Burn-Induced Cardiac Mitochondrial Dysfunction via Interruption of the PDE5A-cGMP-PKG Pathway
Abstract
:1. Introduction
2. Results
2.1. Cardiac Mitochondrial Structure and Morphology
2.2. Cardiac mitDNA Replication
2.3. mtDNA-Encoded Gene Expression in Burned Group
2.4. Cardiac Mitochondrial Function
2.5. Cardiac Mitochondrial Electron Transport Chain Activity
3. Discussion
4. Material and Methods
4.1. Ethics Statement
4.2. Rats
4.3. Transmission Electron Microscopy (TEM)
4.4. Morphometric Analysis
4.5. Mitochondrial Copy Number
4.6. Gene Expression Analysis
4.7. Mitochondria Isolation
4.8. The Mitochondrial Oxidative Phosphorylation (OXPHOS) Activities
4.9. Cardiac Mitochondria Function Analysis
4.10. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
β-Ars | β-Adrenergic Receptors |
CCCP | Carbonyl cyanide m-chlorophenyl hydrazine |
CI | complex I |
CII | complex II |
CIII | complex III |
CIV | complex IV |
CV | complex V |
cGMP | cyclic guanosine monophosphate |
OXPHOS | Oxidative phosphorylation |
P+G+M | pyruvate + glutamate + malate |
PDE5A | phosphodiesterase 5A |
PKG | cytosolic cGMP-dependent protein kinase |
RCR | Respiratory control ratios |
S+R | succinate + rotenone |
SIL | Sildenafil |
TBSA | total body surface area |
TEM | Transmission electron microscopy |
Appendix A
References
- Toussaint, J.; Singer, A.J. The evaluation and management of thermal injuries: 2014 Update. Clin. Exp. Emerg. Med. 2014, 1, 8–18. [Google Scholar] [CrossRef]
- Colohan, S.M. Predicting prognosis in thermal burns with associated inhalational injury: A systematic review of prognostic factors in adult burn victims. J. Burn Care Res. 2010, 31, 529–539. [Google Scholar] [CrossRef]
- Lawrence, B.A.; Zaloshnja, E.; Miller, T.R.; Jones, P.R. Estimates of the Incidence and Costs of Fire-Related Injuries; the U.S. Consumer Product Safety Commission: Calveston, MD, USA, 2009; pp. 1–51.
- Shankar, R.; Melstrom, K.A., Jr.; Gamelli, R.L. Inflammation and sepsis: Past, present, and the future. J. Burn Care Res. 2007, 28, 566–571. [Google Scholar] [CrossRef] [PubMed]
- Jeschke, M.G.; Gauglitz, G.G.; Kulp, G.A.; Finnerty, C.C.; Williams, F.N.; Kraft, R.; Suman, O.E.; Mlcak, R.P.; Herndon, D.N. Long-term persistance of the pathophysiologic response to severe burn injury. PLoS ONE 2011, 6, e21245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duke, J.M.; Rea, S.; Boyd, J.H.; Randall, S.M.; Wood, F.M. Mortality after burn injury in children: A 33-year population-based study. Pediatrics 2015, 135, e903–e910. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdullahi, A.; Amini-Nik, S.; Jeschke, M.G. Animal models in burn research. Cell. Mol. Life Sci. 2014, 71, 3241–3255. [Google Scholar] [CrossRef] [Green Version]
- Abu-Sittah, G.S.; Sarhane, K.A.; Dibo, S.A.; Ibrahim, A. Cardiovascular dysfunction in burns: Review of the literature. Ann. Burn. Fire Disasters 2012, 25, 26–37. [Google Scholar]
- Guillory, A.N.; Clayton, R.P.; Herndon, D.N.; Finnerty, C.C. Cardiovascular Dysfunction Following Burn Injury: What We Have Learned from Rat and Mouse Models. Int. J. Mol. Sci. 2016, 17, 53. [Google Scholar] [CrossRef] [Green Version]
- Horton, J.W.; Garcia, N.M.; White, D.J.; Keffer, J. Postburn cardiac contractile function and biochemical markers of postburn cardiac injury. J. Am. Coll. Surg. 1995, 181, 289–298. [Google Scholar]
- Hutchings, D.C.; Anderson, S.G.; Caldwell, J.L.; Trafford, A.W. Phosphodiesterase-5 inhibitors and the heart: Compound cardioprotection? Heart 2018, 104, 1244–1250. [Google Scholar] [CrossRef]
- Boerrigter, G.; Lapp, H.; Burnett, J.C. Modulation of cGMP in heart failure: A new therapeutic paradigm. Handb. Exp. Pharm. 2009, 191, 485–506. [Google Scholar]
- Layland, J.; Li, J.M.; Shah, A.M. Role of cyclic GMP-dependent protein kinase in the contractile response to exogenous nitric oxide in rat cardiac myocytes. J. Physiol. 2002, 540, 457–467. [Google Scholar] [CrossRef] [PubMed]
- Seya, K.; Ono, K.; Fujisawa, S.; Okumura, K.; Motomura, S.; Furukawa, K. Cytosolic Ca2+-induced apoptosis in rat cardiomyocytes via mitochondrial NO-cGMP-protein kinase G pathway. J. Pharm. Exp. 2013, 344, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Andersson, K.E. PDE5 inhibitors—Pharmacology and clinical applications 20 years after sildenafil discovery. Br. J. Pharm. 2018, 175, 2554–2565. [Google Scholar] [CrossRef] [Green Version]
- Gokakin, A.K.; Deveci, K.; Kurt, A.; Karakus, B.C.; Duger, C.; Tuzcu, M.; Topcu, O. The protective effects of sildenafil in acute lung injury in a rat model of severe scald burn: A biochemical and histopathological study. Burns 2013, 39, 1193–1199. [Google Scholar] [CrossRef]
- Porter, C.; Herndon, D.N.; Borsheim, E.; Chao, T.; Reidy, P.T.; Borack, M.S.; Rasmussen, B.B.; Chondronikola, M.; Saraf, M.K.; Sidossis, L.S. Uncoupled skeletal muscle mitochondria contribute to hypermetabolism in severely burned adults. Am. J. Physiol. Endocrinol. Metab. 2014, 307, E462–E467. [Google Scholar] [CrossRef]
- Szczesny, B.; Brunyanszki, A.; Ahmad, A.; Olah, G.; Porter, C.; Toliver-Kinsky, T.; Sidossis, L.; Herndon, D.N.; Szabo, C. Time-Dependent and Organ-Specific Changes in Mitochondrial Function, Mitochondrial DNA Integrity, Oxidative Stress and Mononuclear Cell Infiltration in a Mouse Model of Burn Injury. PLoS ONE 2015, 10, e0143730. [Google Scholar] [CrossRef] [Green Version]
- Chao, T.; Gomez, B.I.; Heard, T.C.; Smith, B.W.; Dubick, M.A.; Burmeister, D.M. Burn-induced reductions in mitochondrial abundance and efficiency are more pronounced with small volumes of colloids in swine. Am. J. Physiol. Cell Physiol. 2019, 317, C1229–C1238. [Google Scholar] [CrossRef]
- Rubattu, S.; Forte, M.; Raffa, S. Circulating Leukocytes and Oxidative Stress in Cardiovascular Diseases: A State of the Art. Oxid. Med. Cell. Longev. 2019, 2019, 2650429. [Google Scholar] [CrossRef]
- Porter, C.; Herndon, D.N.; Borsheim, E.; Bhattarai, N.; Chao, T.; Reidy, P.T.; Rasmussen, B.B.; Andersen, C.R.; Suman, O.E.; Sidossis, L.S. Long-Term Skeletal Muscle Mitochondrial Dysfunction is Associated with Hypermetabolism in Severely Burned Children. J. Burn Care Res. 2016, 37, 53–63. [Google Scholar] [CrossRef] [Green Version]
- Owen, A.M.; Patel, S.P.; Smith, J.D.; Balasuriya, B.K.; Mori, S.F.; Hawk, G.S.; Stromberg, A.J.; Kuriyama, N.; Kaneki, M.; Rabchevsky, A.G.; et al. Chronic muscle weakness and mitochondrial dysfunction in the absence of sustained atrophy in a preclinical sepsis model. Elife 2019, 8. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.H.; Lu, I.C.; Tai, M.H.; Chai, C.Y.; Kwan, A.L.; Huang, S.H. Erythropoietin Alleviates Burn-induced Muscle Wasting. Int. J. Med. Sci. 2020, 17, 33–44. [Google Scholar] [CrossRef] [Green Version]
- Saraf, M.K.; Herndon, D.N.; Porter, C.; Toliver-Kinsky, T.; Radhakrishnan, R.; Chao, T.; Chondronikola, M.; Sidossis, L.S. Morphological Changes in Subcutaneous White Adipose Tissue After Severe Burn Injury. J. Burn Care Res. 2016, 37, e96–e103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdullahi, A.; Samadi, O.; Auger, C.; Kanagalingam, T.; Boehning, D.; Bi, S.; Jeschke, M.G. Browning of white adipose tissue after a burn injury promotes hepatic steatosis and dysfunction. Cell Death Dis. 2019, 10, 870. [Google Scholar] [CrossRef] [Green Version]
- Vinaik, R.; Barayan, D.; Abdullahi, A.; Jeschke, M.G. NLRP3 inflammasome mediates white adipose tissue browning after burn. Am. J. Physiol. Endocrinol. Metab. 2019, 317, E751–E759. [Google Scholar] [CrossRef] [PubMed]
- Wen, J.J.; Cummins, C.B.; Szczesny, B.; Radhakrishnan, R.S. Cardiac Dysfunction after Burn Injury: Role of the AMPK-SIRT1-PGC1alpha-NFE2L2-ARE Pathway. J. Am. Coll. Surg. 2020. [Google Scholar] [CrossRef]
- Bhan, A.; Sirker, A.; Zhang, J.; Protti, A.; Catibog, N.; Driver, W.; Botnar, R.; Monaghan, M.J.; Shah, A.M. High-frequency speckle tracking echocardiography in the assessment of left ventricular function and remodeling after murine myocardial infarction. Am. J. Physiol. Heart Circ. Physiol. 2014, 306, H1371–H1383. [Google Scholar] [CrossRef] [Green Version]
- Takimoto, E. Cyclic GMP-dependent signaling in cardiac myocytes. Circ. J. 2012, 76, 1819–1825. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, K.; Osanai, T.; Nakano, T.; Wakui, M.; Okumura, K. Enhanced activities and gene expression of phosphodiesterase types 3 and 4 in pressure-induced congestive heart failure. Heart Vessel. 2002, 16, 249–256. [Google Scholar] [CrossRef]
- Williams, F.N.; Herndon, D.N.; Suman, O.E.; Lee, J.O.; Norbury, W.B.; Branski, L.K.; Mlcak, R.P.; Jeschke, M.G. Changes in cardiac physiology after severe burn injury. J. Burn Care Res. 2011, 32, 269–274. [Google Scholar] [CrossRef] [Green Version]
- Ali, H.R. Proteomic Insights into Acylation Events in Alcoholic Liver Disease and Heart Failure. Ph.D. Thesis, University of Colorado Anschutz Medical Campus, Aurora, CO, USA, 2019. [Google Scholar]
- Eisner, V.; Cupo, R.R.; Gao, E.; Csordas, G.; Slovinsky, W.S.; Paillard, M.; Cheng, L.; Ibetti, J.; Chen, S.R.; Chuprun, J.K.; et al. Mitochondrial fusion dynamics is robust in the heart and depends on calcium oscillations and contractile activity. Proc. Natl. Acad. Sci. USA 2017, 114, E859–E868. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karamanlidis, G.; Bautista-Hernandez, V.; Fynn-Thompson, F.; Del Nido, P.; Tian, R. Impaired mitochondrial biogenesis precedes heart failure in right ventricular hypertrophy in congenital heart disease. Circ. Heart Fail. 2011, 4, 707–713. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pala, L. A Chemical Approach to Combatting Cardiovascular Reperfusion Injury. Ph.D. Thesis, University of Glasgow, Glasgow, UK, 2019. [Google Scholar]
- Zhao, Q.; Sun, Q.; Zhou, L.; Liu, K.; Jiao, K. Complex Regulation of Mitochondrial Function During Cardiac Development. J. Am. Heart Assoc. 2019, 8, e012731. [Google Scholar] [CrossRef]
- Wu, S.; Lu, Q.; Wang, Q.; Ding, Y.; Ma, Z.; Mao, X.; Huang, K.; Xie, Z.; Zou, M.H. Binding of FUN14 Domain Containing 1 With Inositol 1,4,5-Trisphosphate Receptor in Mitochondria-Associated Endoplasmic Reticulum Membranes Maintains Mitochondrial Dynamics and Function in Hearts in Vivo. Circulation 2017, 136, 2248–2266. [Google Scholar] [CrossRef] [PubMed]
- Salisbury-Ruf, C.T.; Bertram, C.C.; Vergeade, A.; Lark, D.S.; Shi, Q.; Heberling, M.L.; Fortune, N.L.; Okoye, G.D.; Jerome, W.G.; Wells, Q.S.; et al. Bid maintains mitochondrial cristae structure and function and protects against cardiac disease in an integrative genomics study. Elife 2018, 7. [Google Scholar] [CrossRef] [PubMed]
- Elrod, J.W.; Calvert, J.W.; Morrison, J.; Doeller, J.E.; Kraus, D.W.; Tao, L.; Jiao, X.; Scalia, R.; Kiss, L.; Szabo, C.; et al. Hydrogen sulfide attenuates myocardial ischemia-reperfusion injury by preservation of mitochondrial function. Proc. Natl. Acad. Sci. USA 2007, 104, 15560–15565. [Google Scholar] [CrossRef] [Green Version]
- Rosca, M.G.; Tandler, B.; Hoppel, C.L. Mitochondria in cardiac hypertrophy and heart failure. J. Mol. Cell. Cardiol. 2013, 55, 31–41. [Google Scholar] [CrossRef] [Green Version]
- Maneechote, C.; Palee, S.; Chattipakorn, S.C.; Chattipakorn, N. Roles of mitochondrial dynamics modulators in cardiac ischaemia/reperfusion injury. J. Cell. Mol. Med. 2017, 21, 2643–2653. [Google Scholar] [CrossRef]
- Paradies, G.; Paradies, V.; Ruggiero, F.M.; Petrosillo, G. Mitochondrial bioenergetics and cardiolipin alterations in myocardial ischemia-reperfusion injury: Implications for pharmacological cardioprotection. Am. J. Physiol. Heart Circ. Physiol. 2018, 315, H1341–H1352. [Google Scholar] [CrossRef]
- Huang, J.; Tan, L.; Shen, R.; Zhang, L.; Zuo, H.; Wang, D.W. Decreased Peripheral Mitochondrial DNA Copy Number is Associated with the Risk of Heart Failure and Long-term Outcomes. Medicine 2016, 95, e3323. [Google Scholar] [CrossRef]
- Miyagawa, K.; Emoto, N.; Widyantoro, B.; Nakayama, K.; Yagi, K.; Rikitake, Y.; Suzuki, T.; Hirata, K. Attenuation of Doxorubicin-induced cardiomyopathy by endothelin-converting enzyme-1 ablation through prevention of mitochondrial biogenesis impairment. Hypertension 2010, 55, 738–746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, H.; Zhu, P.; Wang, J.; Zhu, H.; Ren, J.; Chen, Y. Pathogenesis of cardiac ischemia reperfusion injury is associated with CK2alpha-disturbed mitochondrial homeostasis via suppression of FUNDC1-related mitophagy. Cell Death Differ. 2018, 25, 1080–1093. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Falkenberg, M. Mitochondrial DNA replication in mammalian cells: Overview of the pathway. Essays Biochem. 2018, 62, 287–296. [Google Scholar] [PubMed]
- Young, M.J.; Copeland, W.C. Human mitochondrial DNA replication machinery and disease. Curr. Opin. Genet. Dev. 2016, 38, 52–62. [Google Scholar] [CrossRef] [Green Version]
- Nicholls, T.J.; Minczuk, M. In D-loop: 40 years of mitochondrial 7S DNA. Exp. Gerontol. 2014, 56, 175–181. [Google Scholar] [CrossRef]
- Kulp, G.A.; Herndon, D.N.; Lee, J.O.; Suman, O.E.; Jeschke, M.G. Extent and magnitude of catecholamine surge in pediatric burned patients. Shock 2010, 33, 369–374. [Google Scholar] [CrossRef] [Green Version]
- Sidossis, L.S.; Porter, C.; Saraf, M.K.; Borsheim, E.; Radhakrishnan, R.S.; Chao, T.; Ali, A.; Chondronikola, M.; Mlcak, R.; Finnerty, C.C.; et al. Browning of Subcutaneous White Adipose Tissue in Humans after Severe Adrenergic Stress. Cell Metab. 2015, 22, 219–227. [Google Scholar] [CrossRef] [Green Version]
- Keck, M.; Herndon, D.H.; Kamolz, L.P.; Frey, M.; Jeschke, M.G. Pathophysiology of burns. Wien. Med. Wochenschr. 2009, 159, 327–336. [Google Scholar] [CrossRef]
- Kawakami, M.; He, J.; Sakamoto, T.; Okada, Y. Catecholamines play a role in the production of interleukin-6 and interleukin-1alpha in unburned skin after burn injury in mice. Crit. Care Med. 2001, 29, 796–801. [Google Scholar] [CrossRef]
- El Ayadi, A.; Prasai, A.; Jay, J.; Bhattari, N.; Guilory, A.; Herndon, D.; Finnerty, C. The Role of Beta-2 Adrenergic Receptors in Cardiac Bioenergetics Following Severe Burns. FASEB J. 2019, 33, IB281–IB282. [Google Scholar]
- Lawless, M.; Caldwell, J.L.; Radcliffe, E.J.; Smith, C.E.R.; Madders, G.W.P.; Hutchings, D.C.; Woods, L.S.; Church, S.J.; Unwin, R.D.; Kirkwood, G.J.; et al. Phosphodiesterase 5 inhibition improves contractile function and restores transverse tubule loss and catecholamine responsiveness in heart failure. Sci. Rep. 2019, 9, 6801. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mascarenhas, D.D.; Elayadi, A.; Singh, B.K.; Prasai, A.; Hegde, S.D.; Herndon, D.N.; Finnerty, C.C. Nephrilin peptide modulates a neuroimmune stress response in rodent models of burn trauma and sepsis. Int. J. Burn. Trauma 2013, 3, 190–200. [Google Scholar]
- Bohanon, F.J.; Nunez Lopez, O.; Herndon, D.N.; Wang, X.; Bhattarai, N.; Ayadi, A.E.; Prasai, A.; Jay, J.W.; Rojas-Khalil, Y.; Toliver-Kinsky, T.E.; et al. Burn Trauma Acutely Increases the Respiratory Capacity and Function of Liver Mitochondria. Shock 2018, 49, 466–473. [Google Scholar] [CrossRef] [PubMed]
- Shults, N.V.; Kanovka, S.S.; Ten Eyck, J.E.; Rybka, V.; Suzuki, Y.J. Ultrastructural Changes of the Right Ventricular Myocytes in Pulmonary Arterial Hypertension. J. Am. Heart Assoc. 2019, 8, e011227. [Google Scholar] [CrossRef] [PubMed]
- Weibel, E.R.; Kistler, G.S.; Scherle, W.F. Practical stereological methods for morphometric cytology. J. Cell Biol. 1966, 30, 23–38. [Google Scholar] [CrossRef] [PubMed]
- Paukov, V.S.; Kazanskaya, T.A.; Frolov, V. A Quantitative analysis of some components of myocardial electron micrographs. Bull. Exp. Biol. Med. 1971, 71, 469–472. [Google Scholar] [CrossRef]
- Wen, J.J.; Gupta, S.; Guan, Z.; Dhiman, M.; Condon, D.; Lui, C.; Garg, N.J. Phenyl-alpha-tert-butyl-nitrone and benzonidazole treatment controlled the mitochondrial oxidative stress and evolution of cardiomyopathy in chronic chagasic Rats. J. Am. Coll. Cardiol. 2010, 55, 2499–2508. [Google Scholar] [CrossRef] [Green Version]
- Wen, J.J.; Garg, N.J. Manganese superoxide dismutase deficiency exacerbates the mitochondrial ROS production and oxidative damage in Chagas disease. PLoS Negl. Trop Dis. 2018, 12, e0006687. [Google Scholar] [CrossRef]
- Wen, J.J.; Yin, Y.W.; Garg, N.J. PARP1 depletion improves mitochondrial and heart function in Chagas disease: Effects on POLG dependent mtDNA maintenance. PLoS Pathog. 2018, 14, e1007065. [Google Scholar] [CrossRef] [Green Version]
- Wen, J.J.; Porter, C.; Garg, N.J. Inhibition of NFE2L2-Antioxidant Response Element Pathway by Mitochondrial Reactive Oxygen Species Contributes to Development of Cardiomyopathy and Left Ventricular Dysfunction in Chagas Disease. Antioxid. Redox Signal. 2017, 27, 550–566. [Google Scholar] [CrossRef]
Gene Name | Forward Primer | Reverse Primer | Amplicon Size (bp) | Accession # |
---|---|---|---|---|
B-actin | ACTGGCATTGTGATGGACTC | GCTCGGTCAGGATCTTCATG | 142 | V01217.1 |
D-Loop | CGGATGCCTTCCTCAACATA | AGTCTTTCGAGCTTTGTCTATGA | 107 | KF011917.1 |
ATP6 | GCACTAGCAGTACGACTAACAG | GTTGGTGGGCTGATGTCTATAA | 101 | KF011917.1 |
COXII | TCTCCCAGCTGTCATTCTTATTC | GCTTCAGTATCATTGGTGTCCTA | 121 | KF011917.1 |
GAPDH | ACTCCCATTCTTCCACCTTTG | CCCTGTTGCTGTAGCCATATT | 105 | NM_017008.4 |
ND1 | CGCCTGACCAATAGCCATAA | CGACGTTAAAGCCTGAGACTAA | 110 | KF011917.1 |
Gene Name | Forward Primer | Reverse Primer | Amplicon Size (bp) | Accession # |
---|---|---|---|---|
B-actin | ACAGGATGCAGAAGGAGATTAC | ACAGTGAGGCCAGGATAGA | 117 | V01217.1 |
ATP6 | TAGGCTTCCGACACAAACTAAA | CTGCTAGTGCTATCGGTTGAATA | 129 | KF011917.1 |
ATP8 | ATGCCACAACTAGACACAT | TTTGGGTGAGGGAGGTG | 120 | KF011917.1 |
COXI | GCCAGTATTAGCAGCAGGTATC | GGTGGCCGAAGAATCAGAATAG | 125 | KF011917.1 |
COXII | TCTCCCAGCTGTCATTCTTATTC | GCTTCAGTATCATTGGTGTCCTA | 121 | KF011917.1 |
COXIII | GCTGACCTCCAACAGGAATTA | CCTTCTATTAGGCTGTGATGGG | 118 | KF011917.1 |
Cyt B | CCTTCCTACCATTCCTGCATAC | TGGCCTCCGATTCATGTTAAG | 118 | KF011917.1 |
GAPDH | ACTCCCATTCTTCCACCTTTG | CCCTGTTGCTGTAGCCATATT | 105 | NM_017008.4 |
ND1 | GGCTCCTTCTCCCTACAAATAC | AAGGGAGCTCGATTTGTTTCT | 122 | KF011917.1 |
ND2 | CCCAACTATCACCACCATTCTC | TCGTGTTTGGGTCTGGTTAAG | 79 | KF011917.1 |
ND3 | TTCTGCACGCCTTCCTTT | GGTTGTTTGAATCGCTCATGG | 112 | KF011917.1 |
ND4 | GATGAGGCAACCAAACAGAAC | GTGTTGTGAGGGAGAGGATTAG | 147 | KF011917.1 |
ND5 | GCCGCCACTATTATCTCCTTC | CTACTTCCTCCCACTCCATTTG | 112 | NM_133584.1 |
ND6 | GGTGGGTTTGGATTGATTGTTAG | CCTCAGTAGCCATAGCAGTTG | 148 | NM_133584.1 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wen, J.J.; Cummins, C.B.; Radhakrishnan, R.S. Burn-Induced Cardiac Mitochondrial Dysfunction via Interruption of the PDE5A-cGMP-PKG Pathway. Int. J. Mol. Sci. 2020, 21, 2350. https://doi.org/10.3390/ijms21072350
Wen JJ, Cummins CB, Radhakrishnan RS. Burn-Induced Cardiac Mitochondrial Dysfunction via Interruption of the PDE5A-cGMP-PKG Pathway. International Journal of Molecular Sciences. 2020; 21(7):2350. https://doi.org/10.3390/ijms21072350
Chicago/Turabian StyleWen, Jake J., Claire B. Cummins, and Ravi S. Radhakrishnan. 2020. "Burn-Induced Cardiac Mitochondrial Dysfunction via Interruption of the PDE5A-cGMP-PKG Pathway" International Journal of Molecular Sciences 21, no. 7: 2350. https://doi.org/10.3390/ijms21072350
APA StyleWen, J. J., Cummins, C. B., & Radhakrishnan, R. S. (2020). Burn-Induced Cardiac Mitochondrial Dysfunction via Interruption of the PDE5A-cGMP-PKG Pathway. International Journal of Molecular Sciences, 21(7), 2350. https://doi.org/10.3390/ijms21072350