Molecular and Functional Characterization of Elovl4 Genes in Sparus aurata and Solea senegalensis Pointing to a Critical Role in Very Long-Chain (>C24) Fatty Acid Synthesis during Early Neural Development of Fish
Abstract
1. Introduction
2. Results
2.1. Elovl4 Sequence and Phylogenetic Analysis
2.2. Functional Characterization of Elovl4a and Elovl4b
2.3. Tissue Expression of Elovl4 Genes
3. Discussion
4. Materials and Methods
4.1. Molecular Cloning of Elovl4 cDNA Sequences
4.2. Sequence and Phylogenetic Analysis
4.3. Functional Characterization of Sa and Ss Elovl4 Isoforms
4.4. Fatty Acid Analysis
4.5. Tissue Expression of Elovl4 Genes in Gilthead Seabream and Senegalese Sole
4.5.1. Sample Preparation
4.5.2. Gene Expression Analysis by Reverse Transcriptase PCR (RT-PCR)
4.5.3. Gene Expression Analysis by Quantitative Real-Time PCR (qPCR)
4.6. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Monroig, Ó.; Tocher, D.R.; Castro, L.F.C. Polyunsaturated Fatty Acid Biosynthesis and Metabolism in Fish. In Polyunsaturated Fatty Acid Metabolism; Burdge, G.C., Ed.; Elsevier: Amsterdam, The Netherlands, 2018; pp. 31–60. [Google Scholar]
- Castro, L.F.C.; Tocher, D.R.; Monroig, Ó. Long-chain polyunsaturated fatty acid biosynthesis in chordates: Insights into the evolution of Fads and Elovl gene repertoire. Prog. Lipid Res. 2016, 62, 25–40. [Google Scholar] [CrossRef] [PubMed]
- Guillou, H.; Zadravec, D.; Martin, P.G.; Jacobsson, A. The key roles of elongases and desaturases in mammalian fatty acid metabolism: Insights from transgenic mice. Prog. Lipid Res. 2010, 49, 186–199. [Google Scholar] [CrossRef]
- Jakobsson, A.; Westerberg, R.; Jacobsson, A. Fatty acid elongases in mammals: Their regulation and roles in metabolism. Prog. Lipid Res. 2006, 45, 237–249. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wen, Z.; You, C.; Xie, Z.; Tocher, D.R.; Zhang, Y.; Wang, S.; Li, Y. Genome wide identification and functional characterization of two LC-PUFA biosynthesis elongase (elovl8) genes in rabbitfish (Siganus canaliculatus). Aquaculture 2020, 522, 735127. [Google Scholar] [CrossRef]
- Oboh, A. Investigating the Long-Chain Polyunsaturated Fatty Acid Biosynthesis of the African Catfish Clarias gariepinus (Burchell, 1822). Ph.D. Thesis, University of Stirling, Stirling, UK, 2018. [Google Scholar]
- Agbaga, M.P.; Mandal, M.N.A.; Anderson, R.E. Retinal very long-chain PUFAs: New insights from studies on ELOVL4 protein. J. Lipid Res. 2010, 51, 1624–1642. [Google Scholar] [CrossRef]
- Deák, F.; Anderson, R.E.; Fessler, J.L.; Sherry, D.M. Novel cellular functions of very long chain-fatty acids: Insight from ELOVL4 mutations. Front. Cell. Neurosci. 2019, 13, 428. [Google Scholar] [CrossRef]
- Monroig, Ó.; Rotllant, J.; Cerdá-Reverter, J.M.; Dick, J.R.; Figueras, A.; Tocher, D.R. Expression and role of Elovl4 elongases in biosynthesis of very long-chain fatty acids during zebrafish Danio rerio early embryonic development. Biochim. Biophys. Acta-Mol. Cell Biol. Lipids 2010, 1801, 1145–1154. [Google Scholar] [CrossRef]
- Oboh, A.; Navarro, J.C.; Tocher, D.R.; Monroig, Ó. Elongation of very long-chain (>C24) fatty acids in Clarias gariepinus: Cloning, functional characterization and tissue expression of elovl4 elongases. Lipids 2017, 52, 837–848. [Google Scholar] [CrossRef]
- Jin, M.; Monroig, Ó.; Navarro, J.C.; Tocher, D.R.; Zhou, Q.C. Molecular and functional characterisation of two elovl4 elongases involved in the biosynthesis of very long-chain (>C24) polyunsaturated fatty acids in black seabream Acanthopagrus schlegelii. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2017, 212, 41–50. [Google Scholar] [CrossRef] [PubMed]
- Torres, M.; Navarro, J.C.; Varó, I.; Agulleiro, M.J.; Morais, S.; Monroig, Ó.; Hontoria, F. Expression of genes related to long-chain (C18-22) and very long-chain (> C24) fatty acid biosynthesis in gilthead seabream (Sparus aurata) and Senegalese sole (Solea senegalensis) larvae: Investigating early ontogeny and nutritional regulation. Aquaculture 2020, 520, 734949. [Google Scholar] [CrossRef]
- Bazan, N.G. Docosanoids and elovanoids from omega-3 fatty acids are pro-homeostatic modulators of inflammatory responses, cell damage and neuroprotection. Mol. Asp. Med. 2018, 64, 18–33. [Google Scholar] [CrossRef] [PubMed]
- Hopiavuori, B.R.; Deák, F.; Wilkerson, J.L.; Brush, R.S.; Rocha-Hopiavuori, N.A.; Hopiavuori, A.R.; Ozan, K.G.; Sullivan, M.T.; Wren, J.D.; Georgescu, C.; et al. Homozygous expression of mutant ELOVL4 leads to seizures and death in a novel animal model of very long-chain fatty acid deficiency. Mol. Neurobiol. 2018, 55, 1795–1813. [Google Scholar] [CrossRef] [PubMed]
- Hopiavuori, B.R.; Anderson, R.E.; Agbaga, M.P. ELOVL4: Very long chain fatty acids serve an eclectic role in mammalian health and function. Prog. Retin. Eye Res. 2019, 69, 137–158. [Google Scholar] [CrossRef] [PubMed]
- Xie, D.; Chen, F.; Lin, S.; You, C.; Wang, S.; Zhang, Q.; Monroig, Ó.; Tocher, D.R.; Li, Y. Long-chain polyunsaturated fatty acid biosynthesis in the euryhaline herbivorous teleost Scatophagus argus: Functional characterization, tissue expression and nutritional regulation of two fatty acyl elongases. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2016, 198, 37–45. [Google Scholar] [CrossRef] [PubMed]
- Yan, J.; Liang, X.; Cui, Y.; Cao, X.; Gao, J. Elovl4 can effectively elongate C18 polyunsaturated fatty acids in loach Misgurnus anguillicaudatus. Biochem. Biophys. Res. Commun. 2018, 495, 2637–2642. [Google Scholar] [CrossRef]
- Mourente, G. Accumulation of DHA (docosahexaenoic acid; 22:6n-3) in larval and juvenile fish brain. In The Big Fish Bang; Howard, I.B., Ed.; Norwegian Institute of Marine Research: Bergen, Norway, 2003; pp. 239–248. [Google Scholar]
- Stoknes, I.S.; Økland, H.M.W.; Falch, E.; Synnes, M. Fatty acid and lipid class composition in eyes and brain from teleosts and elasmobranchs. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2004, 138, 183–191. [Google Scholar] [CrossRef]
- Tocher, D.R.; Harvie, D.G. Fatty acid compositions of the major phosphoglycerides from fish neural tissues; (n-3) and (n-6) polyunsaturated fatty acids in rainbow trout (Salmo gairdneri) and cod (Gadus morhua) brains and retinas. Fish Physiol. Biochem. 1988, 5, 229–239. [Google Scholar] [CrossRef]
- Seiliez, I.; Panserat, S.; Corraze, G.; Kaushik, S.; Bergot, P. Cloning and nutritional regulation of a Δ6-desaturase-like enzyme in the marine teleost gilthead seabream (Sparus aurata). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2003, 135, 449–460. [Google Scholar] [CrossRef]
- Zheng, X.; Seiliez, I.; Hastings, N.; Tocher, D.R.; Panserat, S.; Dickson, C.A.; Bergot, P.; Teale, A.J. Characterization and comparison of fatty acyl Δ6 desaturase cDNAs from freshwater and marine teleost fish species. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2004, 139, 269–279. [Google Scholar] [CrossRef]
- Agaba, M.K.; Tocher, D.R.; Zheng, X.; Dickson, C.A.; Dick, J.R.; Teale, A.J. Cloning and functional characterisation of polyunsaturated fatty acid elongases of marine and freshwater teleost fish. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2005, 142, 342–352. [Google Scholar] [CrossRef]
- Morais, S.; Castanheira, F.; Martinez-Rubio, L.; Conceição, L.E.C.; Tocher, D.R. Long-chain polyunsaturated fatty acid synthesis in a marine vertebrate: Ontogenetic and nutritional regulation of a fatty acyl desaturase with Δ4 activity. Biochim. Biophys. Acta-Mol. Cell Biol. Lipids 2012, 1821, 660–671. [Google Scholar] [CrossRef]
- Sprecher, H. Metabolism of highly unsaturated n-3 and n-6 fatty acids. Biochim. Biophys. Acta-Mol. Cell Biol. Lipids 2000, 1486, 219–231. [Google Scholar] [CrossRef]
- Agaba, M.; Tocher, D.R.; Dickson, C.A.; Dick, J.R.; Teale, A.J. Zebrafish cDNA encoding multifunctional fatty acid elongase involved in production of eicosapentaenoic (20:5n-3) and docosahexaenoic (22:6n-3) acids. Mar. Biotechnol. 2004, 6, 251–261. [Google Scholar] [CrossRef] [PubMed]
- Marchler-Bauer, A.; Bo, Y.; Han, L.; He, J.; Lanczycki, C.J.; Lu, S.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; et al. CDD/SPARCLE: Functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017, 4, D200–D203. [Google Scholar] [CrossRef]
- Cook, H.W.; Mcmaster, C.R. Fatty acid desaturation and chain elongation in eukaryotes. In Biochemistry of Lipids, Lipoproteins and Membranes, 4th ed.; Vance, D.E., Vance, J.E., Eds.; Elsevier: Amsterdam, The Netherlands, 2002; Volume 36, pp. 181–204. [Google Scholar]
- Betancor, M.B.; Oboh, A.; Ortega, A.; Mourente, G.; Navarro, J.C.; de la Gandara, F.; Tocher, D.R.; Monroig, Ó. Molecular and functional characterisation of a putative elovl4 gene and its expression in response to dietary fatty acid profile in Atlantic bluefin tuna (Thunnus thynnus). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2020, 240, 110372. [Google Scholar] [CrossRef] [PubMed]
- Monroig, Ó.; Webb, K.; Ibarra-Castro, L.; Holt, G.J.; Tocher, D.R. Biosynthesis of long-chain polyunsaturated fatty acids in marine fish: Characterization of an Elovl4-like elongase from cobia Rachycentron canadum and activation of the pathway during early life stages. Aquaculture 2011, 312, 145–153. [Google Scholar] [CrossRef]
- Zhao, N.; Monroig, Ó.; Navarro, J.C.; Xiang, X.; Li, Y.; Du, J.; Li, J.; Xu, W.; Mai, K.; Ai, Q. Molecular cloning, functional characterization and nutritional regulation of two elovl4b elongases from rainbow trout (Oncorhynchus mykiss). Aquaculture 2019, 511, 734221. [Google Scholar] [CrossRef]
- Carmona-Antoñanzas, G.; Monroig, Ó.; Dick, J.R.; Davie, A.; Tocher, D.R. Biosynthesis of very long-chain fatty acids (C>24) in Atlantic salmon: Cloning, functional characterisation, and tissue distribution of an Elovl4 elongase. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2011, 159, 122–129. [Google Scholar] [CrossRef]
- Kabeya, N.; Yamamoto, Y.; Cummins, S.F.; Elizur, A.; Yazawa, R.; Takeuchi, Y.; Haga, Y.; Satoh, S.; Yoshizaki, G. Polyunsaturated fatty acid metabolism in a marine teleost, Nibe croaker Nibea mitsukurii: Functional characterization of Fads2 desaturase and Elovl5 and Elovl4 elongases. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2015, 188, 37–45. [Google Scholar] [CrossRef]
- Li, S.; Monroig, Ó.; Wang, T.; Yuan, Y.; Navarro, J.C.; Hontoria, F.; Liao, K.; Tocher, D.R.; Mai, K.; Xu, W.; et al. Functional characterization and differential nutritional regulation of putative Elovl5 and Elovl4 elongases in large yellow croaker (Larimichthys crocea). Sci. Rep. 2017, 7, 1–15. [Google Scholar] [CrossRef]
- Li, S.; Monroig, Ó.; Navarro, J.C.; Yuan, Y.; Xu, W.; Mai, K.; Tocher, D.R.; Ai, Q. Molecular cloning and functional characterization of a putative Elovl4 gene and its expression in response to dietary fatty acid profiles in orange-spotted grouper Epinephelus coioides. Aquac. Res. 2017, 48, 537–552. [Google Scholar] [CrossRef]
- Agbaga, M.P.; Brush, R.S.; Mandal, M.N.A.; Henry, K.; Elliott, M.H.; Anderson, R.E. Role of Stargardt-3 macular dystrophy protein (ELOVL4) in the biosynthesis of very long chain fatty acids. Proc. Natl. Acad. Sci. USA 2008, 105, 12843–12848. [Google Scholar] [CrossRef] [PubMed]
- Monroig, Ó.; De Llanos, R.; Varó, I.; Hontoria, F.; Tocher, D.R.; Puig, S.; Navarro, J.C. Biosynthesis of polyunsaturated fatty acids in Octopus vulgaris: Molecular cloning and functional characterisation of a stearoyl-CoA desaturase and an elongation of very long-chain fatty acid 4 protein. Mar. Drugs 2017, 15, 82. [Google Scholar] [CrossRef] [PubMed]
- Benitez-Santana, T.; Masuda, R.; Carrillo, E.J.; Ganuza, E.; Valencia, A.; Hernandez-Cruz, C.M.; Izquierdo, M.S. Dietary n-3 HUFA deficiency induces a reduced visual response in gilthead seabream Sparus aurata larvae. Aquaculture 2007, 264, 408–417. [Google Scholar] [CrossRef]
- Suh, M.; Clandinin, M.T. 20:5n-3 but not 22:6n-3 is a Preferred Substrate for Synthesis of n-3 Very-Long- Chain Fatty Acids (C24-C36) in Retina. Curr. Eye Res. 2005, 30, 959–968. [Google Scholar] [CrossRef]
- Monroig, Ó.; Hontoria, F.; Varó, I.; Tocher, D.R.; Navarro, J.C. Biosynthesis of very long -chain (>24C) polyunsaturated fatty acids in juveniles of gilthead seabream (Sparus aurata). In Proceedings of the 17th International Symposium on Fish Nutrition and Feeding, Sun Valley, ID, USA, 6–10 June 2016. [Google Scholar]
- Garlito, B.; Portolés, T.; Niessen, W.M.A.; Navarro, J.C.; Hontoria, F.; Monroig, Ó.; Varó, I.; Serrano, R. Identification of very long-chain (>C24) fatty acid methyl esters using gas chromatography coupled to quadrupole/time-of-flight mass spectrometry with atmospheric pressure chemical ionization source. Anal. Chim. Acta. 2019, 1051, 103–109. [Google Scholar] [CrossRef]
- Torres, M.; Navarro, J.C.; Varó, I.; Monroig, Ó.; Hontoria, F. Nutritional regulation of genes responsible for long-chain (C20-24) and very long-chain (> C24) polyunsaturated fatty acid biosynthesis in post-larvae of gilthead seabream (Sparus aurata) and Senegalese sole (Solea senegalensis). Aquaculture 2020, 525, 735314. [Google Scholar] [CrossRef]
- Poulos, A.; Sharp, P.; Johnson, D.; Easton, C. The occurrence of polyenoic very long chain fatty acids with greater than 32 carbon atoms in molecular species of phosphatidylcholine in normal and peroxisome-deficient (Zellweger’s syndrome) brain. Biochem. J. 1988, 253, 645–650. [Google Scholar] [CrossRef]
- Mandal, M.N.A.; Ambasudhan, R.; Wong, P.W.; Gage, P.J.; Sieving, P.A.; Ayyagari, R. Characterization of mouse orthologue of ELOVL4: Genomic organization and spatial and temporal expression. Genomics 2004, 83, 626–635. [Google Scholar] [CrossRef]
- Tocher, D.R. Metabolism and functions of lipids and fatty acids in teleost fish. Rev. Fish. Sci. 2003, 11, 107–184. [Google Scholar] [CrossRef]
- Bennett, L.D.; Brush, R.S.; Chan, M.; Lydic, T.A.; Reese, K.; Reid, G.E.; Busik, J.V.; Elliott, M.H.; Anderson, R.E. Effect of reduced retinal VLC-PUFA on rod and cone photoreceptors. Investig. Ophthalmol. Vis. Sci. 2014, 55, 3150–3157. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lim, L.; Mukai, Y. Morphogenesis of sense organs and behavioural changes in larvae of the brown-marbled grouper Epinephelus fuscoguttatus (Forsskål). Mar. Freshw. Behav. Physiol. 2014, 6244, 1–15. [Google Scholar]
- Hu, J.; Liu, Y.; Ma, Z.; Qin, J.G. Feeding and Development of Warm Water Marine Fish Larvae in Early Life. In Emerging Issues in Fish Larvae Research; Yúfera, M., Ed.; Springer: New York, NY, USA, 2018; pp. 275–296. [Google Scholar]
- Turkmen, S.; Castro, P.L.; Caballero, M.J.; Hernández-Cruz, C.M.; Saleh, R.; Zamorano, M.J.; Regidor, J.; Izquierdo, M. Nutritional stimuli of gilthead seabream (Sparus aurata) larvae by dietary fatty acids: Effects on larval performance, gene expression and neurogenesis. Aquac. Res. 2017, 48, 202–213. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for General users and for biologist programmers. In Bioinformatics Methods and Protocols; Misener, S., Krawetz, S.A., Eds.; Humana Press: Totowa, NJ, USA, 2000; Volume 132, pp. 365–386. [Google Scholar]
- Jones, D.T.; Taylor, W.R.; Thornton, J.M. The rapid generation of mutation data matrices from protein sequences. Bioinformatics 1992, 8, 275–282. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Folch, J.; Lees, M.; Sloane, G.H. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, r0034. [Google Scholar] [CrossRef] [PubMed]



| FA | Elovl4a | Elovl4b | Control |
|---|---|---|---|
| 24:0 | 14.6 a | 11.3 a | 12.1 a |
| 26:0 | 49.5 b | 68.2 a | 75.0 a |
| 28:0 | 20.8 c | 14.1 b | 8.6 a |
| 30:0 | 11.0 b | 4.5 a | 2.7 a |
| 32:0 | 3.3 b | 1.5 a | 1.0 a |
| 34:0 | 0.7 a | 0.3 a | 0.3 a |
| FA | Elovl4a | Elovl4b | Control |
|---|---|---|---|
| 24:0 | 9.2 b | 9.5 b | 6.1 a |
| 26:0 | 72.1 b | 81.2 b | 58.3 a |
| 28:0 | 11.9 b | 5.7 c | 21.7 a |
| 30:0 | 5.5 b | 2.9 b | 11.5 a |
| 32:0 | 1.4 ab | 0.7 b | 2.4 a |
| 34:0 | 0.0 a | 0.0 a | 0.0 a |
| FA Substrate | Product | Elovl4a | Elovl4b |
|---|---|---|---|
| % Conversion | % Conversion | ||
| 18:4n-3 | 20:4n-3 | 2.5 | 2.7 |
| 22:4n-3 | 9.7 | 12.5 | |
| 24:4n-3 | 5.6 | 49.9 | |
| 26:4n-3 | n.d. | 65.6 | |
| 28:4n-3 | n.d. | n.d. | |
| 30:4n-3 | n.d. | n.d. | |
| 32:4n-3 | n.d. | n.d. | |
| 34:4n-3 | n.d. | n.d. | |
| 36:4n-3 | n.d. | n.d. | |
| 18:3n-6 | 20:3n-6 | 2.6 | 2.1 |
| 22:3n-6 | 21.6 | 9.6 | |
| 24:3n-6 | 52.5 | n.d. | |
| 26:3n-6 | 57.1 | n.d. | |
| 28:3n-6 | 64.8 | n.d. | |
| 30:3n-6 | 90.0 | n.d. | |
| 32:3n-6 | 84.1 | n.d. | |
| 34:3n-6 | 41.3 | n.d. | |
| 36:3n-6 | n.d. | n.d. | |
| 20:5n-3 | 22:5n-3 | 5.8 | 9.1 |
| 24:5n-3 | 17.2 | 33.3 | |
| 26:5n-3 | 20.0 | 57.8 | |
| 28:5n-3 | n.d. | 86.8 | |
| 30:5n-3 | n.d. | 97.7 | |
| 32:5n-3 | n.d. | 72.7 | |
| 34:5n-3 | n.d. | 8.1 | |
| 36:5n-3 | n.d. | n.d. | |
| 20:4n-6 | 22:4n-6 | 10.9 | 8.9 |
| 24:4n-6 | 31.0 | 30.2 | |
| 26:4n-6 | 37.1 | 55.9 | |
| 28:4n-6 | 39.0 | 81.0 | |
| 30:4n-6 | 88.6 | 37.8 | |
| 32:4n-6 | 83.6 | n.d. | |
| 34:4n-6 | 73.7 | n.d. | |
| 36:4n-6 | 11.4 | n.d. | |
| 22:5n-3 | 24:5n-3 | 3.4 | 12.6 |
| 26:5n-3 | 19.8 | 52.2 | |
| 28:5n-3 | 26.0 | 86.3 | |
| 30:5n-3 | 85.6 | 96.5 | |
| 32:5n-3 | 74.2 | 64.4 | |
| 34:5n-3 | 63.0 | 5.3 | |
| 36:5n-3 | n.d. | n.d. | |
| 22:4n-6 | 24:4n-6 | 8.2 | 10.4 |
| 26:4n-6 | 35.1 | 43.1 | |
| 28:4n-6 | 45.5 | 71.8 | |
| 30:4n-6 | 90.8 | 83.0 | |
| 32:4n-6 | 78.7 | 19.5 | |
| 34:4n-6 | 54.6 | n.d. | |
| 36:4n-6 | 7.2 | n.d. | |
| 22:6n-3 | 24:6n-3 | 0.4 | 1.8 |
| 26:6n-3 | n.d. | 100 | |
| 28:6n-3 | n.d. | 100 | |
| 30:6n-3 | n.d. | 40.2 | |
| 32:6n-3 | n.d. | 61.3 | |
| 34:6n-3 | n.d. | n.d. | |
| 36:6n-3 | n.d. | n.d. |
| FA substrate | Product | Elovl4a | Elovl4b |
|---|---|---|---|
| % Conversion | % Conversion | ||
| 18:4n-3 | 20:4n-3 | 4.5 | 8.1 |
| 22:4n-3 | 19.6 | 41.2 | |
| 24:4n-3 | 39.5 | 79.0 | |
| 26:4n-3 | 39.6 | 95.3 | |
| 28:4n-3 | 100 | 96.8 | |
| 30:4n-3 | 100 | 98.7 | |
| 32:4n-3 | 65.4 | 65.7 | |
| 34:4n-3 | n.d. | 1.7 | |
| 36:4n-3 | n.d. | n.d. | |
| 18:3n-6 | 20:3n-6 | 4.6 | 6.2 |
| 22:3n-6 | 38.6 | 40.8 | |
| 24:3n-6 | 66.2 | 66.0 | |
| 26:3n-6 | 65.3 | 89.1 | |
| 28:3n-6 | 100 | 91.9 | |
| 30:3n-6 | 55.0 | 90.4 | |
| 32:3n-6 | 62.7 | 17.8 | |
| 34:3n-6 | n.d. | n.d. | |
| 36:3n-6 | n.d. | n.d. | |
| 20:5n-3 | 22:5n-3 | 12.1 | 30.9 |
| 24:5n-3 | 31.8 | 75.1 | |
| 26:5n-3 | 35.7 | 87.4 | |
| 28:5n-3 | 100 | 96.9 | |
| 30:5n-3 | 50.0 | 98.9 | |
| 32:5n-3 | 33.7 | 82.9 | |
| 34:5n-3 | 38.2 | 14.5 | |
| 36:5n-3 | n.d. | n.d. | |
| 20:4n-6 | 22:4n-6 | 18.1 | 33.1 |
| 24:4n-6 | 49.9 | 73.4 | |
| 26:4n-6 | 56.7 | 85.1 | |
| 28:4n-6 | 65.2 | 94.3 | |
| 30:4n-6 | 95.2 | 95.9 | |
| 32:4n-6 | 84.9 | 51.8 | |
| 34:4n-6 | 25.3 | 2.7 | |
| 36:4n-6 | n.d. | n.d. | |
| 22:5n-3 | 24:5n-3 | 7.8 | 44.3 |
| 26:5n-3 | 33.9 | 87.9 | |
| 28:5n-3 | 51.2 | 97.0 | |
| 30:5n-3 | 92.3 | 99.0 | |
| 32:5n-3 | 27.4 | 82.5 | |
| 34:5n-3 | 32.4 | 16.2 | |
| 36:5n-3 | n.d. | n.d. | |
| 22:4n-6 | 24:4n-6 | 13.5 | 37.2 |
| 26:4n-6 | 58.3 | 85.5 | |
| 28:4n-6 | 71.8 | 94.5 | |
| 30:4n-6 | 94.5 | 96.3 | |
| 32:4n-6 | 21.6 | 53.9 | |
| 34:4n-6 | 25.9 | 5.0 | |
| 36:4n-6 | n.d. | n.d. | |
| 22:6n-3 | 24:6n-3 | 0.6 | 5.1 |
| 26:6n-3 | n.d. | 100 | |
| 28:6n-3 | n.d. | 100 | |
| 30:6n-3 | n.d. | 100 | |
| 32:6n-3 | n.d. | 22.3 | |
| 34:6n-3 | n.d. | n.d. | |
| 36:6n-3 | n.d. | n.d. |
| Sparus aurata | |||||
| Aim | Primer | Sequence (5′–3′) | Ta | PCR Cycles | Extension Time |
| First fragment | UNIelovl4a-F | TGATGGACAACCCCCTGC | 57 °C | 35 | 1 min |
| UNIelovl4a-R | GCAGATGAGGGAGTAGTGCAT | 57 °C | 35 | 1 min | |
| UNIelovl4b-F | ATGGAGCCTTACTATAGCAGAC | 55 °C | 35 | 1 min | |
| UNIelovl4b-R | GCGAAGAGGATGATGAAGGT | 55 °C | 35 | 1 min | |
| 5′ RACE PCR | SaE4a-5R-R1 | TTCTTCATGTACTTGGGCCC | 60 °C | 32 | 2 min 30 s |
| SaE4a-5R-R2 | AGAGGAACAGCAGGTAGGAGG | 60 °C | 32 | 2 min 30 s | |
| SaE4b-5R-R1 | AGGTACAGGCAGCTGATGG | 58 °C | 32 | 2 min 30 s | |
| SaE4b-5R-R2 | GAGATGACATCATGGGCCA | 60 °C | 32 | 2 min 30 s | |
| 3′ RACE PCR | SaE4a-3R-F1 | GTGGACCCAAGATCCAGAAG | 60 °C | 32 | 2 min 30 s |
| SaE4a-3R-F2 | TGTCCCTCTACGTCAACTGC | 60 °C | 32 | 2 min 30 s | |
| SaE4b-3R-F1 | TACCTCACCATCATCCAGATG | 58 °C | 32 | 2 min 30 s | |
| SaE4b-3R-F2 | CTCTACACAGGCTGCCCATT | 60 °C | 32 | 2 min 30 s | |
| ORF Cloning | SaE4a-U-F1 | GATCTTTAAAGCGCCGACAC | 56 °C | 32 | 2 min 40 s |
| SaE4a-U-R1 | TCCGGCTAAATCTTCCTCAA | 56 °C | 32 | 2 min 40 s | |
| SaE4a-V-F2 | CCCGAATTCACCATGGAGATTGTCACACA | 60 °C | 32 | 2 min | |
| SaE4a-V-R2 | CCGCTCGAGCTCTAATCTCTTTTAGCCCTT | 60 °C | 32 | 2 min | |
| SaE4b-U-F1 | AATCGAGACCAAAGGCAGAG | 56 °C | 32 | 2 min 40 s | |
| SaE4b-U-R1 | CTCTGTTAATCGCCGAGCAC | 56 °C | 32 | 2 min 40 s | |
| SaE4b-V-F2 | CCCGAATTCACCATGGAGGTTGTAACACA | 60 °C | 32 | 2 min | |
| SaE4b-V-R2 | CCGCTCGAGCCTCTTCCTTCTTTACTCCC | 60 °C | 32 | 2 min | |
| Solea senegalensis | |||||
| Aim | Primer | Sequence (5′–3′) | Ta | PCR Cycles | Extension Time |
| 3′ RACE PCR | SsE4a-3R-F1 | GGAGGAGAAAGAGGAAAGG | 60 °C | 35 | 2 min 30 s |
| SsE4a-3R-F2 | GAAAGGAAGAGCTAAAAGAGA | 60 °C | 35 | 2 min 30 s | |
| SsE4b-3R-F1 | CGGTCACCTTCATCATCCTC | 60 °C | 35 | 2 min 30 s | |
| SsE4b-3R-F2 | ATGCCTTCCTACACCCAGAA | 60 °C | 35 | 2 min 30 s | |
| ORF Cloning | SsE4a-U-F1 | ACTGGATCACGACCACAACC | 55 °C | 32 | 2 min 15 s |
| SsE4a-U-R1 | TCCCAACACAGGCACATCTC | 55 °C | 32 | 2 min 15 s | |
| SsE4a-V-F2 | CCCAAGCTTACCATGGAGATTGTCACACATTTA | 55 °C | 32 | 2 min | |
| SsE4a-V-R2 | CCGCTCGAGTTAATCTCTTTTAGCTCTTCCTTTC | 55 °C | 32 | 2 min | |
| SsE4b-U-F1 | CGGGGAGGAGGAGAAGAAGA | 55 °C | 32 | 2 min 15 s | |
| SsE4b-U-R1 | AGCAATCCCCTTGACCGTTT | 55 °C | 32 | 2 min 15 s | |
| SsE4b-V-F2 | CCCAAGCTTACCATGGAGGTTGTAACACATTTTG | 55 °C | 32 | 2 min | |
| SsE4b-V-R2 | CCGCTCGAGTTACTCTCTTTTGGCTCTTCCTT | 55 °C | 32 | 2 min | |
| Sparus aurata | ||||||
| Aim | Transcript | Primer | Primer Sequence (5′–3′) | Ta | Fragment | Accession No |
| RT-PCR | elovl4a | F | GCCCAAGTACATGAAGAACAGAG | 60 °C | 563 bp | MK610320 |
| R | GGGAGTAGTGCATCCAGTGG | |||||
| elovl4b | F | GTCAAGTACTCCAACGATGTCAA | 60 °C | 394 bp | MK610321 | |
| R | GGAATGGGCAGCCTGTGT | |||||
| 18s | F | TCCTTTGATCGCTCTACCGT | 60 °C | 460 bp | AY993930.1 | |
| R | TGCCCTCCAATTGATCCTCG | |||||
| qPCR | elovl4a | F | GCCCAAGTACATGAAGAACAGAG | 60 °C | 169 bp | MK610320 |
| R | ACCTGATGAGTCTGCTGGGG | |||||
| elovl4b | F | GTCAAGTACTCCAACGATGTCAA | 60 °C | 247 bp | MK610321 | |
| R | GAGAAGGTAGGTACACGAGT | |||||
| Actb | F | TGCGTGACATCAAGGAGAAG | 60 °C | 190 bp | X89920 | |
| R | AAGGAGCCATACCTCAGGAC | |||||
| Solea senegalensis | ||||||
| Aim | Transcript | Primer | Primer Sequence (5′–3′) | Ta | Fragment | Accession No |
| RT-PCR | elovl4a | F | TGCACTACTCCCTCATCTGC | 60 °C | 497 bp | MN164537 |
| R | TGAAAACAGCCACCTTAGGC | |||||
| elovl4b | F | CCTCTGCCTTGTCCAGTTTC | 60 °C | 175 bp | MN164625 | |
| R | TCCTTGACCCGTAGTTTAAC | |||||
| 18s | F | TCAGACCCAAAACCCATGCG | 60 °C | 464 bp | EF126042.1 | |
| R | CCCGAGATCCAACTACGAGC | |||||
| qPCR | elovl4a | F | AGGTGAGGTAGGGCCTTGTT | 60 °C | 220 bp | MN164537 |
| R | CGGATTCCACCGACAAAAGT | |||||
| elovl4b | F | CCTCTGCCTTGTCCAGTTTC | 60 °C | 175 bp | MN164625 | |
| R | TCCTTGACCCGTAGTTTAAC | |||||
| Actb | F | ACAATGAGCTGAGAGTCGCC | 60 °C | 132 bp | DQ485686 | |
| R | ATGGGGGCGGTACATACAAC | |||||
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morais, S.; Torres, M.; Hontoria, F.; Monroig, Ó.; Varó, I.; Agulleiro, M.J.; Navarro, J.C. Molecular and Functional Characterization of Elovl4 Genes in Sparus aurata and Solea senegalensis Pointing to a Critical Role in Very Long-Chain (>C24) Fatty Acid Synthesis during Early Neural Development of Fish. Int. J. Mol. Sci. 2020, 21, 3514. https://doi.org/10.3390/ijms21103514
Morais S, Torres M, Hontoria F, Monroig Ó, Varó I, Agulleiro MJ, Navarro JC. Molecular and Functional Characterization of Elovl4 Genes in Sparus aurata and Solea senegalensis Pointing to a Critical Role in Very Long-Chain (>C24) Fatty Acid Synthesis during Early Neural Development of Fish. International Journal of Molecular Sciences. 2020; 21(10):3514. https://doi.org/10.3390/ijms21103514
Chicago/Turabian StyleMorais, Sofia, Miguel Torres, Francisco Hontoria, Óscar Monroig, Inma Varó, María José Agulleiro, and Juan Carlos Navarro. 2020. "Molecular and Functional Characterization of Elovl4 Genes in Sparus aurata and Solea senegalensis Pointing to a Critical Role in Very Long-Chain (>C24) Fatty Acid Synthesis during Early Neural Development of Fish" International Journal of Molecular Sciences 21, no. 10: 3514. https://doi.org/10.3390/ijms21103514
APA StyleMorais, S., Torres, M., Hontoria, F., Monroig, Ó., Varó, I., Agulleiro, M. J., & Navarro, J. C. (2020). Molecular and Functional Characterization of Elovl4 Genes in Sparus aurata and Solea senegalensis Pointing to a Critical Role in Very Long-Chain (>C24) Fatty Acid Synthesis during Early Neural Development of Fish. International Journal of Molecular Sciences, 21(10), 3514. https://doi.org/10.3390/ijms21103514

