Deciphering the Biological Activities of Dunaliella sp. Aqueous Extract from Stressed Conditions on Breast Cancer: from in Vitro to in Vivo Investigations
Abstract
:1. Introduction
2. Results
2.1. 4T1 Mammary Carcinoma Cells Sensitivity towards DS Extracts
2.2. Deciphering DSS Cytotoxicity Mechanism
2.2.1. Qualitative Evaluation by Tunel Assay
2.2.2. Qualitative evaluation by Western blot
2.3. Tumor Growth Inhibition by Dunaliella Extracts
2.4. Assessment of Immune Activation
3. Discussion
4. Materials and Methods
4.1. Cancer Cell Line Culture
4.2. Microalgae Culture
4.3. Extracts Preparation
4.4. Cytotoxicity Evaluation
4.5. Cristal Violet Assay
4.6. Tunel Assay
4.7. Western Blot Experiments
4.8. In vivo Experiments
4.9. Immune Cell Identification
4.10. RNA Extraction and qPCR Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
DSS | Dunaliella sp. cultured under stressed conditions |
DSC | Dunaliella sp. cultured under unstressed (control) conditions |
TNBC | Triple negative breast cancer |
PARP-1 | Poly(ADP-ribose) polymerase-1 |
Arg-1 | Arginase-1 |
NOS-2 | Nitric oxide synthase 2 |
COX-2 | CycloOXygenase-2 |
GAPDH | GlycerAldehyde 3-Phosphate DeHydrogenase |
DMBA | 7,12-Dimethylbenz(a)anthracene |
HER-2 | Human epidermal growth factor receptor 2 |
DBD | DNA binding domain |
AMD | Auto-modification domain |
MDSC | Myeloid-derived suppressor cells |
TIL | Tumor-infiltrating lymphocyte |
RTV | Relative tumor volume |
DC | Dendritic cells |
MHC | Major histocompatibility complex |
PGE-2 | ProstaGlandin E2 |
NO | Nitric oxide |
ASW | Artificial sea water |
DMSO | Dimethyl sulfoxide |
PVDF | PolyVinyliDene Fluoride |
RIPA | RadioImmune Precipitation Assay |
PMSF | PhenylMethylSulfonyl Fluoride |
BCA | BiCinchoninic Acid |
SDS-PAGE | Sodium dodecyl sulfate-polyacrylamide gel electrophoresis |
TBST | Tris-buffered saline Tween |
RT | Room temperature |
PBS | Phosphate buffered saline |
NuMA | Nuclear mitotic apparatus protein-1 |
AIF | Apoptosis-inducing factor |
TNF | Tumor necrosis factor |
RPMI | Roswell Park Memorial Institute |
References
- Ramos, A.A.; Polle, J.; Tran, D.; Cushman, J.C.; Jin, E.; Varela, J.C. The unicellular green alga Dunaliella salina Teod. As a model for abiotic stress tolerance: Genetic advances and future perspectives. Algae 2011, 26, 3. [Google Scholar] [CrossRef]
- Raja, R.; Hemaiswarya, S.; Balasubramanyam, D.; Rengasamy, R. Protective effect of Dunaliella salina (Volvocales, Chlorophyta) against experimentally induced fibrosarcoma on wistar rats. Microbiol. Res. 2007, 162, 177–184. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Daim, M.M.; Farouk, S.M.; Madkour, F.F.; Azab, S.S. Anti-inflammatory and immunomodulatory effects of Spirulina platensis in comparison to Dunaliella salina in acetic acid-induced rat experimental colitis. Immunopharmacol. Immunotoxicol. 2015, 37, 126–139. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, R.; Chaitanyakumar, A.; Mageswari, A.; Gomathi, A.; Kumar, J.G.S.P.; Jayasindu, M.; Bharath, G.; Shravan, J.S.; Gothandam, K.M. Oral administration of lyophilized Dunaliella salina, a carotenoid-rich marine alga, reduces tumor progression in mammary cancer induced rats. Food Funct. 2017, 8, 4517–4527. [Google Scholar] [CrossRef] [PubMed]
- Chuang, W.C.; Ho, Y.C.; Liao, J.W.; Lu, F.J. Dunaliella salina exhibits an antileukemic immunity in a mouse model of WEHI-3 leukemia cells. J. Agric. Food Chem. 2014, 62, 11479–11487. [Google Scholar] [CrossRef] [PubMed]
- Hu, C.-C.; Lin, J.-T.; Lu, F.-J.; Chou, F.-P.; Yang, D.-J. Determination of carotenoids in Dunaliella salina cultivated in Taiwan and antioxidant capacity of the algal carotenoid extract. Food Chem. 2008, 109, 439–446. [Google Scholar] [CrossRef]
- Murthy, K.N.C.; Vanitha, A.; Rajesha, J.; Swamy, M.M.; Sowmya, P.R.; Ravishankar, G.A. In vivo antioxidant activity of carotenoids from Dunaliella salina—A green microalga. Life Sci. 2005, 76, 1381–1390. [Google Scholar] [CrossRef] [PubMed]
- Pane, G.; Cacciola, G.; Giacco, E.; Mariottini, G.L.; Coppo, E. Assessment of the Antimicrobial Activity of Algae Extracts on Bacteria Responsible of External Otitis. Mar. Drugs 2015, 13, 6440–6452. [Google Scholar] [CrossRef]
- Yang, D.-J.; Lin, J.-T.; Chen, Y.-C.; Liu, S.-C.; Lu, F.-J.; Chang, T.-J.; Wang, M.; Lin, H.-W.; Chang, Y.-Y. Suppressive effect of carotenoid extract of Dunaliella salina alga on production of LPS-stimulated pro-inflammatory mediators in RAW264.7 cells via NF-κB and JNK inactivation. J. Funct. Foods 2013, 5, 607–615. [Google Scholar] [CrossRef]
- Lin, H.-W.; Chen, Y.-C.; Liu, C.-W.; Yang, D.-J.; Chen, S.-Y.; Chang, T.-J.; Chang, Y.-Y. Regulation of virus-induced inflammatory response by Dunaliella salina alga extract in macrophages. Food Chem. Toxicol. 2014, 71, 159–165. [Google Scholar] [CrossRef]
- Chou, P.Y.; Huang, G.J.; Cheng, H.C.; Wu, C.H.; Chien, Y.C.; Chen, J.S.; Huang, M.H.; Hsu, K.J.; Sheu, M.J. Analgesic And Anti-Inflammatory Activities Of An Ethanol Extract Of Dunaliella Salina Teod. (Chlorophyceae). J. Food Biochem. 2010, 34, 1288–1302. [Google Scholar] [CrossRef]
- Sheu, M.-J.; Huang, G.-J.; Wu, C.-H.; Chen, J.-S.; Chang, H.-Y.; Chang, S.-J.; Chung, J.-G. Ethanol extract of Dunaliella salina induces cell cycle arrest and apoptosis in A549 human non-small cell lung cancer cells. Vivo 2008, 22, 369–378. [Google Scholar]
- Bechelli, J.; Coppage, M.; Rosell, K.; Liesveld, J. Cytotoxicity of Algae Extracts on Normal and Malignant Cells. Available online: https://www.hindawi.com/journals/lrt/2011/373519/ (accessed on 1 July 2018).
- Emtyazjoo, M.; Moghadasi, Z.; Rabbani, M.; Emtyazjoo, M.; Samadi, S.; Mossaffa, N. Anticancer effect of Dunaliella salina under stress and normal conditions against skin carcinoma cell line A431 in vitro. Iran. J. Fish. Sci. 2012, 11, 283–293. [Google Scholar]
- Jayappriyan, K.R.; Rajkumar, R.; Venkatakrishnan, V.; Nagaraj, S.; Rengasamy, R. In vitro anticancer activity of natural β-carotene from Dunaliella salina EU5891199 in PC-3 cells. Biomed. Prev. Nutr. 2013, 3, 99–105. [Google Scholar] [CrossRef]
- Olmos, J.; Gómez, R.; Rubio, V.P. Apoptosis Comparison Effects Between Synthetic and Natural à ’-Carotene from Dunaliella salina on MDA-MB-231Brest Cancer Cells. J. Microb. Biochem. Technol. 2015, 7, 51–56. [Google Scholar]
- Chiu, H.-F.; Liao, J.-Y.; Lu, Y.-Y.; Han, Y.-C.; Shen, Y.-C.; Venkatakrishnan, K.; Golovinskaia, O.; Wang, C.-K. Anti-proliferative, anti-inflammatory and pro-apoptotic effects of Dunaliella salina on human KB oral carcinoma cells. J. Food Biochem. 2017, 41, e12349. [Google Scholar] [CrossRef]
- Worldwide Cancer Data. Available online: https://www.wcrf.org/dietandcancer/cancer-trends/worldwide-cancer-data (accessed on 3 April 2019).
- Hon, J.D.C.; Singh, B.; Sahin, A.; Du, G.; Wang, J.; Wang, V.Y.; Deng, F.-M.; Zhang, D.Y.; Monaco, M.E.; Lee, P. Breast cancer molecular subtypes: From TNBC to QNBC. Am. J. Cancer Res. 2016, 6, 1864–1872. [Google Scholar]
- Podo, F.; Buydens, L.M.C.; Degani, H.; Hilhorst, R.; Klipp, E.; Gribbestad, I.S.; Van Huffel, S.; WM van Laarhoven, H.; Luts, J.; Monleon, D.; et al. Triple-negative breast cancer: Present challenges and new perspectives. Mol. Oncol. 2010, 4, 209–229. [Google Scholar] [CrossRef]
- Foulkes, W.D.; Smith, I.E.; Reis-Filho, J.S. Triple-Negative Breast Cancer. N. Engl. J. Med. 2010, 363, 1938–1948. [Google Scholar] [CrossRef] [Green Version]
- Keung, M.Y.T.; Wu, Y.; Vadgama, J.V. PARP Inhibitors as a Therapeutic Agent for Homologous Recombination Deficiency in Breast Cancers. J. Clin. Med. 2019, 8, 435. [Google Scholar] [CrossRef] [Green Version]
- Fouad, Y.A.; Aanei, C. Revisiting the hallmarks of cancer. Am. J. Cancer Res. 2017, 7, 1016–1036. [Google Scholar] [PubMed]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef] [PubMed]
- Candé, C.; Cecconi, F.; Dessen, P.; Kroemer, G. Apoptosis-inducing factor (AIF): Key to the conserved caspase-independent pathways of cell death? J. Cell. Sci. 2002, 115, 4727–4734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morales, J.C.; Li, L.; Fattah, F.J.; Dong, Y.; Bey, E.A.; Patel, M.; Gao, J.; Boothman, D.A. Review of Poly (ADP-ribose) Polymerase (PARP) Mechanisms of Action and Rationale for Targeting in Cancer and Other Diseases. Crit. Rev. Eukaryot. Gene Expr. 2014, 24, 15–28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chaitanya, G.V.; Alexander, J.S.; Babu, P.P. PARP-1 cleavage fragments: Signatures of cell-death proteases in neurodegeneration. Cell Commun. Signal 2010, 8, 31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siddiqui, A.; Puvvada, A. Immuno Defense Mechanism against Tumors. J. Cancer Sci. Ther. 2011, 3. [Google Scholar] [CrossRef]
- Dietrich, P.Y.; Walker, P.R. Échappement et tolérance des tumeurs à l’apoptose. Tumour Toler. Immune Escape Apoptosis. 2000, 16, 492. [Google Scholar] [CrossRef]
- Loi, S.; Drubay, D.; Adams, S.; Pruneri, G.; Francis, P.A.; Lacroix-Triki, M.; Joensuu, H.; Dieci, M.V.; Badve, S.; Demaria, S.; et al. Tumor-Infiltrating Lymphocytes and Prognosis: A Pooled Individual Patient Analysis of Early-Stage Triple-Negative Breast Cancers. J. Clin. Oncol. 2019, 37, 559–569. [Google Scholar] [CrossRef]
- Miksch, R.C.; Schoenberg, M.B.; Weniger, M.; Bösch, F.; Ormanns, S.; Mayer, B.; Werner, J.; Bazhin, A.V.; D’Haese, J.G. Prognostic Impact of Tumor-Infiltrating Lymphocytes and Neutrophils on Survival of Patients with Upfront Resection of Pancreatic Cancer. Cancers 2019, 11, 39. [Google Scholar] [CrossRef] [Green Version]
- Lee, N.; Zakka, L.R.; Mihm, M.C.; Schatton, T. Tumour-infiltrating lymphocytes in melanoma prognosis and cancer immunotherapy. Pathology 2016, 48, 177–187. [Google Scholar] [CrossRef]
- Gooden, M.J.M.; de Bock, G.H.; Leffers, N.; Daemen, T.; Nijman, H.W. The prognostic influence of tumour-infiltrating lymphocytes in cancer: A systematic review with meta-analysis. Br. J. Cancer 2011, 105, 93–103. [Google Scholar] [CrossRef] [Green Version]
- Maimela, N.R.; Liu, S.; Zhang, Y. Fates of CD8+ T cells in Tumor Microenvironment. Comput. Struct. Biotechnol. J. 2019, 17, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Guillerey, C.; Huntington, N.D.; Smyth, M.J. Targeting natural killer cells in cancer immunotherapy. Nat. Immunol. 2016, 17, 1025–1036. [Google Scholar] [CrossRef] [PubMed]
- Galaine, J.; Borg, C.; Godet, Y.; Adotévi, O. Interest of Tumor-Specific CD4 T Helper 1 Cells for Therapeutic Anticancer Vaccine. Vaccines 2015, 3, 490. [Google Scholar] [CrossRef] [PubMed]
- Fridlender, Z.G.; Sun, J.; Kim, S.; Kapoor, V.; Cheng, G.; Ling, L.; Worthen, G.S.; Albelda, S.M. Polarization of Tumor-Associated Neutrophil (TAN) Phenotype by TGF-β: “N1” versus “N2” TAN. Cancer Cell 2009, 16, 183–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feoktistova, M.; Geserick, P.; Leverkus, M. Crystal Violet Assay for Determining Viability of Cultured Cells. Cold Spring Harb. Protoc. 2016, 2016, 087379. [Google Scholar] [CrossRef] [PubMed]
- Rabinovich, G.A.; Gabrilovich, D.; Sotomayor, E.M. Immunosuppressive strategies that are mediated by tumor cells. Annu. Rev. Immunol. 2007, 25, 267–296. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ben Amor, F.; Elleuch, F.; Ben Hlima, H.; Garnier, M.; Saint-Jean, B.; Barkallah, M.; Pichon, C.; Abdelkafi, S.; Fendri, I. Proteomic Analysis of the Chlorophyta Dunaliella New Strain AL-1 Revealed Global Changes of Metabolism during High Carotenoid Production. Mar. Drugs 2017, 15, 293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Widowati, I.; Zainuri, M.; Kusumaningrum, H.P.; Susilowati, R.; Yann, H.; Leignel, V.; Bourgougnon, N.; Mouget, J.-L. Antioxidant activity of three microalgae Dunaliella salina, Tetraselmis chuii and Isochrysis galbana clone Tahiti. IOP Conf. Ser. Earth Environ. Sci. 2017, 55, 012067. [Google Scholar] [CrossRef] [Green Version]
- Al-Rashed, S.A.; Ibrahim, M.M.; El-Gaaly, G.A.; Al-Shehri, S.; Mostafa, A. Evaluation of radical scavenging system in two microalgae in response to interactive stresses of UV-B radiation and nitrogen starvation. Saudi J. Biol. Sci. 2016, 23, 706–712. [Google Scholar] [CrossRef] [Green Version]
- Davidi, L.; Shimoni, E.; Khozin-Goldberg, I.; Zamir, A.; Pick, U. Origin of β-carotene-rich plastoglobuli in Dunaliella bardawil. Plant Physiol. 2014, 164, 2139–2156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shanab, S.M.; Mostafa, S.S.; Shalaby, E.A.; Mahmoud, G.I. Aqueous extracts of microalgae exhibit antioxidant and anticancer activities. Asian Pac. J. Trop. Biomed. 2012, 2, 608–615. [Google Scholar] [CrossRef] [Green Version]
- Somasekharan, S.P.; El-Naggar, A.; Sorensen, P.H.; Wang, Y.; Cheng, H. An Aqueous Extract of Marine Microalgae Exhibits Antimetastatic Activity through Preferential Killing of Suspended Cancer Cells and Anticolony Forming Activity. Available online: https://www.hindawi.com/journals/ecam/2016/9730654/ (accessed on 5 September 2017).
- Paolini, M.; Cantelli-Forti, G.; Perocco, P.; Pedulli, G.F.; Abdel-Rahman, S.Z.; Legator, M.S. Co-carcinogenic effect of β-carotene. Nature 1999, 398, 760–761. [Google Scholar] [CrossRef]
- Paolini, M.; Abdel-Rahman, S.Z.; Sapone, A.; Pedulli, G.F.; Perocco, P.; Cantelli-Forti, G.; Legator, M.S. β-Carotene: A cancer chemopreventive agent or a co-carcinogen? Mutat. Res. Rev. Mutat. Res. 2003, 543, 195–200. [Google Scholar] [CrossRef]
- Hosseini Tafreshi, A.; Shariati, M. Dunaliella biotechnology: Methods and applications. J. Appl. Microbiol. 2009, 107, 14–35. [Google Scholar] [CrossRef] [PubMed]
- Kleinsimon, S.; Kauczor, G.; Jaeger, S.; Eggert, A.; Seifert, G.; Delebinski, C. ViscumTT induces apoptosis and alters IAP expression in osteosarcoma in vitro and has synergistic action when combined with different chemotherapeutic drugs. BMC Complement Altern. Med. 2017, 17. [Google Scholar] [CrossRef] [Green Version]
- Grudzien, M.; Rapak, A. Effect of Natural Compounds on NK Cell Activation. J. Immunol. Res. 2018, 2018. [Google Scholar] [CrossRef] [Green Version]
- Soumelis, V.; Liu, Y.-J. From plasmacytoid to dendritic cell: Morphological and functional switches during plasmacytoid pre-dendritic cell differentiation. Eur. J. Immunol. 2006, 36, 2286–2292. [Google Scholar] [CrossRef]
- Herzer, K.; Hofmann, T.G.; Teufel, A.; Schimanski, C.C.; Moehler, M.; Kanzler, S.; Schulze-Bergkamen, H.; Galle, P.R. IFN-α–Induced Apoptosis in Hepatocellular Carcinoma Involves Promyelocytic Leukemia Protein and TRAIL Independently of p53. Cancer Res. 2009, 69, 855–862. [Google Scholar] [CrossRef] [Green Version]
- Mahmoud, S.; Lee, A.; Ellis, I.; Green, A. CD8+ T lymphocytes infiltrating breast cancer. Oncoimmunology 2012, 1, 364–365. [Google Scholar] [CrossRef] [Green Version]
- Wu, J.; Li, S.; Yang, Y.; Zhu, S.; Zhang, M.; Qiao, Y.; Liu, Y.-J.; Chen, J. TLR-activated plasmacytoid dendritic cells inhibit breast cancer cell growth in vitro and in vivo. Oncotarget 2016, 8, 11708–11718. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fleming, V.; Hu, X.; Weber, R.; Nagibin, V.; Groth, C.; Altevogt, P.; Utikal, J.; Umansky, V. Targeting Myeloid-Derived Suppressor Cells to Bypass Tumor-Induced Immunosuppression. Front. Immunol. 2018, 9. [Google Scholar] [CrossRef] [PubMed]
- Munder, M. Arginase: An emerging key player in the mammalian immune system. Br. J. Pharmacol. 2009, 158, 638–651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noy, R.; Pollard, J.W. Tumor-associated macrophages: From mechanisms to therapy. Immunity 2014, 41, 49–61. [Google Scholar] [CrossRef] [Green Version]
- Granados-Principal, S.; Liu, Y.; Guevara, M.L.; Blanco, E.; Choi, D.S.; Qian, W.; Patel, T.; Rodriguez, A.A.; Cusimano, J.; Weiss, H.L.; et al. Inhibition of iNOS as a novel effective targeted therapy against triple-negative breast cancer. Breast Cancer Res. 2015, 17, 25. [Google Scholar] [CrossRef]
- Liu, B.; Qu, L.; Yan, S. Cyclooxygenase-2 promotes tumor growth and suppresses tumor immunity. Cancer Cell Int. 2015, 15, 106. [Google Scholar] [CrossRef] [Green Version]
- Nassar, A.; Radhakrishnan, A.; Cabrero, I.; Cotsonis, G.; Cohen, C. COX-2 Expression in Invasive Breast Cancer. Appl. Immunohistochem. Mol. Morphol. 2007, 15, 255–259. [Google Scholar] [CrossRef]
- Basudhar, D.; Glynn, S.A.; Greer, M.; Somasundaram, V.; No, J.H.; Scheiblin, D.A.; Garrido, P.; Heinz, W.F.; Ryan, A.E.; Weiss, J.M.; et al. Coexpression of NOS2 and COX2 accelerates tumor growth and reduces survival in estrogen receptor-negative breast cancer. Proc. Natl. Acad. Sci. USA 2017, 114, 13030–13035. [Google Scholar] [CrossRef] [Green Version]
- Wang, S.; Campos, J.; Gallotta, M.; Gong, M.; Crain, C.; Naik, E.; Coffman, R.L.; Guiducci, C. Intratumoral injection of a CpG oligonucleotide reverts resistance to PD-1 blockade by expanding multifunctional CD8+ T cells. Proc. Natl. Acad. Sci. USA 2016, 113, E7240–E7249. [Google Scholar] [CrossRef] [Green Version]
- Xu, M.; Liu, M.; Du, X.; Li, S.; Li, H.; Li, X.; Li, Y.; Wang, Y.; Qin, Z.; Fu, Y.-X.; et al. Intratumoral Delivery of IL-21 Overcomes Anti-Her2/Neu Resistance through Shifting Tumor-Associated Macrophages from M2 to M1 Phenotype. J. Immunol. 2015, 194, 4997–5006. [Google Scholar] [CrossRef] [Green Version]
- Marabelle, A.; Kohrt, H.; Caux, C.; Levy, R. Intratumoral Immunization: A New Paradigm for Cancer Therapy. Clin. Cancer Res. 2014, 20, 1747–1756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elleuch, F.; Hlima, H.B.; Barkallah, M.; Baril, P.; Abdelkafi, S.; Pichon, C.; Fendri, I. Carotenoids Overproduction in Dunaliella Sp.: Transcriptional Changes and New Insights through Lycopene β Cyclase Regulation. Appl. Sci. 2019, 9, 5389. [Google Scholar] [CrossRef] [Green Version]
- Maadane, A.; Merghoub, N.; Ainane, T.; El Arroussi, H.; Benhima, R.; Amzazi, S.; Bakri, Y.; Wahby, I. Antioxidant activity of some Moroccan marine microalgae: Pufa profiles, carotenoids and phenolic content. J. Biotechnol. 2015, 215, 13–19. [Google Scholar] [CrossRef] [PubMed]
- Rostock, M.; Huber, R.; Greiner, T.; Fritz, P.; Scheer, R.; Schueler, J.; Fiebig, H.H. Anticancer Activity of a Lectin-rich Mistletoe Extract Injected Intratumorally into Human Pancreatic Cancer Xenografts. Anticancer Res. 2005, 25, 1969–1975. [Google Scholar] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Lai, Y.; Xu, X.; Zhu, Z.; Hua, Z. Highly efficient siRNA transfection in macrophages using apoptotic body-mimic Ca-PS lipopolyplex. Int. J. Nanomed. 2018, 13, 6603–6623. [Google Scholar] [CrossRef] [Green Version]
- Rong, Y.; Yuan, C.H.; Qu, Z.; Zhou, H.; Guan, Q.; Yang, N.; Leng, X.H.; Bu, L.; Wu, K.; Wang, F.B. Doxorubicin resistant cancer cells activate myeloid-derived suppressor cells by releasing PGE2. Sci. Rep. 2016, 6, 1–11. [Google Scholar] [CrossRef] [Green Version]
Recognized Antigen | Fluorochrome | Clone | Reference BD Pharmingen |
---|---|---|---|
CD3 | PerCP/Cy5.5 | 145-2C11 | 551163 |
CD8 | BV510 | 341 | 742916 |
NK1.1 | BV60 | PK136 | 563220 |
CD11c | BV711 | HL3 | 563048 |
MHCII | PE/Cy7 | L243 | 335830 |
CD80 | FITC | 16-10A1 | 553768 |
CD107a | BV78 | 61D4B | 564349 |
Gr-1 | APC-Cy™7 | RB6-8C5 | 557661 |
Genes (Mouse) | Primer Sequence (5′→3′) | Amplicon Size | References |
---|---|---|---|
GAPDH | TCTCCCTCACAATTTCCATCCCAG | -- | [69] |
GGGTGCAGCGAACTTTATTGATGG | |||
Arg-1 | CTCCAAGCCAAAGTCCTTAGAG | 185 | [70] |
AGGAGCTGTCATTAGGGACATC | |||
NOS-2 | CCAAGCCCTCACCTACTTCC | 127 | |
CTCTGAGGGCTGACACAAGG | |||
COX-2 | TGAGTACCGCAAACGCTTCT | 169 | |
CTCCCCAAAGATAGCATCTGG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elleuch, F.; Baril, P.; Barkallah, M.; Perche, F.; Abdelkafi, S.; Fendri, I.; Pichon, C. Deciphering the Biological Activities of Dunaliella sp. Aqueous Extract from Stressed Conditions on Breast Cancer: from in Vitro to in Vivo Investigations. Int. J. Mol. Sci. 2020, 21, 1719. https://doi.org/10.3390/ijms21051719
Elleuch F, Baril P, Barkallah M, Perche F, Abdelkafi S, Fendri I, Pichon C. Deciphering the Biological Activities of Dunaliella sp. Aqueous Extract from Stressed Conditions on Breast Cancer: from in Vitro to in Vivo Investigations. International Journal of Molecular Sciences. 2020; 21(5):1719. https://doi.org/10.3390/ijms21051719
Chicago/Turabian StyleElleuch, Fatma, Patrick Baril, Mohamed Barkallah, Federico Perche, Slim Abdelkafi, Imen Fendri, and Chantal Pichon. 2020. "Deciphering the Biological Activities of Dunaliella sp. Aqueous Extract from Stressed Conditions on Breast Cancer: from in Vitro to in Vivo Investigations" International Journal of Molecular Sciences 21, no. 5: 1719. https://doi.org/10.3390/ijms21051719
APA StyleElleuch, F., Baril, P., Barkallah, M., Perche, F., Abdelkafi, S., Fendri, I., & Pichon, C. (2020). Deciphering the Biological Activities of Dunaliella sp. Aqueous Extract from Stressed Conditions on Breast Cancer: from in Vitro to in Vivo Investigations. International Journal of Molecular Sciences, 21(5), 1719. https://doi.org/10.3390/ijms21051719