Detecting the Effects of the Glucocorticoid Dexamethasone on Primary Human Skeletal Muscle Cells—Differences to the Murine Cell Line
Abstract
:1. Introduction
Aim of the Study
2. Results
2.1. Immunfluorescence and Flow Cytometer Analysis: Identification of Primary Human Myoblasts
Flow Cytometer Analysis
2.2. Dex Had no Impact on Cell Viability
2.3. Gene Expression Analysis of Human Myotubes and Myoblast after Treatment with Dex
2.3.1. Dex Induces the Expression of the Atrophy-Related Genes MuRF-1 and MAFbx
2.3.2. Dex has Developmental-Stage-Dependent Effects on Myotubes and Myoblasts
2.4. Dex has Time and Concentration-Dependent Effects on Myosin Protein Expression in Human Myotubes
3. Discussion
3.1. Identification of Primary Human Myoblasts
3.2. Dex has no Impact on Cell Viability
3.3. Dex Induces the Expression of the Atrophy-Related Genes MuRF-1 and MAFbx
3.4. Dex has Developmental-Stage-Dependent Effects on Myotubes and Myoblasts
3.5. Dex has Time and Concentration Dependent Effects on Myosin Protein Expression in Human Myotubes
3.6. Conclusion
Summary
3.7. Limitations of the Study
4. Materials and Methods
4.1. Cell Culture
Isolation of Human Primary Myoblasts
4.2. Immunofluorescence
4.3. Flow Cytometer Analysis
4.4. Viability Assay
4.5. Induction of Atrophic Conditions
4.6. Gene Expression Analyses
4.6.1. RNA Isolation and cDNA Synthesis
4.6.2. Quantitative Real-Time PCR
4.7. Protein Expression
Western Blot
4.8. Statistical Analyses
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
MyHC | Myosin heavy chain |
IGF-1 | Insulin-like growth factor 1 |
mTOR | Mammalian target of rapamycin |
NCAM | Neuronal cell adhesion molecule |
GAPDH | Glyceraldehyde 3-phosphate dehydrogenase |
GM | Growth medium |
DM | Differentiation medium |
Pen.Strep. | Penicillin/streptomycin |
HS | Horse serum |
FCS | Fetal calf serum |
bFGF | basic fibroblast growth factor |
PI3K | Phosphoinositide 3-kinase |
IgG | Immunoglobulin G |
APC | Allophycocyanin |
References
- Mayer, T.G.; Vanharanta, H.; Gatchel, R.J.; Mooney, V.; Barnes, D.; Judge, L.; Smith, S.; Terry, A. Comparison of CT scan muscle measurements and isokinetic trunk strength in postoperative patients. Spine 1989, 14, 33–36. [Google Scholar] [CrossRef]
- Waddell, G. 1987 Volvo award in clinical sciences. A new clinical model for the treatment of low-back pain. Spine 1987, 12, 632–644. [Google Scholar] [CrossRef] [PubMed]
- Kelsey, J.L.; White, A.A.; Pastides, H.; Bisbee, G.E. The impact of musculoskeletal disorders on the population of the United States. J. Bone Joint Surg. Am. 1979, 61, 959–964. [Google Scholar] [CrossRef] [PubMed]
- Schirmacher, P. Schirmacher. Atrophie. Available online: https://eliph.klinikum.uni-heidelberg.de/texte_a/12/12-atrophie (accessed on 4 August 2012).
- Bodine, S.C.; Baehr, L.M. Skeletal muscle atrophy and the E3 ubiquitin ligases MuRF1 and MAFbx/atrogin-1. Am. J. Physiol. Endocrinol. Metab. 2014, 307, E469–E484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bonaldo, P.; Sandri, M. Cellular and molecular mechanisms of muscle atrophy. Dis. Model. Mech. 2013, 6, 25–39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McKinnell, I.W.; Rudnicki, M.A. Molecular mechanisms of muscle atrophy. Cell 2004, 119, 907–910. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jackman, R.W.; Kandarian, S.C. The molecular basis of skeletal muscle atrophy. Am. J. Physiol. Cell Physiol. 2004, 287, C834–C843. [Google Scholar] [CrossRef] [Green Version]
- Cohen, S.; Brault, J.J.; Gygi, S.P.; Glass, D.J.; Valenzuela, D.M.; Gartner, C.; Latres, E.; Goldberg, A.L. During muscle atrophy, thick, but not thin, filament components are degraded by MuRF1-dependent ubiquitylation. J. Cell Biol. 2009, 185, 1083–1095. [Google Scholar] [CrossRef] [Green Version]
- Goldberg, A.L.; Tischler, M.; DeMartino, G.; Griffin, G. Hormonal regulation of protein degradation and synthesis in skeletal muscle. Fed. Proc. 1980, 39, 31–36. [Google Scholar]
- Liu, Z.; Li, G.; Kimball, S.R.; Jahn, L.A.; Barrett, E.J. Glucocorticoids modulate amino acid-induced translation initiation in human skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 2004, 287, E275–E281. [Google Scholar] [CrossRef]
- Thomas, M.; Langley, B.; Berry, C.; Sharma, M.; Kirk, S.; Bass, J.; Kambadur, R. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J. Biol. Chem. 2000, 275, 40235–40243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goldberg, A.L. Protein turnover in skeletal muscle. II. Effects of denervation and cortisone on protein catabolism in skeletal muscle. J. Biol. Chem. 1969, 244, 3223–3229. [Google Scholar] [PubMed]
- Li, B.-G.; Hasselgren, P.-O.; Fang, C.-H.; Warden, G.D. Insulin-like growth factor-I blocks dexamethasone-induced protein degradation in cultured myotubes by inhibiting multiple proteolytic pathways: 2002 ABA paper. J. Burn Care Rehabil. 2004, 25, 112–118. [Google Scholar] [CrossRef] [PubMed]
- Schakman, O.; Gilson, H.; Thissen, J.P. Mechanisms of glucocorticoid-induced myopathy. J. Endocrinol. 2008, 197, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Rhen, T.; Cidlowski, J.A. Antiinflammatory action of glucocorticoids--new mechanisms for old drugs. N. Engl. J. Med. 2005, 353, 1711–1723. [Google Scholar] [CrossRef] [Green Version]
- Newton, R. Molecular mechanisms of glucocorticoid action: what is important? Thorax 2000, 55, 603–613. [Google Scholar] [CrossRef] [Green Version]
- Barnes, P.J. How corticosteroids control inflammation: Quintiles Prize Lecture 2005. Br. J. Pharmacol. 2006, 148, 245–254. [Google Scholar] [CrossRef]
- Lützner, N.; Kalbacher, H.; Krones-Herzig, A.; Rösl, F. FOXO3 is a glucocorticoid receptor target and regulates LKB1 and its own expression based on cellular AMP levels via a positive autoregulatory loop. PLoS ONE 2012, 7, e42166. [Google Scholar] [CrossRef] [Green Version]
- SCHACKE, H. Mechanisms involved in the side effects of glucocorticoids. Pharmacol. Ther. 2002, 96, 23–43. [Google Scholar] [CrossRef]
- Vandevyver, S.; Dejager, L.; Tuckermann, J.; Libert, C. New insights into the anti-inflammatory mechanisms of glucocorticoids: an emerging role for glucocorticoid-receptor-mediated transactivation. Endocrinology 2013, 154, 993–1007. [Google Scholar] [CrossRef] [Green Version]
- Hasselgren, P.O. Glucocorticoids and muscle catabolism. Curr. Opin. Clin. Nutr. Metab. Care 1999, 2, 201–205. [Google Scholar] [CrossRef] [PubMed]
- Annane, D. What Is the Evidence for Harm of Neuromuscular Blockade and Corticosteroid Use in the Intensive Care Unit? Semin. Respir. Crit. Care Med. 2016, 37, 51–56. [Google Scholar] [CrossRef] [PubMed]
- Hermans, G.; van den Berghe, G. Clinical review: intensive care unit acquired weakness. Crit. Care 2015, 19, 274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Evenson, A.R.; Fareed, M.U.; Menconi, M.J.; Mitchell, J.C.; Hasselgren, P.-O. GSK-3beta inhibitors reduce protein degradation in muscles from septic rats and in dexamethasone-treated myotubes. Int. J. Biochem. Cell Biol. 2005, 37, 2226–2238. [Google Scholar] [CrossRef] [PubMed]
- Cohen, S.; Nathan, J.A.; Goldberg, A.L. Muscle wasting in disease: Molecular mechanisms and promising therapies. Nat. Rev. Drug Discov. 2015, 14, 58–74. [Google Scholar] [CrossRef]
- Sacheck, J.M.; Ohtsuka, A.; McLary, S.C.; Goldberg, A.L. IGF-I stimulates muscle growth by suppressing protein breakdown and expression of atrophy-related ubiquitin ligases, atrogin-1 and MuRF1. Am. J. Physiol. Endocrinol. Metab. 2004, 287, E591–E601. [Google Scholar] [CrossRef] [Green Version]
- Sandri, M.; Sandri, C.; Gilbert, A.; Skurk, C.; Calabria, E.; Picard, A.; Walsh, K.; Schiaffino, S.; Lecker, S.H.; Goldberg, A.L. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 2004, 117, 399–412. [Google Scholar] [CrossRef] [Green Version]
- Tintignac, L.A.; Lagirand, J.; Batonnet, S.; Sirri, V.; Leibovitch, M.P.; Leibovitch, S.A. Degradation of MyoD mediated by the SCF (MAFbx) ubiquitin ligase. J. Biol. Chem. 2005, 280, 2847–2856. [Google Scholar] [CrossRef] [Green Version]
- Foletta, V.C.; White, L.J.; Larsen, A.E.; Léger, B.; Russell, A.P. The role and regulation of MAFbx/atrogin-1 and MuRF1 in skeletal muscle atrophy. Pflugers Arch. 2011, 461, 325–335. [Google Scholar] [CrossRef]
- Manning, B.D.; Cantley, L.C. AKT/PKB signaling: navigating downstream. Cell 2007, 129, 1261–1274. [Google Scholar] [CrossRef] [Green Version]
- Sandri, M. Signaling in muscle atrophy and hypertrophy. Physiology (Bethesda) 2008, 23, 160–170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hay, N.; Sonenberg, N. Upstream and downstream of mTOR. Genes Dev. 2004, 18, 1926–1945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bodine, S.C.; Stitt, T.N.; Gonzalez, M.; Kline, W.O.; Stover, G.L.; Bauerlein, R.; Zlotchenko, E.; Scrimgeour, A.; Lawrence, J.C.; Glass, D.J.; et al. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat. Cell Biol. 2001, 3, 1014–1019. [Google Scholar] [CrossRef] [PubMed]
- Clarke, B.A.; Drujan, D.; Willis, M.S.; Murphy, L.O.; Corpina, R.A.; Burova, E.; Rakhilin, S.V.; Stitt, T.N.; Patterson, C.; Latres, E.; et al. The E3 Ligase MuRF1 degrades myosin heavy chain protein in dexamethasone-treated skeletal muscle. Cell Metab. 2007, 6, 376–385. [Google Scholar] [CrossRef] [Green Version]
- Zamir, O.; Hasselgren, P.-O.; Allmen, D.; von Fischer, J.E. The effect of interleukin-1α and the glucocorticoid receptor blocker RU 38486 on total and myofibrillar protein breakdown in skeletal muscle. J. Surg. Res. 1991, 50, 579–583. [Google Scholar] [CrossRef]
- te Pas, M.F.; Jong, P.R.; de Verburg, F.J. Glucocorticoid inhibition of C2C12 proliferation rate and differentiation capacity in relation to mRNA levels of the MRF gene family. Mol. Biol. Rep. 2000, 27, 87–98. [Google Scholar] [CrossRef]
- Mattyasovszky, S.G.; Langendorf, E.K.; Ritz, U.; Schmitz, C.; Schmidtmann, I.; Nowak, T.E.; Wagner, D.; Hofmann, A.; Rommens, P.M.; Drees, P. Exposure to radial extracorporeal shock waves modulates viability and gene expression of human skeletal muscle cells: a controlled in vitro study. J. Orthop. Surg. Res. 2018, 13, 75. [Google Scholar] [CrossRef] [Green Version]
- Illa, I.; Leon-Monzon, M.; Dalakas, M.C. Regenerating and denervated human muscle fibers and satellite cells express neural cell adhesion molecule recognized by monoclonal antibodies to natural killer cells. Ann. Neurol. 1992, 31, 46–52. [Google Scholar] [CrossRef]
- Belles-Isles, M.; Roy, R.; Dansereau, G.; Goulet, M.; Roy, B.; Bouchard, J.P.; Tremblay, J.P. Rapid selection of donor myoblast clones for muscular dystrophy therapy using cell surface expression of NCAM. Eur. J. Histochem. 1993, 37, 375–380. [Google Scholar]
- Lawson-Smith, M.J.; McGeachie, J.K. The identification of myogenic cells in skeletal muscle, with emphasis on the use of tritiated thymidine autoradiography and desmin antibodies. J. Anat. 1998, 192 (Pt 2), 161–171. [Google Scholar] [CrossRef]
- Seale, P.; Sabourin, L.A.; Girgis-Gabardo, A.; Mansouri, A.; Gruss, P.; Rudnicki, M.A. Pax7 Is Required for the Specification of Myogenic Satellite Cells. Cell 2000, 102, 777–786. [Google Scholar] [CrossRef] [Green Version]
- Allen, R.E.; Temm-Grove, C.J.; Sheehan, S.M.; Rice, G. Chapter 8 Skeletal Muscle Satellite Cell Cultures. Elsevier: Amsterdam, The Netherlands, 1997; pp. 155–176. ISBN 9780125641548. [Google Scholar]
- Kim, M.; Sung, B.; Kang, Y.J.; Kim, D.H.; Lee, Y.; Hwang, S.Y.; Yoon, J.-H.; Yoo, M.-A.; Kim, C.M.; Chung, H.Y.; et al. The combination of ursolic acid and leucine potentiates the differentiation of C2C12 murine myoblasts through the mTOR signaling pathway. Int. J. Mol. Med. 2015, 35, 755–762. [Google Scholar] [CrossRef] [Green Version]
- Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef]
- Cerletti, M.; Molloy, M.J.; Tomczak, K.K.; Yoon, S.; Ramoni, M.F.; Kho, A.T.; Beggs, A.H.; Gussoni, E. Melanoma cell adhesion molecule is a novel marker for human fetal myogenic cells and affects myoblast fusion. J. Cell Sci. 2006, 119, 3117–3127. [Google Scholar] [CrossRef] [Green Version]
- Logie, J.J.; Ali, S.; Marshall, K.M.; Heck, M.M.S.; Walker, B.R.; Hadoke, P.W.F. Glucocorticoid-mediated inhibition of angiogenic changes in human endothelial cells is not caused by reductions in cell proliferation or migration. PLoS ONE 2010, 5, e14476. [Google Scholar] [CrossRef] [Green Version]
- Tiao, G.; Fagan, J.; Roegner, V.; Lieberman, M.; Wang, J.J.; Fischer, J.E.; Hasselgren, P.O. Energy-ubiquitin-dependent muscle proteolysis during sepsis in rats is regulated by glucocorticoids. J. Clin. Invest. 1996, 97, 339–348. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.J.; Xiao, J.J.; Liu, L.; Jiao, H.C.; Lin, H. Excessive glucocorticoid-induced muscle MuRF1 overexpression is independent of Akt/FoXO1 pathway. Biosci. Rep. 2017, 37. [Google Scholar] [CrossRef] [Green Version]
- Almon, R.R.; DuBois, D.C.; Yao, Z.; Hoffman, E.P.; Ghimbovschi, S.; Jusko, W.J. Microarray analysis of the temporal response of skeletal muscle to methylprednisolone: comparative analysis of two dosing regimens. Physiol. Genomics 2007, 30, 282–299. [Google Scholar] [CrossRef]
- Lecker, S.H.; Jagoe, R.T.; Gilbert, A.; Gomes, M.; Baracos, V.; Bailey, J.; Price, S.R.; Mitch, W.E.; Goldberg, A.L. Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J. 2004, 18, 39–51. [Google Scholar] [CrossRef]
- Komamura, K.; Shirotani-Ikejima, H.; Tatsumi, R.; Tsujita-Kuroda, Y.; Kitakaze, M.; Miyatake, K.; Sunagawa, K.; Miyata, T. Differential gene expression in the rat skeletal and heart muscle in glucocorticoid-induced myopathy: analysis by microarray. Cardiovasc. Drugs Ther. 2003, 17, 303–310. [Google Scholar] [CrossRef]
- Jagoe, R.T.; Redfern, C.P.F.; Roberts, R.G.; Gibson, G.J.; Goodship, T.H.J. Skeletal muscle mRNA levels for cathepsin B, but not components of the ubiquitin-proteasome pathway, are increased in patients with lung cancer referred for thoracotomy. Clin. Sci. 2002, 102, 353–361. [Google Scholar]
- Bodine, S.C.; Latres, E.; Baumhueter, S.; Lai, V.K.; Nunez, L.; Clarke, B.A.; Poueymirou, W.T.; Panaro, F.J.; Na, E.; Dharmarajan, K.; et al. Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 2001, 294, 1704–1708. [Google Scholar] [CrossRef]
- Menconi, M.; Gonnella, P.; Petkova, V.; Lecker, S.; Hasselgren, P.-O. Dexamethasone and corticosterone induce similar, but not identical, muscle wasting responses in cultured L6 and C2C12 myotubes. J. Cell. Biochem. 2008, 105, 353–364. [Google Scholar] [CrossRef] [Green Version]
- Latres, E.; Amini, A.R.; Amini, A.A.; Griffiths, J.; Martin, F.J.; Wei, Y.; Lin, H.C.; Yancopoulos, G.D.; Glass, D.J. Insulin-like growth factor-1 (IGF-1) inversely regulates atrophy-induced genes via the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR) pathway. J. Biol. Chem. 2005, 280, 2737–2744. [Google Scholar] [CrossRef] [Green Version]
- Han, D.-S.; Yang, W.-S.; Kao, T.-W. Dexamethasone Treatment at the Myoblast Stage Enhanced C2C12 Myocyte Differentiation. Int. J. Med. Sci. 2017, 14, 434–443. [Google Scholar] [CrossRef] [Green Version]
- Sacheck, J.M.; Hyatt, J.-P.K.; Raffaello, A.; Jagoe, R.T.; Roy, R.R.; Edgerton, V.R.; Lecker, S.H.; Goldberg, A.L. Rapid disuse and denervation atrophy involve transcriptional changes similar to those of muscle wasting during systemic diseases. FASEB J. 2007, 21, 140–155. [Google Scholar] [CrossRef]
- Stitt, T.N.; Drujan, D.; Clarke, B.A.; Panaro, F.; Timofeyva, Y.; Kline, W.O.; Gonzalez, M.; Yancopoulos, G.D.; Glass, D.J. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol. Cell 2004, 14, 395–403. [Google Scholar] [CrossRef]
- Lagirand-Cantaloube, J.; Offner, N.; Csibi, A.; Leibovitch, M.P.; Batonnet-Pichon, S.; Tintignac, L.A.; Segura, C.T.; Leibovitch, S.A. The initiation factor eIF3-f is a major target for atrogin1/MAFbx function in skeletal muscle atrophy. EMBO J. 2008, 27, 1266–1276. [Google Scholar] [CrossRef] [Green Version]
- Li, H.-H.; Kedar, V.; Zhang, C.; McDonough, H.; Arya, R.; Wang, D.-Z.; Patterson, C. Atrogin-1/muscle atrophy F-box inhibits calcineurin-dependent cardiac hypertrophy by participating in an SCF ubiquitin ligase complex. J. Clin. Invest. 2004, 114, 1058–1071. [Google Scholar] [CrossRef] [Green Version]
- Lagirand-Cantaloube, J.; Cornille, K.; Csibi, A.; Batonnet-Pichon, S.; Leibovitch, M.P.; Leibovitch, S.A. Inhibition of atrogin-1/MAFbx mediated MyoD proteolysis prevents skeletal muscle atrophy in vivo. PLoS ONE 2009, 4, e4973. [Google Scholar] [CrossRef] [Green Version]
- Jogo, M.; Shiraishi, S.; Tamura, T.-a. Identification of MAFbx as a myogenin-engaged F-box protein in SCF ubiquitin ligase. FEBS Lett. 2009, 583, 2715–2719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belanto, J.J.; Diaz-Perez, S.V.; Magyar, C.E.; Maxwell, M.M.; Yilmaz, Y.; Topp, K.; Boso, G.; Jamieson, C.H.; Cacalano, N.A.; Jamieson, C.A.M. Dexamethasone induces dysferlin in myoblasts and enhances their myogenic differentiation. Neuromuscul. Disord. 2010, 20, 111–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stoyanova, T.; Roy, N.; Kopanja, D.; Bagchi, S.; Raychaudhuri, P. DDB2 decides cell fate following DNA damage. Proc. Natl. Acad. Sci. USA 2009, 106, 10690–10695. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Centner, T.; Yano, J.; Kimura, E.; McElhinny, A.S.; Pelin, K.; Witt, C.C.; Bang, M.L.; Trombitas, K.; Granzier, H.; Gregorio, C.C.; et al. Identification of muscle specific ring finger proteins as potential regulators of the titin kinase domain. J. Mol. Biol. 2001, 306, 717–726. [Google Scholar] [CrossRef] [Green Version]
- Francetic, T.; Li, Q. Skeletal myogenesis and Myf5 activation. Transcription 2011, 2, 109–114. [Google Scholar] [CrossRef] [Green Version]
- Yoshiko, Y.; Hirao, K.; Maeda, N. Differentiation in C(2)C(12) myoblasts depends on the expression of endogenous IGFs and not serum depletion. Am. J. Physiol. Cell Physiol. 2002, 283, C1278–C1286. [Google Scholar] [CrossRef] [Green Version]
- Sun, L.; Trausch-Azar, J.S.; Muglia, L.J.; Schwartz, A.L. Glucocorticoids differentially regulate degradation of MyoD and Id1 by N-terminal ubiquitination to promote muscle protein catabolism. Proc. Natl. Acad. Sci. USA 2008, 105, 3339–3344. [Google Scholar] [CrossRef] [Green Version]
- Stewart, J.D.; Masi, T.L.; Cumming, A.E.; Molnar, G.M.; Wentworth, B.M.; Sampath, K.; McPherson, J.M.; Yaeger, P.C. Characterization of proliferating human skeletal muscle-derived cells in vitro: differential modulation of myoblast markers by TGF-beta2. J. Cell. Physiol. 2003, 196, 70–78. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Growth Medium Myoblasts (GM) | Differentiation Medium (DM) |
---|---|
Dulbecco’s modified Eagle medium (DMEM/F-12)(1:1) + GlutaMAX, Gibco®, Life Technologies, Grand Island, NY, USA); 10% FCS (Fetal Calf Serum, Biochrom GmbH, Berlin, Germany); 2.5 ng/mL bFGF (BPS Bioscience, San Diego, CA, USA); 1% Pen. Strep.(Gibco®, Life Technologies, Grand Island, NY, USA) | (DMEM/F-12)(1:1) + GlutaMAX, 5% Horse Serum (Biochrom GmbH, Berlin, Germany); 1% Pen. Strep |
Primer | Sequence |
---|---|
GAPDH Acc.# M33197 | FW cgaccactttgtcaagctca RV aggggagattcagtgtggtg |
Myf5 Acc.# NM_005593.2 | FW tgcccgaatgtaacagtcct RV ggaactagaagcccctggag |
MyoD Acc.# X56677.1 | FW ggggctaggttcagctttct RV gctctggcaaagcaactctt |
MyoG Acc.# NM_002479.5 | FW gccagactatccccttcctc RV gaggccgcgttatgataaaa |
Myosin Acc.# Z38133.1 | FW ggcaaaacggaaggagctag RV tcttcctcctcctcagctct |
Foxo Acc.# NM_001455 | FW agccagtctatgcaaaccct RV ccaacccatcagcatccatg |
MAFbx Acc.# NM_001242463 | FW cgtttcactttcaccccagg RV actgcatttctcccctccaa |
MuRF-1 Acc.# NM_032588 | FW gagccaccttcctcttgact RV tggtgtccttcttccttccc |
GR Acc.# AB307716 | FW caaatcagcctttcctcggg RV ctggcccttcaaatgttgct |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Langendorf, E.K.; Rommens, P.M.; Drees, P.; Mattyasovszky, S.G.; Ritz, U. Detecting the Effects of the Glucocorticoid Dexamethasone on Primary Human Skeletal Muscle Cells—Differences to the Murine Cell Line. Int. J. Mol. Sci. 2020, 21, 2497. https://doi.org/10.3390/ijms21072497
Langendorf EK, Rommens PM, Drees P, Mattyasovszky SG, Ritz U. Detecting the Effects of the Glucocorticoid Dexamethasone on Primary Human Skeletal Muscle Cells—Differences to the Murine Cell Line. International Journal of Molecular Sciences. 2020; 21(7):2497. https://doi.org/10.3390/ijms21072497
Chicago/Turabian StyleLangendorf, Eva K., Pol M. Rommens, Philipp Drees, Stefan G. Mattyasovszky, and Ulrike Ritz. 2020. "Detecting the Effects of the Glucocorticoid Dexamethasone on Primary Human Skeletal Muscle Cells—Differences to the Murine Cell Line" International Journal of Molecular Sciences 21, no. 7: 2497. https://doi.org/10.3390/ijms21072497
APA StyleLangendorf, E. K., Rommens, P. M., Drees, P., Mattyasovszky, S. G., & Ritz, U. (2020). Detecting the Effects of the Glucocorticoid Dexamethasone on Primary Human Skeletal Muscle Cells—Differences to the Murine Cell Line. International Journal of Molecular Sciences, 21(7), 2497. https://doi.org/10.3390/ijms21072497