Knockout of the Glucocorticoid Receptor Impairs Reproduction in Female Zebrafish
Abstract
1. Introduction
2. Results
2.1. Ovarian Histology and Fertility Analysis
2.2. Real Time PCR of Signals Involved in Reproduction at Central and Peripheral Levels
2.3. Infrared Imaging Analysis
3. Discussion
4. Materials and Methods
4.1. Zebrafish Maintenance and Oocyte Isolation
4.2. Histological Analysis
4.3. Fish Fertility
4.4. RNA Extraction and cDNA Synthesis
4.5. Real-Time PCR
4.6. Fourier Transform Infrared Imaging (FTIRI) Measurements and Data Analysis
4.7. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Biran, J.; Levavi-Sivan, B. Endocrine Control of Reproduction, Fish. In Encyclopedia of Reproduction; Academic Press: Cambridge, MA, USA, 2018; pp. 362–368. [Google Scholar] [CrossRef]
- Juntti, S.A.; Fernald, R.D. Timing reproduction in teleost fish: Cues and mechanisms. Curr. Opin. Neurobiol. 2016, 38, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Schreck, C.B. Stress and fish reproduction: The roles of allostasis and hormesis. Gen. Comp. Endocrinol. 2010, 165, 549–556. [Google Scholar] [CrossRef] [PubMed]
- Trudeau, V.L. Facing the challenges of neuropeptide gene knockouts: Why do they not inhibit reproduction in adult teleost fish? Front. Neurosci. 2018, 12, 302. [Google Scholar] [CrossRef] [PubMed]
- Santangeli, S.; Maradonna, F.; Olivotto, I.; Piccinetti, C.C.; Gioacchini, G.; Carnevali, O. Effects of BPA on female reproductive function: The involvement of epigenetic mechanism. Gen. Comp. Endocrinol. 2017, 245, 122–126. [Google Scholar] [CrossRef] [PubMed]
- Santangeli, S.; Consales, C.; Pacchierotti, F.; Habibi, H.R.; Carnevali, O. Transgenerational effects of BPA on female reproduction. Sci. Total Environ. 2019, 685, 1294–1305. [Google Scholar] [CrossRef]
- Milla, S.; Wang, N.; Mandiki, S.N.M.; Kestemont, P. Corticosteroids: Friends or foes of teleost fish reproduction? Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2009, 153, 242–251. [Google Scholar] [CrossRef]
- Whirledge, S.; Cidlowski, J.A. Glucocorticoids and Reproduction: Traffic Control on the Road to Reproduction. Trends Endocrinol. Metab. 2017, 28, 399–415. [Google Scholar] [CrossRef]
- Pontes, J.T.; Maside, C.; Lima, L.F.; Magalhães-Padilha, D.M.; Padilha, R.T.; Matos, M.H.T.; Figueiredo, J.R.; Campello, C.C. Immunolocalization for glucocorticoid receptor and effect of cortisol on in vitro development of preantral follicles. Vet. Anim. Sci. 2019, 7, 100060. [Google Scholar] [CrossRef]
- Nordkap, L.; Almstrup, K.; Nielsen, J.E.; Bang, A.K.; Priskorn, L.; Krause, M.; Holmboe, S.A.; Winge, S.B.; Egeberg Palme, D.L.; Mørup, N.; et al. Possible involvement of the glucocorticoid receptor (NR3C1) and selected NR3C1 gene variants in regulation of human testicular function. Andrology 2017, 5, 1105–1114. [Google Scholar] [CrossRef]
- Faught, E.; Vijayan, M.M. Maternal stress and fish reproduction: The role of cortisol revisited. Fish Fish. 2018, 19, 1016–1030. [Google Scholar] [CrossRef]
- Facchinello, N.; Skobo, T.; Meneghetti, G.; Colletti, E.; Dinarello, A.; Tiso, N.; Costa, R.; Gioacchini, G.; Carnevali, O.; Argenton, F.; et al. Nr3c1 null mutant zebrafish are viable and reveal DNA-binding-independent activities of the glucocorticoid receptor. Sci. Rep. 2017, 7, 4371. [Google Scholar] [CrossRef] [PubMed]
- Gans, I.; Hartig, E.I.; Zhu, S.; Tilden, A.R.; Hutchins, L.; Maki, N.; Graber, J.H.; Coffman, J.A. Klf9 is a key feedforward regulator of the transcriptomic response to glucocorticoid receptor activity Ian Gans 1,2. bioRxiv 2019. [Google Scholar] [CrossRef]
- Giorgini, E.; Conti, C.; Ferraris, P.; Sabbatini, S.; Tosi, G.; Rubini, C.; Vaccari, L.; Gioacchini, G.; Carnevali, O. Effects of Lactobacillus rhamnosus on zebrafish oocyte maturation: An FTIR imaging and biochemical analysis. Anal. Bioanal. Chem. 2010, 398, 3063–3072. [Google Scholar] [CrossRef]
- Giorgini, E.; Gioacchini, G.; Conti, C.; Ferraris, P.; Sabbatini, S.; Tosi, G.; Piccinetti, C.C.; Vaccari, L.; Carnevali, O. The role of melatonin on zebrafish follicle development: An FT-IR imaging approach. Vib. Spectrosc. 2012, 62, 279–285. [Google Scholar] [CrossRef]
- Santangeli, S.; Maradonna, F.; Zanardini, M.; Notarstefano, V.; Gioacchini, G.; Forner-Piquer, I.; Habibi, H.; Carnevali, O. Effects of diisononyl phthalate on Danio rerio reproduction. Environ. Pollut. 2017, 231, 1051–1062. [Google Scholar] [CrossRef]
- Carnevali, O.; Santobuono, M.; Forner-Piquer, I.; Randazzo, B.; Mylonas, C.C.; Ancillai, D.; Giorgini, E.; Maradonna, F. Dietary diisononylphthalate contamination induces hepatic stress: A multidisciplinary investigation in gilthead seabream (Sparus aurata) liver. Arch. Toxicol. 2019, 93, 2361–2373. [Google Scholar] [CrossRef]
- Carnevali, O.; Giorgini, E.; Canuti, D.; Mylonas, C.C.; Forner-Piquer, I.; Maradonna, F. Diets contaminated with Bisphenol A and Di-isononyl phtalate modify skeletal muscle composition: A new target for environmental pollutant action. Sci. Total Environ. 2019, 658, 250–259. [Google Scholar] [CrossRef]
- Carnevali, O.; Candelma, M.; Sagrati, A.; Pignalosa, P.; Giorgini, E.; Gioacchini, G. Macromolecular Characterization of Swordfish Oocytes by FTIR Imaging Spectroscopy. Sci. Rep. 2019, 9, 8850. [Google Scholar] [CrossRef]
- Notarstefano, V.; Sabbatini, S.; Conti, C.; Pisani, M.; Astolfi, P.; Pro, C.; Rubini, C.; Vaccari, L.; Giorgini, E. Investigation of human pancreatic cancer tissues by Fourier Transform Infrared Hyperspectral Imaging. J. Biophotonics 2020, 13, e201960071. [Google Scholar] [CrossRef]
- Cole, T.J.; Blendy, J.A.; Monaghan, A.P. Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev. 1995, 9, 1608–1621. [Google Scholar] [CrossRef]
- Liu, Y.; Tang, H.; Xie, R.; Li, S.; Liu, X.; Lin, H.; Zhang, Y.; Cheng, C.H.K. Genetic evidence for multifactorial control of the reproductive axis in zebrafish. Endocrinology 2017, 158, 604–611. [Google Scholar] [CrossRef] [PubMed]
- Marvel, M.; Spicer, O.S.; Wong, T.T.; Zmora, N.; Zohar, Y. Knockout of the Gnrh genes in zebrafish: Effects on reproduction and potential compensation by reproductive and feeding-related neuropeptides. Biol. Reprod. 2018, 99, 565–577. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, C.V.; Yilmaz, O. Vitellogenesis and Yolk Proteins, Fish; Elsevier Ltd.: Amsterdam, The Netherlands, 2018; ISBN 9780128096338. [Google Scholar]
- Carnevali, O.; Mosconi, G.; Angelini, F.; Limatola, E.; Ciarcia, G.; Polzonetti-Magni, A. Plasma vitellogenin and 17β-estradiol levels during the annual reproductive cycle of Podarcis s. sicula Raf. Gen. Comp. Endocrinol. 1991, 84, 337–343. [Google Scholar] [CrossRef]
- Yilmaz, O.; Patinote, A.; Nguyen, T.; Bobe, J. Multiple vitellogenins in zebrafish (Danio rerio): Quantitative inventory of genes, transcripts and proteins, and relation to egg quality. Fish Physiol. Biochem. 2018, 44, 1509–1525. [Google Scholar] [CrossRef]
- Clelland, E.; Peng, C. Endocrine/paracrine control of zebrafish ovarian development. Mol. Cell. Endocrinol. 2009, 312, 42–52. [Google Scholar] [CrossRef]
- Kwok, H.-F.; So, W.-K.; Wang, Y.; Ge, W. Zebrafish Gonadotropins and Their Receptors: I. Cloning and Characterization of Zebrafish Follicle-Stimulating Hormone and Luteinizing Hormone Receptors—Evidence for Their Distinct Functions in Follicle Development1. Biol. Reprod. 2005, 72, 1370–1381. [Google Scholar] [CrossRef]
- Hayashi, Y.; Kobira, H.; Yamaguchi, T.; Shiraishi, E.; Yazawa, T.; Hirai, T.; Kamei, Y.; Kitano, T. High temperature causes masculinization of genetically female medaka by elevation of cortisol. Mol. Reprod. Dev. 2010, 77, 679–686. [Google Scholar] [CrossRef]
- Gao, L.; Zhao, F.; Zhang, Y.; Wang, W.; Cao, Q. Diminished ovarian reserve induced by chronic unpredictable stress in C57BL/6 mice. Gynecol. Endocrinol. 2020, 36, 49–54. [Google Scholar] [CrossRef]
- Wu, X.J.; Thomas, P.; Zhu, Y. Pgrmc1 knockout impairs oocyte maturation in zebrafish. Front. Endocrinol. 2018, 9, 560. [Google Scholar] [CrossRef]
- Tang, H.; Wang, L.; Chen, Y.; He, J.; Qu, L.; Guo, Y.; Liu, Y.; Liu, X.; Lin, H. Ovulation is associated with the LH-dependent induction of pla2g4aa in zebrafish. Mol. Cell. Endocrinol. 2018, 473, 53–60. [Google Scholar] [CrossRef]
- Horie, M.; Kotani, T. Formation of mos RNA granules in the zebrafish oocyte that differ from cyclin B1 RNA granules in distribution, density and regulation. Eur. J. Cell Biol. 2016, 95, 563–573. [Google Scholar] [CrossRef] [PubMed]
- Kotani, T.; Yasuda, K.; Ota, R.; Yamashita, M. Cyclin b1 mRNA translation is temporally controlled through formation and disassembly of RNA granules. J. Cell Biol. 2013, 202, 1041–1055. [Google Scholar] [CrossRef] [PubMed]
- Kondo, T.; Yanagawa, T.; Yoshida, N.; Yamashita, M.; Cerda, J.; Petrino, T.R.; Greenberg, M.J.; Wallace, R.A. Introduction of cyclin B induces activation of the maturation-promoting factor and breakdown of germinal vesicle in growing zebrafish oocytes unresponsive to the maturation-inducing hormone Pharmacology of the serotonergic inhibition of steroid-induced re. Mol. Reprod. Dev. 1997, 48, 282–291. [Google Scholar]
- Hu, K.L.; Zhao, H.; Chang, H.M.; Yu, Y.; Qiao, J. Kisspeptin/kisspeptin receptor system in the ovary. Front. Endocrinol. 2018, 8, 365. [Google Scholar] [CrossRef] [PubMed]
- Fernandois, D.; Na, E.; Cuevas, F.; Cruz, G.; Lara, H.E.; Paredes, A.H. Kisspeptin is involved in ovarian follicular development during aging in rats. J. Endocrinol. 2016, 228, 161–170. [Google Scholar] [CrossRef]
- Mayer, C.; Boehm, U. Female reproductive maturation in the absence of kisspeptin/GPR54 signaling. Nat. Neurosci. 2011, 14, 704–710. [Google Scholar] [CrossRef]
- Saadeldin, I.M.; Koo, O.J.; Kang, J.T.; Kwon, D.K.; Park, S.J.; Kim, S.J.; Moon, J.H.; Oh, H.J.; Jang, G.; Lee, B.C. Paradoxical effects of kisspeptin: It enhances oocyte in vitro maturation but has an adverse impact on hatched blastocysts during in vitro culture. Reprod. Fertil. Dev. 2012, 24, 656–668. [Google Scholar] [CrossRef]
- Byri, P.; Gangineni, A.; Reddy, K.R.; Raghavender, K.B.P. Effect of kisspeptin on in vitro maturation of sheep oocytes. Vet. World 2017, 10, 276–280. [Google Scholar] [CrossRef]
- Wu, T.; Patel, H.; Mukai, S.; Melino, C.; Garg, R.; Ni, X.; Chang, J.; Peng, C. Activin, Inhibin, and Follistatin in Zebrafish Ovary: Expression and Role in Oocyte Maturation1. Biol. Reprod. 2000, 62, 1585–1592. [Google Scholar] [CrossRef]
- Wang, Y.; Ge, W. Developmental Profiles of Activin βA, βB, and Follistatin Expression in the Zebrafish Ovary: Evidence for Their Differential Roles During Sexual Maturation and Ovulatory Cycle1. Biol. Reprod. 2004, 71, 2056–2064. [Google Scholar] [CrossRef]
- Chen, W.; Liu, L.; Ge, W. Expression analysis of growth differentiation factor 9 (Gdf9/gdf9), anti-müllerian hormone (Amh/amh) and aromatase (Cyp19a1a/cyp19a1a) during gonadal differentiation of the zebrafish, Danio rerio. Biol. Reprod. 2017, 96, 401–413. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.T.; Hong, W.S.; Chen, S.X.; Zhu, Y. Upregulation of adamts9 by gonadotropin in preovulatory follicles of zebrafish. Mol. Cell. Endocrinol. 2020, 499, 110608. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.T.; Carter, N.J.; Wu, X.J.; Hong, W.S.; Chen, S.X.; Zhu, Y. Progestin and Nuclear Progestin Receptor Are Essential for Upregulation of Metalloproteinase in Zebrafish Preovulatory Follicles. Front. Endocrinol. 2018, 9, 517. [Google Scholar] [CrossRef] [PubMed]
- Carnevali, O.; Conti, C.; Ferraris, P.; Garavaglia, M.G.; Gioacchini, G.; Giorgini, E.; Rubini, C.; Sabbatini, S.; Tosi, G. FT-IR Microspectroscopy on molecular building of Zebrafish oocytes. J. Mol. Struct. 2009, 938, 207–213. [Google Scholar] [CrossRef]
- Notarstefano, V.; Gioacchini, G.; Byrne, H.J.; Zacà, C.; Sereni, E.; Vaccari, L.; Borini, A.; Carnevali, O.; Giorgini, E. Vibrational characterization of granulosa cells from patients affected by unilateral ovarian endometriosis: New insights from infrared and Raman microspectroscopy. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2019, 212, 206–214. [Google Scholar] [CrossRef]
- Gioacchini, G.; Giorgini, E.; Vaccari, L.; Ferraris, P.; Sabbatini, S.; Bianchi, V.; Borini, A.; Carnevali, O. A new approach to evaluate aging effects on human oocytes: Fourier transform infrared imaging spectroscopy study. Fertil. Steril. 2014, 101, 120–127. [Google Scholar] [CrossRef]
- Gioacchini, G.; Notarstefano, V.; Sereni, E.; Zacà, C.; Coticchio, G.; Giorgini, E.; Vaccari, L.; Carnevali, O.; Borini, A. Does the molecular and metabolic profile of human granulosa cells correlate with oocyte fate? New insights by Fourier transform infrared microspectroscopy analysis. Mol. Hum. Reprod. 2018, 24, 521–532. [Google Scholar] [CrossRef]
- Faught, E.; Vijayan, M.M. Postnatal triglyceride accumulation is regulated by mineralocorticoid receptor activation under basal and stress conditions. J. Physiol. 2019, 597, 4927–4941. [Google Scholar] [CrossRef]
- Faught, E.; Vijayan, M.M. The mineralocorticoid receptor is essential for stress axis regulation in zebrafish larvae. Sci. Rep. 2018, 8, 18081. [Google Scholar] [CrossRef]
- Pikulkaew, S.; Benato, F.; Celeghin, A.; Zucal, C.; Skobo, T.; Colombo, L.; Dalla Valle, L. The knockdown of maternal glucocorticoid receptor mRNA alters embryo development in zebrafish. Dev. Dyn. 2011, 240, 874–889. [Google Scholar] [CrossRef]
- Nesan, D.; Kamkar, M.; Burrows, J.; Scott, I.C.; Marsden, M.; Vijayan, M.M. Glucocorticoid receptor signaling is essential for mesoderm formation and muscle development in zebrafish. Endocrinology 2012, 153, 1288–1300. [Google Scholar] [CrossRef]
- Berois, N.; Arezo, M.J.; Papa, N.G. Gamete interactions in teleost fish: The egg envelope. Basic studies and perspectives as environmental biomonitor. Biol. Res. 2011, 44, 119–124. [Google Scholar] [CrossRef] [PubMed]
- Selman, K.; Wallace, R.A.; Sarka, A.; Qi, X. Stages of oocyte development in the zebrafish, Brachydanio rerio. J. Morphol. 1993, 218, 203–224. [Google Scholar] [CrossRef] [PubMed]
- Gioacchini, G.; Maradonna, F.; Lombardo, F.; Bizzaro, D.; Olivotto, I.; Carnevali, O. Increase of fecundity by probiotic administration in zebrafish (Danio rerio). Reproduction 2010, 140, 953–959. [Google Scholar] [CrossRef] [PubMed]
- Santangeli, S.; Maradonna, F.; Gioacchini, G.; Cobellis, G.; Piccinetti, C.C.; Dalla Valle, L.; Carnevali, O. BPA-Induced Deregulation of Epigenetic Patterns: Effects on Female Zebrafish Reproduction. Sci. Rep. 2016, 6, 21982. [Google Scholar] [CrossRef] [PubMed]
- Forner-Piquer, I.; Maradonna, F.; Gioacchini, G.; Santangeli, S.; Allarà, M.; Piscitelli, F.; Habibi, H.R.; Di Marzo, V.; Carnevali, O. Dose-Specific Effects of Di-Isononyl Phthalate on the Endocannabinoid System and on Liver of Female Zebrafish. Endocrinology 2017, 158, 3462–3476. [Google Scholar] [CrossRef] [PubMed]
- Maradonna, F.; Ancillai, D.; Notarstefano, V.; Valenti, A.; Leoni, T.; Carnevali, O. An integrated approach to evaluate port sediment quality: From chemical characterization to multispecies bioassays. Sci. Total Environ. 2020, 746, 141204. [Google Scholar] [CrossRef] [PubMed]
- Carnevali, O.; Avella, M.A.; Gioacchini, G. Effects of probiotic administration on zebrafish development and reproduction. Gen. Comp. Endocrinol. 2012, 188, 297–302. [Google Scholar] [CrossRef]
- Yilmaz, O.; Patinote, A.; Nguyen, T.V.; Com, E.; Lavigne, R.; Pineau, C.; Sullivan, C.V.; Bobe, J. Scrambled eggs: Proteomic portraits and novel biomarkers of egg quality in zebrafish (Danio rerio). PLoS ONE 2017, 12, e0188084. [Google Scholar] [CrossRef]
- Randazzo, B.; Zarantoniello, M.; Gioacchini, G.; Giorgini, E.; Truzzi, C.; Notarstefano, V.; Cardinaletti, G.; Huyen, K.T.; Carnevali, O.; Olivotto, I. Can Insect-Based Diets Affect Zebrafish (Danio rerio) Reproduction? A Multidisciplinary Study. Zebrafish 2020, 17, 287–304. [Google Scholar] [CrossRef]
(a) | ||||
Brain-mRNA Expression (a.u.) | wt | gr−/− | ||
kiss 1 | 11.76 ± 2.13 a | 3.87 ± 2.94 b | ||
kiss 2 | 1.81 ± 0.19 a | 1.39 ± 0.57 a | ||
gnrh3 | 17.41 ± 9.84 a | 14.06 ± 14.76 a | ||
(b) | ||||
Liver-mRNA Expression (a.u.) | wt | gr−/− | ||
vtg1 | 2.42 ± 0.45 a | 2.28 ± 2.07 a | ||
vtg2 | 1.61 ± 0.59 a | 2.31 ± 1.75 a | ||
vtg3 | 1.61 ± 0.60 a | 6.64 ± 4.58 a | ||
vtg4 | 1.58 ± 0.59 a | 2.06 ± 1.11 a | ||
vtg5 | 1.57 ± 0.32 a | 2.87 ± 1.98 a | ||
vtg6 | 1.12± 0.28 a | 1.17 ± 0.98 a | ||
vtg7 | 1.57 ± 0.87 a | 2.06 ± 1.11 a | ||
(c) | ||||
Follicle-mRNA Expression (a.u) | III b | IV | ||
wt | gr−/− | wt | gr−/− | |
inhbaa | 9.24 ± 0.74 a | 8.32 ± 0.5 a | 5.3 ± 0.14 b | n.d |
inhbb | 4.39 ± 0.27 a | 3.06 ± 1.69 a | 6.4 ± 1.27 b | 1.37 ± 0.59 a |
gdf9 | 1.78 ± 0.61 a | 1.20± 0.15 a | 1.40 ±0.56 a | 1.42 ± 0.60 a |
pgrmc1 | 7.27 ± 0.61 a | 1.48 ± 0.45 b | 35.45 ± 2.57 c | 22.93 ± 2.93 d |
pgrmc2 | 5.33 ± 3.78 a | 12.45 ± 4.21 a | 38.34 ± 2.83 b | n.d. |
kiss1 | 3.23 ± 0.22 a | 4.67 ± 0.17 a | 35.0 ± 4.24 b | 2.24 ± 0.36 a |
kiss2 | 27.238 ± 11.27 a | 8.42 ± 4.71 b | 27.27 ± 0.38 a | 4.75 ± 3.18 b |
ccnb1 | 8.47 ± 0.26 a | 5.58 ± 0.81 b | 7.47 ± 0.55 a | 1.1 ± 0.14 c |
fshr | 1.95 ± 1.16 a | 3.13 ± 0.69 a | 2.81 ± 0.43 a | 18.19 ± 0.27 b |
lhcgr | 1.09 ± 0.09 a | 1.48 ± 0.30 a | 31.31 ± 2.16 b | 21.49 ± 3.18 c |
mmp9 | 1.87 ± 0.92 a | 2.17 ± 0.24 a | 5.18 ±1.89 b | n.d. |
wt III | gr−/− III | |
---|---|---|
LIP/CYT | 0.060 ± 0.013 a | 0.099 ± 0.012 b |
CH2CYT | 0.0050 ± 0.0011 a | 0.0069 ± 0.0010 b |
PRT/CYT | 0.40 ± 0.012 a | 0.39 ± 0.030 a |
COH/CYT | 0.00082 ± 0.00011 a | 0.00097 ± 0.00012 a |
CRT/CYT | 0.106 ± 0.019 a | 0.144 ± 0.021 b |
wt IV | gr−/− IV | |
---|---|---|
LIP/CYT | 0.091 ± 0.005 a | 0.112 ± 0.006 b |
CH2CYT | 0.0090 ± 0.0007 a | 0.0106 ± 0.0005 b |
FA/CYT | 0.0061 ± 0.0006 a | 0.0075 ± 0.0006 b |
PRT/CYT | 0.45 ± 0.011 a | 0.43 ± 0.016 a |
COH/CYT | 0.00123 ± 0.00011 a | 0.00137 ± 0.00012 a |
CRT/CYT | 0.034 ± 0.0024 a | 0.042 ± 0.0024 b |
wt ZR | gr−/− ZR | |
---|---|---|
LIP/ZR | 0.058 ± 0.008 a | 0.127 ± 0.022 b |
CH2/ZR | 0.0049 ± 0.0009 a | 0.0092 ± 0.0016 b |
FA/ZR | 0.0038 ± 0.0009 a | 0.0054 ± 0.0005 b |
PRT/ZR | 0.34 ± 0.024 a | 0.18 ± 0.020 b |
COH/ZR | 0.101 ± 0.014 a | 0.200 ± 0.051 b |
Gene | For Sequence 5′-3′ | Rew Sequence 5′-3′ | Accession Number | Primer Efficiency | Source |
---|---|---|---|---|---|
inhbaa | TGCTGCAAGCGACAATTTTA | CATTCGTTTCGGGACTCAAG | AF475092 | 87% | [42] |
inhbb | CAACTTAGATGGACACGCTG | GTGGATGTCGAGGTCTTGTC | X76051 | 85% | [42] |
fshr | GATTCTTCACCGTCTTCTCC | TGTAGCTGCTCAACTCAAACA | NM001001812.1 | 92% | [57] |
gdf9 | CGACCACAACCACCTCTCTCC | GGGACTGAGTGCTGGTGGATGCC | NM001012383.1 | 95% | |
lhgcr | GGCGAAGGCTAGATGGCACAT | TCGCAATCTGGTTCATCAATA | NM_205625.1 | 98% | |
pgrmc1 | CGGTTGTGATGGAGCAGATT | AGTAGCGCCAGTTCTGGTCA | NM_001007392.1 | 87% | |
pgrmc2 | ACAACGAGCTGCTGAATGTG | ATGGGCCAGTTCAGAGTGAG | NM_213104.1 | 87% | |
kiss1 | ACAGACACTCGTCCCACAGATG- | CAATCGTGTGAGCATGTCCTG | NM001113489.1 | 90% | [60] |
kiss2 | ATTCTCTTCATGTCTGCAATGGTCA | TGCTTCTCAGGTAAAGCATCATTG | NM001142585.1 | 93% | |
ccnb1 | GAAATGATGGCTCTCCGTGT | ACCACAGGTGCCTTCTCAAC | NM131513 | 80% | This paper |
gnrh3 | TTAGCATGGAGTGAAAAGGAAGGTTG | ACCACAGGTGCCTTCTCAAC | NM001177450.1 | 82% | [60] |
mmp9 | CATTAAAGATGCCCTGATGTATCCC | AGTGGTGGTCCGTGGTTGAG | NM213123 | 85% | [12] |
vtg1 | GATTAAGCGTACACTGAGACCA | AGCCACTTCTTGTCCAAATACT | NM001044897 | 90% | [61] |
vtg2 | TGCCGCATGAAACTTGAATCT | GTTCTTACTGGTGCACAGCC | NM001044913 | 91% | |
vtg3 | GGGAAAGGATTCAAGATGTTCAGA | ATTTGCTGATTTCAACTGGGAGAC | NM131265 | 99% | |
vtg4 | TCCAGACGGTACTTTCACCA | CTGACAGTTCTGCATCAACACA | NM001045294 | 87% | |
vtg5 | ATTGCCAAGAAAGAGCCCAA | TTCAGCCTCAAACAGCACAA | NM001025189 | 91% | |
vtg6 | TTTGGTGTGAGAACTGGAGG | CCAGTTTGTGAGTGCTTTCAG | NM001122610 | 89% | |
vtg7 | TTGGTGTGAGAACTGGAGGA | TTGCAAGTGCCTTCAGTGTA | NM001102671 | 93% | |
rplp0 | CTGAACATCTCGCCCTTCTC | TAGCCGATCTGCAGACACAC | NM131580.1 | 98% | [57] |
rpl13 | TCTGGAGGACTGTAAGAGGTATGC | AGACGCACAATCTTGAGAGCAG | NM_212784.1 | 98% | [16] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maradonna, F.; Gioacchini, G.; Notarstefano, V.; Fontana, C.M.; Citton, F.; Dalla Valle, L.; Giorgini, E.; Carnevali, O. Knockout of the Glucocorticoid Receptor Impairs Reproduction in Female Zebrafish. Int. J. Mol. Sci. 2020, 21, 9073. https://doi.org/10.3390/ijms21239073
Maradonna F, Gioacchini G, Notarstefano V, Fontana CM, Citton F, Dalla Valle L, Giorgini E, Carnevali O. Knockout of the Glucocorticoid Receptor Impairs Reproduction in Female Zebrafish. International Journal of Molecular Sciences. 2020; 21(23):9073. https://doi.org/10.3390/ijms21239073
Chicago/Turabian StyleMaradonna, Francesca, Giorgia Gioacchini, Valentina Notarstefano, Camilla Maria Fontana, Filippo Citton, Luisa Dalla Valle, Elisabetta Giorgini, and Oliana Carnevali. 2020. "Knockout of the Glucocorticoid Receptor Impairs Reproduction in Female Zebrafish" International Journal of Molecular Sciences 21, no. 23: 9073. https://doi.org/10.3390/ijms21239073
APA StyleMaradonna, F., Gioacchini, G., Notarstefano, V., Fontana, C. M., Citton, F., Dalla Valle, L., Giorgini, E., & Carnevali, O. (2020). Knockout of the Glucocorticoid Receptor Impairs Reproduction in Female Zebrafish. International Journal of Molecular Sciences, 21(23), 9073. https://doi.org/10.3390/ijms21239073