Initiation of Conceptus Elongation Coincides with an Endometrium Basic Fibroblast Growth Factor (FGF2) Protein Increase in Heifers
Abstract
1. Introduction
2. Results
2.1. Pregnancy Hormone P4 was Affected by Pregancy Status as Expected
2.2. Endometrium and Conceptus FGF and FGFR mRNA Expression was Influenced by the Day of Pregnancy
2.3. aFGF and bFGF Protein was Localized in the Endomentrium of both Cyclic and Pregnant Heifers
2.4. bFGF Protein Abundance Increased at Day 15
3. Discussion
4. Materials and Methods
4.1. Animals and Collection of Samples
4.2. Progesterone and Estradiol-17β Analysis
4.3. Gene Expression Analysis
4.4. Immunohistochemistry of FGF in the Endometrium
4.5. Endometrium Protein Abundance Determination
4.6. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Presta, M.; Dell’Era, P.; Mitola, S.; Moroni, E.; Ronca, R.; Rusnati, M. Fibroblast growth factor/fibroblast growth factor receptor system in angiogenesis. Cytokine Growth Factor Rev. 2005, 16, 159–178. [Google Scholar] [CrossRef] [PubMed]
- Powers, C.J.; McLeskey, S.W.; Wellstein, A. Fibroblast growth factors, their receptors and signaling. Endocr. Relat. Cancer 2000, 7, 165–197. [Google Scholar] [CrossRef] [PubMed]
- Gupta, A.; Bazer, F.; Jaeger, L. Immunolocalization of acidic and basic fibroblast growth factors in porcine uterine and conceptus tissues. Biol. Reprod. 1997, 56, 1527–1536. [Google Scholar] [CrossRef]
- Tsai, S.-J.; Wu, M.-H.; Chen, H.-M.; Chuang, P.-C.; Wing, L.-Y.C. Fibroblast Growth Factor-9 Is an Endometrial Stromal Growth Factor. Endocrinology 2002, 143, 2715–2721. [Google Scholar] [CrossRef] [PubMed]
- Ornitz, D.M.; Itoh, N. The fibroblast growth factor signaling pathway. Wires Dev. Biol. 2015, 4, 215–266. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Weinstein, M.; Li, C.; Naski, M.; Cohen, R.I.; Ornitz, D.M.; Leder, P.; Deng, C. Fibroblast growth factor receptor 2 (FGFR2)-mediated reciprocal regulation loop between FGF8 and FGF10 is essential for limb induction. Development 1998, 125, 753. [Google Scholar] [PubMed]
- Torry, D.S.; Leavenworth, J.; Chang, M.; Maheshwari, V.; Groesch, K.; Ball, E.R.; Torry, R.J. Angiogenesis in implantation. J. Assist. Reprod. Genet. 2007, 24, 303–315. [Google Scholar] [CrossRef]
- Lapointe, J.; Bilodeau, J.-F. Antioxidant Defenses Are Modulated in the Cow Oviduct During the Estrous Cycle1. Biol. Reprod. 2003, 68, 1157–1164. [Google Scholar] [CrossRef]
- Pfarrer, C.; Weise, S.; Berisha, B.; Schams, D.; Leiser, R.; Hoffmann, B.; Schuler, G. Fibroblast Growth Factor (FGF)-1, FGF2, FGF7 and FGF Receptors are Uniformly Expressed in Trophoblast Giant Cells During Restricted Trophoblast Invasion in Cows. Placenta 2006, 27, 758–770. [Google Scholar] [CrossRef]
- Pfarrer, C.D.; Ruziwa, S.D.; Winther, H.; Callesen, H.; Leiser, R.; Schams, D.; Dantzer, V. Localization of Vascular Endothelial Growth Factor (VEGF) and its Receptors VEGFR-1 and VEGFR-2 in Bovine Placentomes from Implantation Until Term. Placenta 2006, 27, 889–898. [Google Scholar] [CrossRef]
- Okumu, L.; Forde, N.; Mamo, S.; McGettigan, P.; Mehta, P.J.P.; Roche, J.; Lonergan, P. Temporal regulation of fibroblast growth factors in the bovine endometrium and conceptus. Reproduction 2014, 147, 825–834. [Google Scholar] [CrossRef] [PubMed]
- Cooke, N.T.F.; Pennington, A.K.; Yang, Q.; Ealy, D.A. Several fibroblast growth factors are expressed during pre-attachment bovine conceptus development and regulate interferon-tau expression from trophectoderm. Reproduction 2009, 137, 259–269. [Google Scholar] [CrossRef] [PubMed]
- Brooks, K.; Spencer, T.E. Biological Roles of Interferon Tau (IFNT) and Type I IFN Receptors in Elongation of the Ovine Conceptus1. Biol. Reprod. 2015, 92, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Schanzenbach, C.I. Developement of Diagnostic Tools to Decipher Para- and Endocrine Effects of IFN Tau. Ph.D Thesis, ETH Zurich, Zurich, Switzerland, 2018. Available online: https://www.research-collection.ethz.ch/handle/20.500.11850/310749 (accessed on 10 February 2020).
- Ealy, A.D.; Yang, Q.E. REVIEW ARTICLE: Control of Interferon-Tau Expression During Early Pregnancy in Ruminants. Am. J. Reprod. Immunol. 2009, 61, 95–106. [Google Scholar] [CrossRef]
- Michael, D.D.; Alvarez, I.M.; Ocon, O.M.; Powell, A.M.; Talbot, N.C.; Johnson, S.E.; Ealy, A.D. Fibroblast growth factor-2 is expressed by the bovine uterus and stimulates interferon-tau production in bovine trophectoderm. Endocrinology 2006, 147, 3571–3579. [Google Scholar] [CrossRef] [PubMed]
- Lim, W.; Bae, H.; Bazer, F.W.; Song, G. Fibroblast growth factor 2 induces proliferation and distribution of G2/M phase of bovine endometrial cells involving activation of PI3K/AKT and MAPK cell signaling and prevention of effects of ER stress. J. Cell Physiol. 2018, 233, 3295–3305. [Google Scholar] [CrossRef] [PubMed]
- Sangha, R.K.; Li, X.F.; Shams, M.; Ahmed, A. Fibroblast growth factor receptor-1 is a critical component for endometrial remodeling: Localization and expression of basic fibroblast growth factor and FGF-R1 in human endometrium during the menstrual cycle and decreased FGF-R1 expression in menorrhagia. Laboratory investigation. Lab. Investig. 1997, 77, 389–402. [Google Scholar]
- Fujimoto, J.; Hori, M.; Ichigo, S.; Hirose, R.; Tamaya, T. Ability of ovarian steroids to regulate the expression of the fibroblast growth factor family in fibroblasts derived from uterine endometrium. J. Biomed. Sci. 1996, 3, 280–285. [Google Scholar] [CrossRef]
- Ulbrich, S.E.; Schulke, K.; Groebner, A.E.; Reichenbach, H.D.; Angioni, C.; Geisslinger, G.; Meyer, H.H. Quantitative characterization of prostaglandins in the uterus of early pregnant cattle. Reproduction 2009, 138, 371–382. [Google Scholar] [CrossRef]
- Groebner, A.E.; Rubio-Aliaga, I.; Schulke, K.; Reichenbach, H.D.; Daniel, H.; Wolf, E.; Meyer, H.H.; Ulbrich, S.E. Increase of essential amino acids in the bovine uterine lumen during preimplantation development. Reproduction 2011, 141, 685–695. [Google Scholar] [CrossRef]
- Groebner, A.E.; Schulke, K.; Unterseer, S.; Reichenbach, H.D.; Reichenbach, M.; Büttner, M.; Wolf, E.; Meyer, H.H.D.; Ulbrich, S.E. Enhanced proapoptotic gene expression of XAF1, CASP8 and TNFSF10 in the bovine endometrium during early pregnancy is not correlated with augmented apoptosis. Placenta 2010, 31, 168–177. [Google Scholar] [CrossRef] [PubMed]
- Berisha, B.; Sinowatz, F.; Schams, D. Expression and localization of fibroblast growth factor (FGF) family members during the final growth of bovine ovarian follicles. Mol. Reprod. Dev. 2004, 67, 162–171. [Google Scholar] [CrossRef] [PubMed]
- Schams, D.; Steinberg, V.; Steffl, M.; Meyer, H.H.; Berisha, B. Expression and possible role of fibroblast growth factor family members in porcine antral follicles during final maturation. Reproduction 2009, 138, 141–149. [Google Scholar] [CrossRef] [PubMed]
- Prakash, B.S.; Meyer, H.H.; Schallenberger, E.; van de Weil, D.F. Development of a sensitive enzymeimmunoassay (EIA) for progesterone determination in unextracted bovine plasma using the second antibody technique. J. Steroid Biochem. 1987, 28, 623–627. [Google Scholar] [CrossRef]
Day | Status | Animals | Progesterone [ng/mL] | Estradiol-17β [pg/mL] | ||
---|---|---|---|---|---|---|
Mean ± SEM | p-Value | Mean ± SEM | p-Value | |||
Day 12 | nonpregnant | 6 | 8.40 ± 1.02 | 0.7 | 3.51 ± 0.61 | 0.7 |
pregnant | 5 | 7.83 ± 0.93 | 3.23 ± 0.56 | |||
Day 15 | nonpregnant | 7 | 6.63 ± 0.86 | 0.04 | 1.92 ± 0.52 | 0.3 |
pregnant | 6 | 9.37 ± 0.93 | 2.81 ± 0.56 | |||
Day 18 | nonpregnant | 8 | 6.80 ± 0.80 | 0.003 | 1.20 ± 0.48 | 0.2 |
pregnant | 5 | 10.91 ± 1.02 | 2.32 ± 0.61 |
Primer | Sequence | Fragment Length [bp] | Accession Number | |
---|---|---|---|---|
Polyubiquitin | for | AGATCCAGGATAAGGAAGGCAT | 198 | NM_174133 |
rev | GCTCCACCTCCAGGGTGAT | |||
Histone | for | AGATCCAGGATAAGGAAGGCAT | 233 | NM_174133 |
rev | GCTCCACCTCCAGGGTGAT | |||
18S rRNA | for | AAGTCTTTGGGTTCCGGG | 365 | - |
rev | GGACATCTAAGGGCATCACA | |||
FGF1 | for | GCTGAAGGAGAAACCACGAC | 317 | BC103225 |
rev | GTTTTCCTCCAACCTTTCCA | |||
FGF2 | for | GAACGGGGGCTTCTTCCT | 288 | NM_174056 |
rev | CCCAGTTCGTTTCAGTGCC | |||
FGFR1(IIIc) | for | ACTGCTGGAGTTAATACCACCG | 125 | NM_001110207 |
rev | GCAGAGTGATGGGAGAGTCC | |||
FGFR2(IIIc) | for | GGTGTTAACACCACGGACAA | 139 | AJ439896 |
rev | CTGGCAGAACTGTCAACCAT | |||
FGFR3(IIIc) | for | CGCTAACACCACCGACAAG | 154 | AF368288 |
rev | CACCAGCTCCTCCTCAGC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chiumia, D.; Schulke, K.; Groebner, A.E.; Waldschmitt, N.; Reichenbach, H.-D.; Zakhartchenko, V.; Bauersachs, S.; Ulbrich, S.E. Initiation of Conceptus Elongation Coincides with an Endometrium Basic Fibroblast Growth Factor (FGF2) Protein Increase in Heifers. Int. J. Mol. Sci. 2020, 21, 1584. https://doi.org/10.3390/ijms21051584
Chiumia D, Schulke K, Groebner AE, Waldschmitt N, Reichenbach H-D, Zakhartchenko V, Bauersachs S, Ulbrich SE. Initiation of Conceptus Elongation Coincides with an Endometrium Basic Fibroblast Growth Factor (FGF2) Protein Increase in Heifers. International Journal of Molecular Sciences. 2020; 21(5):1584. https://doi.org/10.3390/ijms21051584
Chicago/Turabian StyleChiumia, Daniel, Katy Schulke, Anna E. Groebner, Nadine Waldschmitt, Horst-Dieter Reichenbach, Valeri Zakhartchenko, Stefan Bauersachs, and Susanne E. Ulbrich. 2020. "Initiation of Conceptus Elongation Coincides with an Endometrium Basic Fibroblast Growth Factor (FGF2) Protein Increase in Heifers" International Journal of Molecular Sciences 21, no. 5: 1584. https://doi.org/10.3390/ijms21051584
APA StyleChiumia, D., Schulke, K., Groebner, A. E., Waldschmitt, N., Reichenbach, H.-D., Zakhartchenko, V., Bauersachs, S., & Ulbrich, S. E. (2020). Initiation of Conceptus Elongation Coincides with an Endometrium Basic Fibroblast Growth Factor (FGF2) Protein Increase in Heifers. International Journal of Molecular Sciences, 21(5), 1584. https://doi.org/10.3390/ijms21051584