acid | 3.68 | 103 | 153 | 109 | 10 |
| Chlorogenic acid | 4.69 | 100 | 353 | 191 | 11 |
| Caffeic acid | 5.52 | 100 | 179 | 135 | 10 |
| Quercetin-3-O-rutinoside | 5.72 | 135 | 609 | 300 | 40 |
| p-Coumaric acid | 6.38 | 90 | 163 | 119 | 9 |
| Quercetin-3-O-glucoside | 6.47 | 210 | 463 | 300 | 35 |
| Kaempferol-3-O-glucoside | 6.57 | 200 | 447 | 284 | 30 |
| Isorhamnetin-O-glucoside | 6.75 | 210 | 477 | 315 | 25 |
| Luteolin-7-O-glucoside | 6.93 | 230 | 447 | 285 | 30 |
| Rosmarinic acid | 7.09 | 120 | 359 | 161 | 14 |
| Isorhamnetin | 7.34 | 155 | 315 | 300 | 23 |
| Luteolin | 8.46 | 135 | 285 | 133 | 30 |
| Quercetin | 8.52 | 130 | 301 | 151 | 19 |
| Kaempferol | 9.50 | 130 | 285 | 285 | 0 |
| Primer | Sequences 5′- 3′ |
|---|---|
| gb-miR160_F | TTAGTCTGCCTGGCTCCCTGTATG |
| gb-miR482_F | TGGGTTGTAGTCTTCAGGAGTGGG |
| gb-miR482_R | GAAGGCAATAGGAATGGGAGGATC |
| gb-miR5261_F | TTTGGAAAGTATTCGCATTGATTA |
| gb-miR5261_R | TATGGAACAAATTGCCACTCGGAT |
| gb-miR75_R | CCGGGCAGTAGGAATGGGAGGAAT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ražná, K.; Sawinska, Z.; Ivanišová, E.; Vukovic, N.; Terentjeva, M.; Stričík, M.; Kowalczewski, P.Ł.; Hlavačková, L.; Rovná, K.; Žiarovská, J.; et al. Properties of Ginkgo biloba L.: Antioxidant Characterization, Antimicrobial Activities, and Genomic MicroRNA Based Marker Fingerprints. Int. J. Mol. Sci. 2020, 21, 3087. https://doi.org/10.3390/ijms21093087
Ražná K, Sawinska Z, Ivanišová E, Vukovic N, Terentjeva M, Stričík M, Kowalczewski PŁ, Hlavačková L, Rovná K, Žiarovská J, et al. Properties of Ginkgo biloba L.: Antioxidant Characterization, Antimicrobial Activities, and Genomic MicroRNA Based Marker Fingerprints. International Journal of Molecular Sciences. 2020; 21(9):3087. https://doi.org/10.3390/ijms21093087
Chicago/Turabian StyleRažná, Katarína, Zuzanna Sawinska, Eva Ivanišová, Nenad Vukovic, Margarita Terentjeva, Michal Stričík, Przemysław Łukasz Kowalczewski, Lucia Hlavačková, Katarína Rovná, Jana Žiarovská, and et al. 2020. "Properties of Ginkgo biloba L.: Antioxidant Characterization, Antimicrobial Activities, and Genomic MicroRNA Based Marker Fingerprints" International Journal of Molecular Sciences 21, no. 9: 3087. https://doi.org/10.3390/ijms21093087
APA StyleRažná, K., Sawinska, Z., Ivanišová, E., Vukovic, N., Terentjeva, M., Stričík, M., Kowalczewski, P. Ł., Hlavačková, L., Rovná, K., Žiarovská, J., & Kačániová, M. (2020). Properties of Ginkgo biloba L.: Antioxidant Characterization, Antimicrobial Activities, and Genomic MicroRNA Based Marker Fingerprints. International Journal of Molecular Sciences, 21(9), 3087. https://doi.org/10.3390/ijms21093087

